MYO10 drives genomic instability and inflammation in cancer – Open Source Biology & Genetics Interest Group

INTRODUCTION

Genomic instability often refers to the existence of a variety of DNA alterations, ranging from single nucleotide changes (such as base substitution, deletion, and insertion) to chromosomal rearrangements (e.g., gain or loss of a segment or the whole chromosome) (1). Loss of genome stability can lead to early onset or accelerate the progression of degenerative diseases including premature aging and cancer. Genomic instability is a hallmark of most human cancers and generally correlates with cancer patient prognosis and therapy selection (2, 3). However, our understanding about how genomic instability is regulated and how it promotes tumor development remains incomplete.

Because of the location of DNA/chromosomes in the nucleus, genomic instability has been conventionally considered to be a pathophysiological event that takes place in the nucleus, where DNA sequence, chromosome number, and/or structures are altered by endogenous or exogenous stimuli. For instance, carcinogens or irradiation can directly damage DNA; mutations in genes controlling DNA replication, repair, or chromosomal segregation cause DNA/chromosomal instability; and defects in the nuclear structure alter chromosome territory and impair chromosomal metabolism (4). Recent evidence suggests that the cytosol-nucleus connection network, or the so-called linker of nucleoskeleton and cytoskeleton (LINC) complex, also affects genome stability (5). The LINC complex contains sad1 unc-84 domain protein 1 (SUN) proteins that span the inner nuclear membrane and connect to the nuclear lamina and Nesprin proteins that are tail-anchored to the outer nuclear membrane and connect to SUN proteins in the lumenal region of the nuclear envelope (6–8). The cytoskeletal networks to which the LINC complex connects through Nesprin proteins include microtubules, intermediate filaments, and actin fibers (8). Mutation in genes involved in the LINC complex or the nuclear envelope has been shown to result in abnormal nuclear morphology, transcriptional deregulation, and DNA repair defect, highlighting the importance of a delicate cytoskeleton-nucleus connection in maintaining genome stability (6–11).

Genomic instability caused by nuclear envelope ruptures or mitotic drug treatment has the potential to trigger the cyclic GMP-AMP synthase (cGAS)/stimulator of interferon genes (STING)–mediated inflammatory response as a result of the recognition of cytosolic DNA, particularly micronuclei (12, 13). However, genomic and micronuclei DNA triggered weaker cGAS/STING response than viral DNA (13, 14), likely because they contain nucleosome structures that prevented cGAS from being activated (15). Additional mechanisms are also crafted to limit activation of the cGAS/STING pathway toward genomic or micronuclei DNA, such as the competition between cGAS and barrier-to-autointegration factor (BAF) for binding to genomic DNA (16) and sequestration of the nuclease three-prime repair exonuclease 1 (TREX1) in the endoplasmic reticulum (17). Nevertheless, continuous activation of the cGAS/STING pathway driven by genomic instability has been reported to induce chronic inflammation, fueling cancer progression probably by suppressing cytotoxic T cells in the tumor microenvironment (12, 18).

The myosin family contains diverse actin-binding motor proteins (19). While conventional type II myosin proteins regulate skeletal muscle contraction and cell migration, most of the remaining unconventional myosins function in cellular processes such as intracellular transport and tethering, cell division, cell motility, cytoskeleton organization, etc. (20). Myosin X (MYO10) (not MYH10) is an unconventional myosin that binds to actin filaments (21). It is also known to localize to the tips of filopodia (22, 23), finger-like membrane protrusions that are often associated with cellular movement (24, 25). Hence, MYO10 has been indicated to regulate cell adhesion, spindle orientation, cell-cell junction, and cell motility and is involved in wound healing, tumor invasion, neuronal extension, etc. (20, 23).

