Tag: HOMER

A Benchmark of Genetic Variant Calling Pipelines Using Metagenomic Short-Read Sequencing

Introduction Short-read metagenomic sequencing is the technique most widely used to explore the natural habitat of millions of bacteria. In comparison with 16S rRNA sequencing, shotgun metagenomic sequencing (MGS) provides sequence information of the whole genomes, which can be used to identify different genes present in an individual bacterium and…

Continue Reading A Benchmark of Genetic Variant Calling Pipelines Using Metagenomic Short-Read Sequencing

Comparison of capture-based mtDNA sequencing performance between MGI and illumina sequencing platforms in various sample types | BMC Genomics

Hu T, Chitnis N, Monos D, Dinh A. Next-generation sequencing technologies: an overview. Hum Immunol. 2021;82(11):801–11. Article  CAS  Google Scholar  Jeon SA, Park JL, Park SJ, Kim JH, Goh SH, Han JY, Kim SY. Comparison between MGI and Illumina sequencing platforms for whole genome sequencing. Genes Genomics. 2021;43(7):713–24. Article  CAS …

Continue Reading Comparison of capture-based mtDNA sequencing performance between MGI and illumina sequencing platforms in various sample types | BMC Genomics

Single-cell analysis of chromatin accessibility in the adult mouse brain

Tissue preparation and nucleus isolation All experimental procedures using live animals were approved by the SALK Institute Animal Care and Use Committee under protocol number 18-00006. Adult C57BL/6J male mice were purchased from Jackson Laboratories. Brains were extracted from 56–63-day-old mice and sectioned into 600 µm coronal sections along the anterior–posterior…

Continue Reading Single-cell analysis of chromatin accessibility in the adult mouse brain

Overlapping and merging ChIP-seq peaks

Overlapping and merging ChIP-seq peaks 0 Hi all, I have ChIP-seq data sets for two different proteins (let’s call them A and B) in the same cell line that need to form a dimer in order to function as an active TF. Protein A can form either a homodimer (A/A)…

Continue Reading Overlapping and merging ChIP-seq peaks

Construction of a risk stratification model integrating ctDNA to predict response and survival in neoadjuvant-treated breast cancer | BMC Medicine

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. Article  PubMed  Google Scholar  Giaquinto AN, Sung H, Miller KD, Kramer JL, Newman LA,…

Continue Reading Construction of a risk stratification model integrating ctDNA to predict response and survival in neoadjuvant-treated breast cancer | BMC Medicine

Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…

Continue Reading Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

Applications of NGS Technology in Forensic DNA Analysis

Caratti S, Turrina S, Ferrian M et al (August 2015) MiSeq FGx sequencing system: a new platform for forensic genetics. Forensic Sci Int Genet Suppl Ser 5:e98–e100. doi.org/10.1016/j.fsigss.2015.09.040 Elkins KM, Garloff AT, Zeller CB (2023) Additional predictions for forensic DNA phenotyping of externally visible characteristics using the ForenSeq and Imagen…

Continue Reading Applications of NGS Technology in Forensic DNA Analysis

Borrelia puertoricensis in opossums (Didelphis marsupialis) from Colombia | Parasites & Vectors

Oppler Z, Keeffe K, McCoy K, Brisson D. Evolutionary genetics of Borrelia. Curr Issues Mol Biol. 2021;42:97–112. doi.org/10.21775/cimb.042.097.2. Article  PubMed  Google Scholar  Margos G, Fingerle V, Cutler S, Gofton A, Stevenson B, Estrada-Peña A. Controversies in bacterial taxonomy: the example of the genus Borrelia. Ticks Tick Borne Dis. 2020;11:101335. doi.org/10.1016/j.ttbdis.2019.101335….

Continue Reading Borrelia puertoricensis in opossums (Didelphis marsupialis) from Colombia | Parasites & Vectors

Find Genes in Homer Analysis that have the enriched Motif

Find Genes in Homer Analysis that have the enriched Motif 0 Hello, I recently did a Homer analysis using a set of genes to find enriched Motifs. It worked and now I am interested in knowing for one certain Motif, which genes lead to the enrichment of this Motif. Feels…

Continue Reading Find Genes in Homer Analysis that have the enriched Motif

Chromatin priming elements direct tissue-specific gene activity before hematopoietic specification

Introduction The development of multicellular organisms requires the activation of different gene batteries which specify the identity of each individual cell type. Such shifts in cellular identity are driven by shifts in the gene regulatory network (GRN) consisting of transcription factors (TFs) binding to the enhancers and promoters of their…

Continue Reading Chromatin priming elements direct tissue-specific gene activity before hematopoietic specification

