how to replace a list of headers in fasta file that are not in order

That is how my fasta file looks like:

>monCan3F9-B-G1795-Map9
TTTATTATACCCTGAACCCATTAAAA(multiple lines)
>monJX13F48-L-B718-Map1
AAAATTAATTCAGAATTATGTTTG(multiple lines)
.
.
.

the list of new names are not in the same order as in the fasta file, so I have to define it like this e.g. :

monCan3F9-B-G1795-Map9 > BARI1#DNA/Tc1-Mariner

monJX13F48-L-B718-Map1 > PARIS#LTR


. 

.

for a few names, I could do that manually using ‘sed’ but I don’t know how to do it when I have about 1000 of them!
I tried to check samtools manual but as far as I understood it requires sam and bam files, is there any other toolkit to do such a thing?