MYO10 was shown to be up-regulated in a wide range of human cancers including melanoma, breast cancer (26), leukemia (27), and lung cancer (28). High expression levels of MYO10 correlated with breast and skin cancer aggressiveness and indicated poorer patient survival (26, 29). MYO10 up-regulation seems to be important for metastasis of TP53 mutant breast cancer (30). These findings suggest a potentially important role of MYO10 in cancer development. However, how MYO10 is regulated and how its up-regulation promotes cancer progression are poorly understood. Here, we report a previously uncharacterized role of MYO10 in maintaining nuclear structural integrity and genome stability. We show that the protein level of MYO10 is critical for this function and reveal that MYO10 undergoes ubiquitination and proteasomal degradation by ubiquitin-conjugating enzyme H7 (UbcH7) and β-transducin repeat containing protein 1 (β-TrCP1). We further demonstrate that MYO10 regulates the cGAS/STING-dependent inflammatory response and affects cancer progression and response to immune checkpoint blockades (ICBs).

DISCUSSION

Abnormal nuclear structures seen in cancer cells include, but are not limited to, irregular nuclear shape, fragile nucleus, and altered chromosome topology (67), all of which could alter the chromosome territory and ultimately lead to genomic instability. Other than defects in the nuclear structural genes, recent studies suggest that the LINC complex also affects the nuclear integrity (5). Here, we present a previously uncharacterized finding that a cytoplasmic protein, MYO10, regulates genome stability at least partially through mediating the LINC-nucleus network followed by mitotic regulation. Further, our studies propose a model in which MYO10^high or overexpression creates an inflammatory tumor microenvironment that leads to T cell exhaustion, which promotes tumor growth. Yet, in the meantime, the immunogenic potential of the tumor environment (i.e., increased genomic instability and the presence of infiltrating T cells) enhanced the tumor response to ICBs (see model in fig. S20).

We showed that the protein level of MYO10 is critical for this function. We also identified UbcH7 and β-TrCP1 as the E2 and E3 enzymes, respectively, for MYO10 ubiquitination and degradation. Because MYO10 is a motor protein that binds to and regulates the tension of the cytoskeleton and interacts with the LINC complex, elevated levels (at or above approximately twofold) of MYO10 may disrupt the proper cytoskeleton-nucleus network balance (e.g., causing abnormal perinuclear localization of Nesprin, the outer nuclear membrane portion of the LINC complex that connects to the cytoplasm), which consequently results in abnormal nuclear morphology. This aberrant nuclear morphology will likely cause abnormal mitosis to form micronuclei, exacerbating genomic instability and triggering the cGAS/STING pathway to induce transcription of inflammatory genes such as ILs and IFNs mediated at least partially through P65 nuclear translocation (fig. S20). These effects are unlikely related to the previously reported function of MYO10 in regulating filopodia, a cellular membrane structure that is involved in cell movement (24).

Consistent with our model, we observed greatly elevated levels of ILs and IFN response regulators in cancer cells overexpressing MYO10. On the other hand, depleting MYO10 significantly reduced the production of these inflammatory factors. Treatment with aspirin or depletion of STING to reduce inflammation significantly reduced tumor growth of both MYO10^high and MYO10-overexpressing breast tumors in mice. This is consistent with epidemiological studies showing that long-term users of aspirin or nonsteroidal anti-inflammatory drugs significantly reduced cancer risk (68).