Phenotypic drug-susceptibility profiles and genetic analysis based on whole-genome sequencing of Mycobacterium avium complex isolates in Thailand

Abstract Mycobacterium avium complex (MAC) infections are a significant clinical challenge. Determining drug-susceptibility profiles and the genetic basis of drug resistance is crucial for guiding effective treatment strategies. This study aimed to determine the drug-susceptibility profiles of MAC clinical isolates and to investigate the genetic basis conferring drug resistance using…

Continue Reading Phenotypic drug-susceptibility profiles and genetic analysis based on whole-genome sequencing of Mycobacterium avium complex isolates in Thailand

Transcriptional and epigenetic regulators of human CD8+ T cell function identified through orthogonal CRISPR screens

Developing an epigenetic screening platform in human T cells Staphylococcus aureus Cas9 (SaCas9) has been extensively used for genome editing in vivo as its compact size (3,159 bp) relative to the conventional Streptococcus pyogenes Cas9 (SpCas9) enables packaging into adeno-associated virus26,27,28. However, SaCas9 has not been widely used for targeted gene…

Continue Reading Transcriptional and epigenetic regulators of human CD8+ T cell function identified through orthogonal CRISPR screens

distance between chip peaks and individual TSS

distance between chip peaks and individual TSS 0 I have generated my peak data through chip sequencing data and I have individual transcription sites coordinates from RNA sequencing data. How to compare the distance between these TSS and peaks, so that I can find the closest TSS to peak and…

Continue Reading distance between chip peaks and individual TSS

Using Homer3 Software to Perform the Pre-Processing of the fNIRS Hyperscanning Data

To begin open MATLAB, then navigate to the folder where the raw and irs files are saved. Select and open the folder. Type Homer3 into the command window of MATLAB to launch the Homer3 GUI. Homer3 will detect the nirs files and ask to convert them to snirf format to…

Continue Reading Using Homer3 Software to Perform the Pre-Processing of the fNIRS Hyperscanning Data

MGA-seq: robust identification of extrachromosomal DNA and genetic variants using multiple genetic abnormality sequencing | Genome Biology

Zack TI, Schumacher SE, Carter SL, Cherniack AD, Saksena G, Tabak B, Lawrence MS, Zhang C-Z, Wala J, Mermel CH. Pan-cancer patterns of somatic copy number alteration. Nat Genet. 2013;45:1134–40. Article  CAS  PubMed  PubMed Central  Google Scholar  Dixon JR, Xu J, Dileep V, Zhan Y, Song F, Le VT, Yardımcı…

Continue Reading MGA-seq: robust identification of extrachromosomal DNA and genetic variants using multiple genetic abnormality sequencing | Genome Biology

Cross validate RNA-seq and ATAC-seq

Cross validate RNA-seq and ATAC-seq 1 Hi, I have RNA-seq and ATAC-seq for the same samples. I wish to cross-validate two datasets. I got DEGs from RNA-seq and DARs from ATAC-seq. I annotated DARs (differentially accessible regions) using Homer, so I got their nearest gene information. Would it be reasonable…

Continue Reading Cross validate RNA-seq and ATAC-seq

GoM DE: interpreting structure in sequence count data with differential expression analysis allowing for grades of membership | Genome Biology

Models for single-cell ATAC-seq data In single-cell ATAC-seq data, \(x_{ij}\) is the number of unique reads mapping to peak or region j in cell i. Although \(x_{ij}\) can take non-negative integer values, it is common to “binarize” the accessibility data (e.g., [19, 74, 133,134,135]), meaning that \(x_{ij} = 1\) when…

Continue Reading GoM DE: interpreting structure in sequence count data with differential expression analysis allowing for grades of membership | Genome Biology

Get the strongest TF binding regions for Chip-Seq

Get the strongest TF binding regions for Chip-Seq 0 Hi All, Is there a package / program that finds the peaks with the most differential pileup between the condition and input? For example, I am currently calling peaks with HOMER and MACS2; these programs automatically determine if the amount of…

Continue Reading Get the strongest TF binding regions for Chip-Seq

Distinct non-synonymous mutations in cytochrome b highly correlate with decoquinate resistance in apicomplexan parasite Eimeria tenella | Parasites & Vectors

Chapman HD, Rathinam T. Focused review: the role of drug combinations for the control of coccidiosis in commercially reared chickens. Int J Parasitol Drugs Drug Resist. 2022;18:32–42. PubMed  PubMed Central  Google Scholar  Peek HW, Landman WJM. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 2011;31:143–61. CAS …