Our data also offer some intriguing yet important insights into the role of MYO10 in determining the tumor response to ICBs. First, the fact that PyMT/Myo10^+/+ tumors responded to ICBs supports the idea that MYO10^high conferred an immunogenic environment. Second, the fact that PyMT/Myo10^+/− mice actually grew larger in the presence of anti–PD-1 therapy suggests that reducing the level of MYO10 leads to immunotherapy resistance. Such a tumor-promoting effect (or hyperprogression) of anti–PD-1 in immune-resistant tumors is not uncommon. For instance, anti–PD-1 promoted the growth of non–small cell lung cancer–derived patient-derived xenograft models (69). The exact mechanisms underlying ICB’s hyperprogression are poorly understood and likely context dependent. For instance, loss of programmed cell death ligand 1 (PD-L1) or Serine/Threonine kinase 11 (STK11) (70) or the presence of epidermal growth factor receptor mutation and MDM proto-oncogene 2/4 (MDM2/4) amplification (71) were reported to induce anti–PD-1 hyperprogression. The mechanisms by which PyMT/Myo10^+/− tumors grew larger in the presence of anti–PD-1 were probably related to the altered tumor microenvironment (e.g., reduced and increased secretion of Ifnα and Tnfα, respectively, and less infiltrating T cells). Nonetheless, the implications of these findings are significant. Determination of tumor PD-L1 expression and/or quantification of tumor-infiltrating lymphocytes are considered to predict the response to ICBs, but their effects have been questioned (72, 73). Our findings led us to propose that breast tumors with MYO10^high will respond to ICBs. On the other hand, they also warn us that tumors with low MYO10 might be resistant to ICBs, and therefore, the application of this type of anticancer agents should be avoided. In conclusion, our results reveal a previously uncharacterized role of MYO10 in tumor development and immune therapy response, highlighting the potential of targeting this gene in cancer.

MATERIALS AND METHODS

Cell cultures, reagents, and transfection

The human cervical cancer cell line HeLa, the osteosarcoma cancer cell line U2OS, the lung adenocarcinoma cancer cell line A549, the breast cancer cell lines (MDA-MB-231 and MCF7), diploid human embryonic lung fibroblasts WI38, human retinal pigment epithelial ARPE19, and human embryonic kidney cell line HEK293T were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The breast cancer cell lines (HCC1143 and HCC70) were cultured in RPMI 1640 with 10% FBS and 1% penicillin-streptomycin. The breast cell lines (MCF10A and MCF10A-Neu) were cultured in DMEM/F12 with high glucose, l-glutamine, 32 mM sodium bicarbonate, cholera toxin (0.1 μg/ml), hydrocortisone (0.5 μg/ml), insulin (0.01 mg/ml), 0.05% horse serum, epidermal growth factor (0.02 μg/ml), and 1% penicillin-streptomycin. The human fetal lung fibroblast IMR-90 cells were cultured in Eagle’s minimal essential medium with nonessential amino acids and 10% fetal calf serum and 1% penicillin-streptomycin. CHX was purchased from Acros Organics (New Jersey, USA). CHX was freshly dissolved in phosphate-buffered saline (PBS) before use at a concentration of 32 mM. MG132 was purchased from Selleck Chemicals LLC (Houston, TX, USA) and dissolved in dimethyl sulfoxide at the stock concentration of 10 mM. Protein A and G beads (#SC-2003) were from Santa Cruz Biotechnology (Dallas, TX, USA). Aspirin (A2093-100G) was purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA). Matrigel (#356230) was purchased from Corning (New York, USA). Cell transfection was performed with the X-tremeGENE HP transfection reagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocols or polyethylenimine (PEI) 300.

Antibodies

The following commercially available antibodies were used: anti-MYO10 [Santa Cruz Biotechnology, #sc-166720, or Proteintech, #24565-1-AP, for immunofluorescence staining], anti-UbcH7 (Novus, #NB100-2265), anti–lamin A/C (Santa Cruz Biotechnology, #sc-7292), anti-Nesprin3 (Abcam, #ab74261), anti-ANAPC2 (Santa Cruz Biotechnology, #sc-20984), anti-Flag M2 (Sigma-Aldrich, #F3165), anti-CHK1 (Santa Cruz Biotechnology, #sc-56291), anti-CTSL (Santa Cruz Biotechnology, #sc-32320), anti–tubulin 4A (GeneTex, #GTX112141), anti-synemin (Santa Cruz Biotechnology, #sc-374484), anti-actin (Santa Cruz Biotechnology, #sc-47778), anti-GFP (Novus, #NB100-1770, or Proteintech, #50430-2-AP), anti-Neu (Santa Cruz Biotechnology, #sc-33684), anti–glyceraldehyde phosphate dehydrogenase (Proteintech, #60004), anti-V5 (Cell Signaling Technology, #13202S), anti-p65/RELA (Bethyl Laboratories, #A301-824A), anti-STING (Cell Signaling Technology, #13647S), anti-cGAS (Cell Signaling Technology, #15102S), anti-pSTAT1 (Cell Signaling Technology, #9167S), anti-pSTAT3 (Cell Signaling Technology, #9131S), anti–IL-1β (NCI-monoclonal 3ZD), anti–IL-8 (Santa Cruz Biotechnology, #sc-376750), anti-pTBK1 (Cell Signaling Technology, #5483S), anti-pIRF3 (Cell Signaling Technology, #29047S), and anti–phospho-histone H3 (Ser¹⁰) (Millipore, #06-570). Rat anti-mouse CD279 (PD-1, #P362) was purchased from Leinco Technologies Inc. (St. Louis, MO, USA). Rat anti-mouse phycoerythrin (PE)–CD8α (#553033), hamster anti-mouse peridinin-chlorophyll-protein (PerCP)–CD3e (#553067), rat anti-mouse fluorescein isothiocyanate (FITC)–CD4 (#553729), and hamster anti-mouse FITC-CD3e (#553062) were from DB Pharmingen (San Jose, CA, USA). The goat anti-mouse (#PI-31430) and goat anti-rabbit (#PI-31460) horseradish peroxidase (HRP)–conjugated antibodies were purchased from Pierce/Thermo Fisher Scientific. The anti-goat HRP-conjugated antibody was purchased from Invitrogen (USA). Alexa Fluor 488 goat anti-mouse immunoglobulin G (IgG) (H + L), Alexa Fluor 488 goat anti-rabbit IgG (H + L), Alexa Fluor 594 goat anti-mouse IgG (H + L), and Alexa Fluor 594 goat anti-rabbit IgG (H + L) were obtained from Life Technologies/Thermo Fisher Scientific.

RNA interference

For RNAi, lentiviral shRNA vectors targeting UbcH7, CTSL, lamin A/C, and MYO10 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The following are targeting sequences for UbcH7: CCAGCAGAGTACCCATTCAAA (TRCN0000007209) and CCACCGAAGATCACATTTAAA (TRCN0000007211); CTSL: CCAAAGACCGGAGAAACCATT (TRCN0000349635) and AGGCGATGCACAACAGATTAT (TRCN0000318682); lamin A/C: GATGATCCCTTGCTGACTTAC (TRCN0000262697) and AGAAGGAGGGTGACCTGATAG (TRCN0000262764); and MYO10: ACTAACCTCCCAACCTGATTT (TRCN0000298630) and GATAGGACTTTCCACCTGATT (TRCN0000123088). siRNA duplexes targeting β-TrCP1 were purchased from GE Healthcare/Dharmacon (Lafayette, CO, USA).

For lentivirus production, we followed procedures that we previously described (33). Briefly, we cultured HEK293T cells in 10-cm dishes at ~50% confluency the day before transfection. We prepared the transfection complex as follows: 12 μg of DNA (3 μg of shRNA, 3 μg of pGag/pol, 3 μg of pVSV-G, and 3 μg of pRSV-Rev) in 250 μl of sterile ultrapure H₂O containing 62 μl of 2 M CaCl₂. The mixture was incubated at room temperature for 5 min, was added 250 μl of 2× Hanks’ balanced salt solution buffer and incubated for another 20 min, and was added dropwise to preplated HEK293T cells. After 72 hours, the culture media were collected and centrifuged at 2000 rpm for 10 min at 4°C, and the supernatant was transferred to a new tube to infect cells or stored at 4°C. Target cells were seeded 1 day before transduction. The culture medium of target cells was aspirated, replaced with fresh complete media and virus-containing supernatant at a 1:1 (v/v) ratio with polybrene (4 to 10 μg/ml). The cells were cultured for 2 to 3 days, and stable clones were obtained by selecting cells with puromycin (3 μg/ml) for 2 weeks.