Continue Reading Distinct non-synonymous mutations in cytochrome b highly correlate with decoquinate resistance in apicomplexan parasite Eimeria tenella | Parasites & Vectors

Modeling SHANK3-associated autism spectrum disorder in Beagle dogs via CRISPR/Cas9 gene editing

De Rubeis S, He X, Goldberg AP, Poultney CS, Samocha K, Cicek AE, et al. Synaptic, transcriptional and chromatin genes disrupted in autism. Nature. 2014;515:209–15. Article  PubMed  PubMed Central  Google Scholar  Iossifov I, O’Roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, et al. The contribution of de novo…

Continue Reading Modeling SHANK3-associated autism spectrum disorder in Beagle dogs via CRISPR/Cas9 gene editing

Bioinformatics Programmer I – 126046

UCSD Layoff from Career Appointment: Apply by 10/18/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 10/27/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. The Moores Cancer Center (MCC) is one of just 54 NCI-designated…

Continue Reading Bioinformatics Programmer I – 126046

Craft Recordings announces seven exclusive titles for RSD Black Friday

Today, Craft Recordings announces its exclusive line-up of titles for RSD Black Friday, taking place on November 24 at participating independent retailers. This year’s releases include seven limited-edition pressings from a wide range of genres and eras, encompassing everything from midcentury jazz to post-millennium punk. For jazz aficionados, offerings include…

Continue Reading Craft Recordings announces seven exclusive titles for RSD Black Friday

Synechococcus nitrogen gene loss in iron-limited ocean regions

Richardson TL, Jackson GA. Small phytoplankton and carbon export from the surface ocean. Science. 2007;315:838–40. Article  CAS  PubMed  Google Scholar  Flombaum P, Gallegos JL, Gordillo RA, Rincón J, Zabala LL, Jiao N, et al. Present and future global distributions of the marine Cyanobacteria Prochlorococcus and Synechococcus. Proc Natl Acad Sci…

Continue Reading Synechococcus nitrogen gene loss in iron-limited ocean regions

Multitissue H3K27ac profiling of GTEx samples links epigenomic variation to disease

Samples for H3K27ac ChIP–seq Samples were collected by the GTEx Consortium. The donor enrollment and consent, informed consent approval, histopathological review procedures, and biospecimen procurement methods and fixation were the same as previously described22. No compensation was provided to the families of participants. Massachusetts Institute of Technology Committee on the…

Continue Reading Multitissue H3K27ac profiling of GTEx samples links epigenomic variation to disease

How To Read Chip-Seq Data

Source: Youtube.com The era of big data has revolutionized the way we analyze and interpret complex biological systems. In the field of genomics, Chip-Seq (Chromatin Immunoprecipitation Sequencing) data has become a valuable resource for understanding gene regulation and the functionality of the genome. Chip-Seq data provides insights into the binding…

Continue Reading How To Read Chip-Seq Data

Bioinformatics Programmer in La Jolla, CA for University of California San Diego

Details Posted: 12-Sep-23 Location: La Jolla, California Salary: Open This position is a contract/limited position with the possibility of extension/career conversion. UCSD Layoff from Career Appointment: Apply by 09/13/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 09/25/2023. Eligible…

Continue Reading Bioinformatics Programmer in La Jolla, CA for University of California San Diego

Bioinformatics Programmer – 125138

This position is a contract/limited position with the possibility of extension/career conversion. UCSD Layoff from Career Appointment: Apply by 09/13/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 09/25/2023. Eligible Special Selection clients should contact their Disability Counselor for…

Continue Reading Bioinformatics Programmer – 125138

Unraveling virulence determinants in extended-spectrum beta-lactamase-producing Escherichia coli from East Africa using whole-genome sequencing | BMC Infectious Diseases

Mboowa G, Sserwadda I, Bulafu D, Chaplain D, Wewedru I, Seni J, et al. Transmission Dynamics of Antimicrobial Resistance at a National Referral Hospital in Uganda. Am J Trop Med Hyg. 2021;105(2):498–506. Article  CAS  PubMed  PubMed Central  Google Scholar  Rossolini GM, Arena F, Pecile P. Pollini SJCoip. Update on the…

Continue Reading Unraveling virulence determinants in extended-spectrum beta-lactamase-producing Escherichia coli from East Africa using whole-genome sequencing | BMC Infectious Diseases

python – Run command when creating Conda environment with Snakemake

I presume that downloading script produces some output. I would split your rule into two rules, one specifically for downloading and the other only for running the annotation. The downloading rule will have declared only the output directive, which would be the input for the second rule. rule download_genome: output:…

Continue Reading python – Run command when creating Conda environment with Snakemake