Western blot analysis

For protein expression analysis, cultured cells or digested tissues were extracted by the NP-40 lysis buffer [50 mM tris-HCl (pH 7.6), 150 mM NaCl, 10 mM NaF, and 0.5% Nonidet P-40] supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT), aprotinin (10 μg/ml), and leupeptin (1 μg/ml). Lysis was performed for 30 min on ice followed by sonication for 10 s two times. Protein concentrations were determined by the bicinchoninic acid assay (BCA) method (Pierce BCA Protein Assay, Thermo Fisher Scientific, USA). The amount of 100 μg of total proteins was separated on gradient SDS–polyacrylamide gel electrophoresis (SDS-PAGE) gels, transferred to polyvinylidene difluoride membrane (Immobilon, Millipore, Bedford, MA), and blotted with specific antibodies (1:1000 dilution for all antibodies unless specifically indicated).

Immunoprecipitation

For endogenous protein IP, at least 2 × 10⁶ cells were lysed in 1 ml of NP40 lysis buffer on ice for 30 min and then were briefly sonicated (2% power output, 5 s per cycle for 2 cycles). The cell lysates were centrifuged at 13,000 rpm for 10 min at 4°C, and the supernatants were incubated with primary antibodies (1 μg/1 mg of lysates) overnight at 4°C. Then, Protein A and G agarose beads (50 μl of slurry) were added into each sample and further incubated for 2 hours, washed four times with lysis buffer, and collected by centrifuge at 13,000 rpm for 1 min, and the beads were boiled with 40 μl of 2× sample buffer before running on SDS-PAGE.

To immunoprecipitate exogenously expressed proteins, HEK293T cells were transfected with specific plasmids by PEI300 (1 μg of DNA per 3 μl of PEI) for 48 hours, treated or not before cell lysis. For HEK293T cells, greater than 50% transfection efficiency was achieved by this method of transfection. The clear cell lysates were incubated with the primary antibody of FLAG-M2 (Sigma-Aldrich) or GFP (Novus or Proteintech) overnight at 4°C. Then, the samples were processed as stated above.

Immunofluorescence of cell cultures

To prepare slides for immunofluorescence staining, cells were plated on glass coverslips in six-well plates and allowed to grow for 24 hours. Cells were then transfected or treated as indicated in specific experimental settings, fixed in 4% paraformaldehyde in PBS for 10 min at room temperature, followed by washing with PBS three times. Cells were permeabilized with 0.5% Triton X-100 in PBS for 10 min and incubated in blocking buffer [10% FBS, 0.5% bovine serum albumin (BSA), and 0.2% Triton X-100 in PBS] at room temperature for 30 min. Cells were washed four times with 0.2% Triton X-100 in PBS for 5 min and incubated in 0.2% Triton X-100 in PBS containing primary antibodies (1:30 to 1:500 dilution) for overnight at 4°C. The slides were washed with 0.2% Triton X-100 in PBS four times, and secondary antibodies conjugated with Alexa Fluor 488 or Alexa Fluor 594 were added at 1:1000 dilution on cover glasses and incubated for 1 hour in the dark at room temperature. The samples were mounted with ProLong Gold Antifade solution containing 4′,6-diamidino-2-phenylindole (DAPI) (#P36931, Life Technologies/Thermo Fisher Scientific, Carlsbad, CA, USA) and visualized under a fluorescence microscope.

Cell fractionation

Cells cultured in a 6-cm dish were washed with PBS twice; lysed in 150 μl of lysis buffer [10 mM Hepes (pH 7.9), 1.5 mM MgCl₂, 10 mM KCl, 0.43 M sucrose, 10% glycerol, and 0.1% Triton X-100] supplemented with 1 mM PMSF, 1 mM DTT, aprotinin (10 μg/ml), leupeptin (1 μg/ml); and incubated on ice for 5 min. The cell lysate was then subjected to centrifugation at 2000 rpm for 5 min at 4°C. The supernatant was collected as cytoplasmic proteins. The pellet was washed with ice-cold PBS and lysed in 150 μl of NP40 buffer. After 10 min of incubation on ice, the samples were sonicated for 10 s two times to complete cell lysis, and the lysate was centrifuged at 12,000 rpm for 10 min, which mainly contains the nuclear extract.

Metaphase spreading and chromosome counting

HCC1143 parental or V5-MYO10–expressing cells were treated with colchicine (0.5 μg/ml) for 2 hours at 37°C, collected into a 15-ml tube, and centrifuged at 1200 rpm for 10 min. The cell pellet was gently washed two times with PBS and resuspended in hypotonic solution (0.075 M KCl) and allowed to stand for 30 min at room temperature. Cells were fixed in methanol:acetic acid [3:1 (v/v)] for 5 min at room temperature. The suspension was then dropped onto glass slides and dried at 37°C. The samples were subjected to DAPI staining and visualized under a fluorescence microscope.

SILAC assay

To prepare for SILAC analysis, A549 control or shUbcH7 stable cells were grown in SILAC medium (Thermo Fisher Scientific, #PI89985) with 10% dialyzed SILAC FBS (Thermo Fisher Scientific, # PI88440) and supplemented with either light or heavy isotope-labeled amino acids. Control cells were cultured with regular media containing ¹²C-Leu/¹²C-Arg, whereas shUbcH7 group cells were cultured with ¹³C-Leu (Thermo Fisher Scientific, #PI88435) and ¹³C-Arg (Thermo Fisher Scientific, #PI88210) media. Cells were passaged every 2 to 3 days for 10 passages, during which SILAC-grade PBS (Thermo Fisher Scientific, #1315014) and collagenase (Thermo Fisher Scientific, #17104019) were used. Subsequently, light and heavy amino acid–labeled cells were collected, lysed in SILAC-grade radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, #PI89900) on ice for 20 min, sonicated, and centrifuged, and the supernatant was collected. The protein lysates were quantitated by a Pierce BCA protein assay kit (Thermo Fisher Scientific, #PI23225, Franklin, MA, USA), and equal amounts of cell lysates from control and shUbcH7 groups were mixed (1:1 ratio) and run on 10% SDS-PAGE. The gel was silver-stained and excised into 10 slices and submitted for mass spectrometry analysis.

Protein sequence analysis by liquid chromatography–tandem mass spectrometry

Gel slices were further cut into ~1-mm³ pieces, dehydrated with acetonitrile for 10 min, washed off acetonitrile, completely dried in a SpeedVac, and stored for processing. Rehydration of the gel was done in 50 mM ammonium bicarbonate containing trypsin (12.5 ng/μl) (Promega, Madison, WI) at 4°C for 45 min and then incubated the sample at 37°C overnight. Ammonium bicarbonate was removed from the digestion products, washed the sample with solution containing 50% acetonitrile and 1% formic acid once, dried, and stored at 4°C until analysis. The samples were run on an LTQ Orbitrap Velos Pro ion-trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA). Peptide identification was determined by matching the protein database with fragmentation signatures, and data were filtered by a 1 to 2% peptide false discovery rate.

Quantitative polymerase chain reaction

We performed quantitative polymerase chain reaction (qPCR) according to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. Briefly, total RNA was extracted from HCC70 parental or MYO10-depleted cells by TRIzol (#15596026, Thermo Fisher Scientific, Waltham, MA, USA). The complementary DNA (cDNA) synthesis was conducted by the RevertAid first-strand cDNA synthesis kit (#K1622, Thermo Fisher Scientific). qPCR was run on a CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA) using the SYBR Green Master Mix (#208054, Invitrogen/Thermo Fisher Scientific, Franklin, MA, USA). The gene expression level was determined by analyzing 2-ΔΔC_t using actin as the control. The qPCR program is as follows: 95°C for 3 min, 95°C for 10 s for 40 cycles, and then 60°C for 30 s. Following the qPCR cycle, the melt curve was determined by heating the samples to 95°C for 10 s, reducing to 60°C for 30 s, and then gradually increasing to 95°C with 0.5°C increment increases.