Filtering transcription factor and HOMER and ENCODE

Filtering transcription factor and HOMER and ENCODE 0 Hello, I have a list of transcription factors identified by HOMER tool form MACS2 peak called. I want to filter this list as it has about 70 TFs. Does anyone know about ENCODE transcription factor database and how to use that database…

Continue Reading Filtering transcription factor and HOMER and ENCODE

The Biostar Herald for Thursday, August 24, 2023

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, and was edited by Istvan…

Continue Reading The Biostar Herald for Thursday, August 24, 2023

homer motif search

homer motif search 0 I have used findMotifsGenome.pl from HOMER to find motif, its output have many files including knownResults.html and homerResults.html. which output file should I consider for my downstream studies and what is difference between these two files? search motif HOMER • 23 views Login before adding your…

Continue Reading homer motif search

Assign gene to peak in bulk ATAC-seq

Assign gene to peak in bulk ATAC-seq 0 Hi all, I have some questions about bulk ATAC-seq that I don’t understand, hope that you can help. If we have a task to identify which genes in a sample (such as diseased) are in open chromatin region, is that using differential…

Continue Reading Assign gene to peak in bulk ATAC-seq

Interpreting HOMER peak calling score and annotation file

Interpreting HOMER peak calling score and annotation file 0 Hello, I used homer for peak calling and peak annotation for two different conditions. I want to count the differential peaks, which are the peaks that exist in one file but not the other. My question is: Do I simply see…

Continue Reading Interpreting HOMER peak calling score and annotation file

The progress of novel strategies on immune-based therapy in relapsed or refractory diffuse large B-cell lymphoma

Susanibar-Adaniya S, Barta SK. 2021 Update on diffuse large B cell lymphoma: a review of current data and potential applications on risk stratification and management. Am J Hematol. 2021;96:617–29. Article  PubMed  PubMed Central  Google Scholar  Rovira J, Valera A, Colomo L, Setoain X, Rodriguez S, Martinez-Trillos A, et al. Prognosis…

Continue Reading The progress of novel strategies on immune-based therapy in relapsed or refractory diffuse large B-cell lymphoma

Help with an error with Homer

Help with an error with Homer 0 Hi all, I looked for this error but still don’t know why. Would you please have a suggestion? Thank you so much! findMotifsGenome.pl homer_format hg38 MotifOutput/ -size 200 -mask -len 8 -preparsedDir preparsed_dir I got these files in the output folder: hg38r.200.cgbins hg38r.200.cgfreq…

Continue Reading Help with an error with Homer

Physiological and evolutionary contexts of a new symbiotic species from the nitrogen-recycling gut community of turtle ants

Klepzig KD, Adams AS, Handelsman J, Raffa KF. Symbioses: a key driver of insect physiological processes, ecological interactions, evolutionary diversification, and impacts on humans. Environ Entomol. 2009;38:67–77. CAS  PubMed  Google Scholar  Dale C, Moran NA. Molecular interactions between bacterial symbionts and their hosts. Cell. 2006;126:453–65. CAS  PubMed  Google Scholar  Salem…

Continue Reading Physiological and evolutionary contexts of a new symbiotic species from the nitrogen-recycling gut community of turtle ants

Bioinformatics Programmer – Hybrid/Remote – 123642 Job in , Higher Education Career, Jobs in University of California San Diego

Payroll Title:BIOINFORMATICS PROGR 1 Department:CELLULAR & MOLECULAR MEDICINE Hiring Pay Scale$55,000 – $92,000 / Year Worksite:Hybrid Remote Appointment Type:Career Appointment Percent:100% Union:Uncovered Total Openings:1 Work Schedule:Days, 8 hrs/day, Monday – Friday #123642 Bioinformatics Programmer – Hybrid/RemoteExtended Deadline: Fri 8/4/2023 Apply Now UC San Diego values equity, diversity, and inclusion….

Continue Reading Bioinformatics Programmer – Hybrid/Remote – 123642 Job in , Higher Education Career, Jobs in University of California San Diego

Bioinformatics Programmer – Hybrid/Remote – 123642 job in San Diego, California at University of California – San Diego Medical Centers

UCSD Layoff from Career Appointment: Apply by 6/14/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 6/26/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. This position may have the ability to work in a Hybrid…

Continue Reading Bioinformatics Programmer – Hybrid/Remote – 123642 job in San Diego, California at University of California – San Diego Medical Centers

Help to get differential_peaks.bed to use for findMotifsGenome.pl?

Help to get differential_peaks.bed to use for findMotifsGenome.pl? 0 Hi all, I am trying to use the command findMotifsGenome.pl from HOMER that needs differential_peaks.bed file as input. I used nf-core/atac-seq then DiffBind but not sure how to get differential_peaks.bed file. Would you please have a suggestion? Do I need to…

Continue Reading Help to get differential_peaks.bed to use for findMotifsGenome.pl?

“Very close % of target vs % of Background sequences with Motif” & “SeqBias at 1st rank”

Homer motif analysis: “Very close % of target vs % of Background sequences with Motif” & “SeqBias at 1st rank” 1 Hi everyone. I’m trying to find the motifs bound by my ChIP-ed protein using Homer. I don’t have knowledge regarding NGS analysis. The analysis was done by my labmate…

Continue Reading “Very close % of target vs % of Background sequences with Motif” & “SeqBias at 1st rank”

Exploring the molecular and clinical spectrum of COVID-19-related acute necrotizing encephalopathy in three pediatric cases

Messiah SE, Xie L, Mathew MS, Delclos GL, Kohl HW 3rd, Kahn JS. Results of COVID-19 surveillance in a large United States pediatric healthcare system over one year. Child (Basel). 2021;8:752. Google Scholar  Cloete J, Kruger A, Masha M, du Plessis NM, Mawela D, Tshukudu M, et al. Paediatric hospitalisations…

Continue Reading Exploring the molecular and clinical spectrum of COVID-19-related acute necrotizing encephalopathy in three pediatric cases

DPYSL2/CRMP2 isoform B knockout in human iPSC-derived glutamatergic neurons confirms its role in mTOR signaling and neurodevelopmental disorders

Quach TT, Honnorat J, Kolattukudy PE, Khanna R, Duchemin AM. CRMPs: Critical molecules for neurite morphogenesis and neuropsychiatric diseases. Mol Psychiatry. 2015;20:1037–45. Article  CAS  Google Scholar  Moutal A, White KA, Chefdeville A, Laufmann RN, Vitiello PF, Feinstein D, et al. Dysregulation of CRMP2 post-translational modifications drive its pathological functions. Mol…

Continue Reading DPYSL2/CRMP2 isoform B knockout in human iPSC-derived glutamatergic neurons confirms its role in mTOR signaling and neurodevelopmental disorders

Bioinformatics – Bethesda | Mendeley Careers

Job Description Overall Position Summary and Objectives Under this task order, the contractor will provide support services to satisfy the overall operational objectives. The primary objective is to provide services and deliverables through bioinformatics support services as part of an existing bioinformatics team. Minimum EducationMaster’s Resume Max Pages15 Certifications &…

Continue Reading Bioinformatics – Bethesda | Mendeley Careers

P62/SQSTM1 binds with claudin-2 to target for selective autophagy in stressed intestinal epithelium

McGuckin, M. A., Eri, R., Simms, L. A., Florin, T. H. & Radford-Smith, G. Intestinal barrier dysfunction in inflammatory bowel diseases. Inflamm. Bowel Dis. 15, 100–113 (2009). Article  PubMed  Google Scholar  Ahmad, R., Sorrell, M. F., Batra, S. K., Dhawan, P. & Singh, A. B. Gut permeability and mucosal inflammation:…

Continue Reading P62/SQSTM1 binds with claudin-2 to target for selective autophagy in stressed intestinal epithelium

Global scale phylogeography of functional traits and microdiversity in Prochlorococcus

Costea PI, Munch R, Coelho LP, Paoli L, Sunagawa S, Bork P. metaSNV: a tool for metagenomic strain level analysis. PLoS ONE. 2017;12:1–9. Article  Google Scholar  Callahan BJ, McMurdie PJ, Holmes SP. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J. 2017;11:2639–43. Article  PubMed  PubMed…

Continue Reading Global scale phylogeography of functional traits and microdiversity in Prochlorococcus

problem with HOMER findMotifsGenome.pl

Hi All, I did and ATAC-Seq experiment in different cell lines and I was curious to see if they have different motifs in the open chromatin. I was planning to use HOMER for this, but running from linux bash: findMotifsGenome.pl ATAC_d001_peaks_called_with_homer.txt hg38 ATACAd001_FIND_MOTIF I got this message of error (see…

Continue Reading problem with HOMER findMotifsGenome.pl

CRISPR’d Mosquitoes With All-Male Offspring Could Help Eradicate Malaria

Scientists have long searched for a vaccine against malaria, but it remains one of the deadliest diseases in the world. Almost half of the world’s population lives in areas where malaria transmission occurs, and an estimated 619,000 people died of the disease in 2021. Worse yet, the vast majority of…

Continue Reading CRISPR’d Mosquitoes With All-Male Offspring Could Help Eradicate Malaria