Primers sequences for human target genes are as follows: IL-1β forward: 5′-ACCTGAGCTCGCCAGTGAA-3′ and IL-1β reverse: 5′-TCGGAGATTCGTAGCTGGAT-3′; IFNB1 forward: 5′-TGTCGCCTACTACCTGTTGTGC-3′ and IFNB1 reverse: 5′-AACTGCAACCTTTCGAAGCC-3′; TNFα forward: 5′-TCTCTCAGCTCCACGCCATT-3′ and TNFα reverse: 5′-CCCAGGCAGTCAGATCATCTTC-3′; CDKN1A forward: 5′-AACTAGGCGGTTGAATGAGAG-3′ and CDKN1A reverse: 5′-GAGGAAGTAGCTGGCATGAAG-3′; and β-actin forward: 5′-GTCCCTCACCCTCCCAAAAGC-3′ and β-actin reverse: 5′-GCTGCCTCAACACCTCAACCC-3′.

Tumor mouse xenografts

A total of 4.5 × 10⁶ HCC1143 parental, MYO10-depleted, V5-MYO10–overexpressing, and V5-MYO10–overexpressing but STING stably depleted cells suspended in Matrigel at a 1:1 ratio were implanted into the mammary fat pad of 8-week-old female nude or NOD-SCID mice purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All mice studies were approved by the Institutional Animal Care and Use Committee at Case Western Reserve University (CWRU) and are consistent with the recommendations of the American Veterinary Medical Association Guidelines on Euthanasia before the initiation of experiments. All mice were housed in-group in cages with bedding, controlled temperature (23° ± 2°C), humidity (50 ± 5%), and illumination (12-hour light/12-hour dark cycle). Mice were adapted to the facility for 1 week before experiments. Tumor volumes were measured every 2 days using a caliper and determined by a formula [volume = (length × width²)/2] starting from day 5 after implantation. The results were expressed as mean tumor volumes with SD. Aspirin (100 mg/kg) dissolved in PBS was administered orally daily using oral gavage tube starting from day 5 after tumor implantation.

Generation of MYO10^+/− cells

MYO10 knockout U2OS or MDA-MB-2312 cells were generated by CRISPR-Cas9 as previously described with modifications (74). Briefly, a 22–base pair oligonucleotide targeting the PEST domain of MYO10 (TAGGTGGACTCGCCGCTGGAGG) was identified using the MIT CRISPR design tool. The annealed double-strand oligo was ligated to the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene, #48139). U2OS or MDA-MB-231 cells were transfected with the targeting plasmid using Lipofectamine. After puromycin selection of transfected cells by 2 days, cells were replated into dishes at nearly single-cell density. After ~2 weeks, visible single colonies were picked up and cultured in 24-well plates. Expression of MYO10 protein was examined by Western blotting using a mouse monoclonal anti-MYO10 antibody. MYO10 gene deletion was confirmed by genomic DNA sequencing.

Knockout and transgenic mice

Rederivation of Myo10^tm1d mice in the C57BL/6J background was performed at the CWRU Transgenic and Targeting facility. Two Myo10^+/− founder male mice were confirmed by genotyping and were crossed with WT female FVB/NJ mice to produce pups. The resultant Myo10^+/− male mice were crossed with WT FVB/NJ female mice, and this process was repeated six times to obtain heterozygous mice (both male and female) with the FVB/N genetic background. The sixth-generation Myo10^+/− female mice were then crossed with MMTV-PyMT male mice purchased from the Jackson Laboratory to obtain PyMT/Myo10^+/+, PyMT/Myo10^+/−, and PyMT/Myo10^−/− mice. Mice genotyping was performed according to the Jackson Laboratory for PyMT or as previously reported for Myo10 (35). Mice were examined twice a week in the mammary glands to detect tumor development.

Treatment with anti–PD-1 antibodies

Starting from week 5.5 of age, MMTV-PyMT/Myo10^+/+ and MMTV-PyMT/Myo10^+/− female mice (five per group) were given the monoclonal anti–PD-1 antibody (150 μg) by intraperitoneal injection every 4 days and continued until the age of 13 weeks. Tumor volumes were analyzed as stated above. The animals were euthanized at approximately week 10 of age, and tumors were taken for analyses of cytokines and the presence of infiltrating T lymphocytes.

Enzyme-linked immunosorbent assay analysis in cell cultures and tumor tissues

The levels of Ifnα (MyBioSource, #MBS2506010) and Tnfα (RayBiotech, #ELM-TNFa-1) in tumors from MMTV-PyMT/Myo10^+/+ and MMTV-PyMT/Myo10^+/− female mice were measured by enzyme-linked immunosorbent assay (ELISA). Briefly, xenografted tumors from approximately week 10 of mice were surgically removed, and approximately 100 mg of tumor tissues was dissected on ice into small pieces and added ~300 μl of lysis buffer [100 mM tris (pH 7.4), 150 mM NaCl, 1 mM EGTA, 1 mM EDTA, 0.5% NP40, and 0.5% sodium deoxycholate]. Tissues were homogenized on ice for 30 to 60 s followed by sonication for 10 s and centrifuged at 10,000 rpm for 20 min at 4°C, and the supernatant was collected for ELISA analysis.

To measure cGAMP (Cayman, #501700) in cultured cells, HCC1143 (parental, MYO10 depleted, V5-MYO10 overexpressing, and V5-MYO10 overexpressing but STING depleted) or HCC70 (parental and MYO10 depleted) cells were collected, lysed in extraction buffer with vortex, and centrifuged at 13,000 rpm for 10 min at 4°C, and the supernatants were collected for analysis. ELISA was performed according to the manufacturer’s instructions. The absorbance was normalized by protein content in each group, and the levels of cGAMP, Ifnα, and Tnfα were determined by the standard curve. Data were acquired from three replicates.

Tumor tissue immunofluorescence staining

Tumor tissue samples were established from spontaneous mammary tumors arising in MMTV-PyMT and MMTV-PyMT/Myo10^+/− female mice. In a small container, a fresh tissue sample was carefully coated with optimal cutting temperature (OCT) compound at room temperature. OCT-coated samples were placed into an appropriately sized cryomold and covered the tissue with OCT. Forceps were used to lower the embedded tissues into the isopentane without fully submerging, keeping the cryomold in contact with isopentane until the OCT has solidified and turned white. Once frozen, the cryomold was placed on powdered dry ice, and frozen embedded tissues were stored at −80°C. For all tumor samples, 5-μm tissue sections were cut using a Leica CM1850 cryostat microtome, and samples were mounted on glass microscope slides and left to air-dry for 2 hours at room temperature. The samples were fixed with methanol at 20°C for 15 min and then air-dried for 30 min. Samples were blocked with blocking buffer (PBS/1% FBS /0.5% BSA/0.1% Triton X-100) and then added conjugated primary antibodies (rat anti-mouse PE-CD4, hamster anti-mouse PerCP-CD3e, rat anti-mouse FITC-CD4, and rat anti-mouse FITC-CD3e; 1:1000 diluted in 0.5% BSA/PBS) and incubated at 4°C overnight while avoiding drying. The slides were washed five times with 0.1% Triton X-100 in PBS for 5 min each, mounted in 200 μl of DAPI (final concentration of 1 μg/ml, 1:1000 dilute in PBS) for 5 min, washed with PBS three times, and visualized under a confocal microscope.

Statistical analysis

All cell culture experiments were performed at least twice. Data are presented as means ± SD (or SEM unless indicated otherwise). The statistical analysis was conducted by the Prism 8.0 (GraphPad) software. Pairwise comparison was performed using a two-tailed Student’s t test, whereas one-way analysis of variance (ANOVA) was used to compare multiple comparisons. P values of less than at least 0.05 were considered statistically significant.

Categories