Identify binding motifs within large super enhancer region

Identify binding motifs within large super enhancer region 1 Hello, From my H3K27ac ChIP seq data, I have identified 500 super enhancer regions using Homer’s findPeaks -style super. From the super enhancer regions, I found 4 enriched binding motifs within the 500 super enhancer regions using Homer’s findMotifsGenome.pl. First, I…

Continue Reading Identify binding motifs within large super enhancer region

HOMER Results – SeqBias interpretation and follow-up

Hi everyone, I am using findMotifs from Homer to find enriched motifs in a set of genes of interest. This is the first time I am doing this and I’m a bit confused with some of the results. I am getting a lot of entries with SeqBias, with combinations of…

Continue Reading HOMER Results – SeqBias interpretation and follow-up

How to correctly use bedtools merge for annotated .bed files?

I have two annotated .bed files that each contain 26 columns– the first 3 columns are the standard chr number, start position, and end position, while the remaining columns contain additional information. I want to merge these two annotated .bed files while retaining the information in columns 4-26. To specify,…

Continue Reading How to correctly use bedtools merge for annotated .bed files?

Plotting ATAC-seq data over RNA-seq?

Plotting ATAC-seq data over RNA-seq? 0 Hi everyone, I am new to this space and have no bioinformatics background — with very limited knowledge on data processing. So I apologize ahead of time if any of my questions are extremely stupid or make no sense 🙂 I did manage to…

Continue Reading Plotting ATAC-seq data over RNA-seq?

Mitochondrial DNA is a target of HBV integration

Patients Tumour tissues from seven HBsAg-positive patients (6 men, 1 woman; mean age 66.7 ± 8 years) with HBV-related HCC and paired adjacent non-tumour tissues from six of them were studied. The clinical, histological, and virologic characteristics of the patients are summarised in Table 1. Two normal liver samples from HBV-negative patients who…

Continue Reading Mitochondrial DNA is a target of HBV integration

What Might Life Be Like in 2100? Monmouth College Professors Discuss the Topic, Again

MONMOUTH, ILLINOIS (June 30, 2023) — “The purpose of this book is to help start the debate that will determine how this century unfolds.” — Michio Kaku, author of the 2011 book Physics of the Future: How Science Will Shape Human Destiny and Our Daily Lives by the Year 2100 Everybody…

Continue Reading What Might Life Be Like in 2100? Monmouth College Professors Discuss the Topic, Again

How to find peaks with specific TFs identified by HOMER

How to find peaks with specific TFs identified by HOMER 1 Hi, I have attempted to utilize HOMER to identify peaks associated with specific transcription factors (TFs). I employed “findMotifsGenome.pl” and “annotatePeaks.pl” to extract sequences linked to these TFs. In theory, the results obtained from both methods should be identical….

Continue Reading How to find peaks with specific TFs identified by HOMER

Introduction to Bioinformatics in Transcriptomics and Gene Expression Analysis

Bioinformatics is a field that has revolutionized the way we analyze biological data. It has played a crucial role in the analysis of transcriptomics and gene expression data. Transcriptomics is the study of the transcriptome, which is the complete set of RNA transcripts produced by the genome of an organism….

Continue Reading Introduction to Bioinformatics in Transcriptomics and Gene Expression Analysis

White Sox rally to beat Rangers

CHICAGO: Zach Remillard singled in Elvis Andrus with the go-ahead run on a play that was overturned by video review, and the Chicago White Sox rallied with three runs in eighth inning to beat the Texas Rangers, 7-6, on Tuesday (Wednesday in Manila). Chicago White Sox’s Elvis Andrus, right, scores…

Continue Reading White Sox rally to beat Rangers

DNA Fragment Enrichment for High-Throughput Sequencing

Lesnik E.A., Freier S.M. 1995. Relative thermodynamic stability of DNA, RNA, and DNA:RNA hybrid duplexes: relationship with base composition and structure. Biochemistry. 34, 10807‒10815. Article  CAS  PubMed  Google Scholar  Okou D.T., Steinberg K.M., Middle C., Cutler D.J., Albert T.J., Zwick M.E. 2007. Microarray-based genomic selection for high-throughput resequencing. Nat. Methods….

Continue Reading DNA Fragment Enrichment for High-Throughput Sequencing

Homer not finding hg38 genome – Support scientifique et technique

Hi everyone,I am trying to annotate a .bed file using homer annotatePeaks.pl module load homer/ annotatePeaks.pl ConsensusPeaks.bed hg38 -gtf gencode.v43.annotation.gtf.gz > ConsensusPeaks.annotatedPeaks I obtain the following error message !!!!Genome /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/hg38 not found in /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/.//config.txt To check if is available, run “perl /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/.//configureHomer.pl -list” If so, add it by typing “perl…

Continue Reading Homer not finding hg38 genome – Support scientifique et technique

HOMER annotatePeaks.pl problem

HOMER annotatePeaks.pl problem 1 I am using HOMER to get read mapping around TE (well, I need to make a heatmap). I am using following command: annotatePeaks.pl XXX.bed XXX(genome) -bedGraph XXX.bedgraph -size 200 -hist 2 -ghist -noadj -fragLength 0 > XXX.txt Before running this command, I converted my bed file…

Continue Reading HOMER annotatePeaks.pl problem

Future ocean conditions induce necrosis, microbial dysbiosis and nutrient cycling imbalance in the reef sponge Stylissa flabelliformis

Bell JJ. The functional roles of marine sponges. Estuarine, Coastal Shelf Sci. 2008;79:341–53. Article  Google Scholar  De Goeij JM, Van Oevelen D, Vermeij MJ, Osinga R, Middelburg JJ, de Goeij AF, et al. Surviving in a marine desert: the sponge loop retains resources within coral reefs. Science. 2013;342:108–10. Article  PubMed …

Continue Reading Future ocean conditions induce necrosis, microbial dysbiosis and nutrient cycling imbalance in the reef sponge Stylissa flabelliformis

Key triggers of adaptive genetic variability of sessile oak [Q. petraea (Matt.) Liebl.] from the Balkan refugia: outlier detection and association of SNP loci from ddRAD-seq data

Adamack AT, Gruber B (2014) PopGenReport: simplifying basic population genetic analyses in R. Methods Ecol Evol 5:384–387. doi.org/10.1111/2041-210x.12158 Article  Google Scholar  Aguirre-Liguori JA, Ramírez-Barahona S, Gaut BS (2021) The evolutionary genomics of species’ responses to climate change. Nat Ecol Evol 5:1350–60. doi.org/10.1038/s41559-021-01526-9 Article  PubMed  Google Scholar  Ahrens CW, Rymer PD,…

Continue Reading Key triggers of adaptive genetic variability of sessile oak [Q. petraea (Matt.) Liebl.] from the Balkan refugia: outlier detection and association of SNP loci from ddRAD-seq data

Bioinformatics Programmer – Hybrid/Remote – 123642

UCSD Layoff from Career Appointment: Apply by 6/14/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 6/26/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. This position may have the ability to work in a Hybrid…

Continue Reading Bioinformatics Programmer – Hybrid/Remote – 123642

Transcriptomics and the origin of obligate parthenogenesis

Avise J (2008) Clonality: the genetics, ecology, and evolution of sexual abstinence in vertebrate animals. Oxford University Press, USA Book  Google Scholar  Avise JC (2015) Evolutionary perspectives on clonal reproduction in vertebrate animals. Proc Natl Acad Sci USA 112(29):8867–8873 Article  CAS  PubMed  PubMed Central  Google Scholar  Andrews S (2010) FastQC:…

Continue Reading Transcriptomics and the origin of obligate parthenogenesis

Bioinformatics job with E-talentnetwork | 1401831339

Job Description Overall Position Summary and Objectives Under this task order, the contractor will provide support services to satisfy the overall operational objectives. The primary objective is to provide services and deliverables through bioinformatics support services as part of an existing bioinformatics team. Minimum EducationMaster’s Resume Max Pages15 Certifications &…

Continue Reading Bioinformatics job with E-talentnetwork | 1401831339

Backcrossing to different parents produced two distinct hybrid species

Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC Bioinforma 12:246. doi.org/10.1186/1471-2105-12-246 Article  Google Scholar  Anderegg WRL, Flint A, Huang C-Y, Flint L, Berry JA, Davis FW et al. (2015) Tree mortality predicted from drought-induced vascular damage. Nat Geosci 8:367–371 Article  CAS  Google Scholar …

Continue Reading Backcrossing to different parents produced two distinct hybrid species

Whole-genome sequencing of Listeria monocytogenes isolated from the first listeriosis foodborne outbreak in South Korea

Introduction Although globalization has provided opportunities for consumers to enjoy a wide range of products and expanded global food trade, the complexity of the international food supply has contributed to an increase in foodborne outbreaks (Quested et al., 2010; Hussain and Dawson, 2013). Worldwide efforts have ensured food safety by…

Continue Reading Whole-genome sequencing of Listeria monocytogenes isolated from the first listeriosis foodborne outbreak in South Korea

Genome sequencing and de novo and reference-based genome assemblies of Bos indicus breeds

Asalone KC, Ryan KM, Yamadi M, Cohen AL, Farmer WG, George DJ, Joppert C, Kim K, Mughal MF, Said R, Toksoz-Exley M, Bisk E, Bracht JR (2020) Regional sequence expansion or collapse in heterozygous genome assemblies. PLoS Comput Biol. doi.org/10.1371/journal.pcbi.1008104 Article  PubMed  PubMed Central  Google Scholar  Bankevich A, Nurk S,…

Continue Reading Genome sequencing and de novo and reference-based genome assemblies of Bos indicus breeds

Pangenomics of the death cap mushroom Amanita phalloides, and of Agaricales, reveals dynamic evolution of toxin genes in an invasive range

Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA, et al. The population biology of invasive species. Annu Rev Ecol Syst. 2001;32:305–32. Article  Google Scholar  Allendorf FW, Lundquist LL. Introduction: population biology, evolution, and control of invasive species. Conserv Biol. 2003;17:24–30. Article  Google Scholar  Erickson AB. The…

Continue Reading Pangenomics of the death cap mushroom Amanita phalloides, and of Agaricales, reveals dynamic evolution of toxin genes in an invasive range

Tracing the introduction of the invasive common myna using population genomics

Acclimatisation (6 January 1877) Southland Times. Page 2. paperspast.natlib.govt.nz/newspapers/ST18770105.2.7. Accessed 21 January 2022 Adamack AT, Gruber B (2014) PopGenReport: simplifying basic population genetic analyses in R. Methods Ecol Evol 5:384–387. doi.org/10.1111/2041-210x.12158 Article  Google Scholar  Andrews S (2010) FastQC. A quality control tool for high throughput sequence data. www.bioinformatics.babraham.ac.uk/projects/fastqc/ Andrews KR,…

Continue Reading Tracing the introduction of the invasive common myna using population genomics

Homer detailed annotation

Homer detailed annotation 1 Dear, I used HOMER annotatePeaks.pl to annotate my peaks. Here is the format for my code: annotatePeaks.pl peak.bed ref.fa -gff3 ref.gff3 > PeakAnno.txt. But, I don’t know why it is “NA” for the columns of “Focus Ratio/Region Size” and Detailed Annotation””? I am more interested in…

Continue Reading Homer detailed annotation

ATP6V0C gene variants were identified in individuals with epilepsy, with or without developmental delay

Steering Committee on Quality Improvement and Management, Subcommittee on Febrile Seizures American Academy of Pediatrics. Febrile seizures clinical practice guideline for the long-term management of the child with simple febrile seizures. Pediatrics. 2008;121:1281–6. Camfield P, Camfield C. Febrile seizures and genetic epilepsy with febrile seizures plus (GEFS+). Epileptic Disord. 2015;17:124–33….

Continue Reading ATP6V0C gene variants were identified in individuals with epilepsy, with or without developmental delay

The origin and possible mechanism of embryonic cell-free DNA release in spent embryo culture media: a review

Menasha J, Levy B, Hirschhorn K, Kardon NB. Incidence and spectrum of chromosome abnormalities in spontaneous abortions: new insights from a 12-year study. Genet Med. 2005;7(4):251–63. doi.org/10.1097/01.GIM.0000160075.96707.04. Article  PubMed  Google Scholar  Munné S, Chen S, Collis P, Garrisi J, Zheng X, Cekleniak N, et al. Maternal age, morphology, development and…

Continue Reading The origin and possible mechanism of embryonic cell-free DNA release in spent embryo culture media: a review

Hot spring distribution and survival mechanisms of thermophilic comammox Nitrospira

Daims H, Lebedeva EV, Pjevac P, Han P, Herbold C, Albertsen M, et al. Complete nitrification by Nitrospira bacteria. Nature 2015;528:504. Article  CAS  PubMed  PubMed Central  Google Scholar  van Kessel MA, Speth DR, Albertsen M, Nielsen PH, den Camp HJO, Kartal B, et al. Complete nitrification by a single microorganism….

Continue Reading Hot spring distribution and survival mechanisms of thermophilic comammox Nitrospira

homer – How much of the space of motifs have been discovered?

I notice when using tools like HOMER there are two different types of outputs: de novo motifs vs known motifs and it seems no matter what the data is (type of ChIP etc.) there is always a “de novo” motif set in the results. I was hoping to reach out…

Continue Reading homer – How much of the space of motifs have been discovered?

Genome-resolved metagenomics revealed metal-resistance, geochemical cycles in a Himalayan hot spring

Agency for Toxic Substances and Disease Registry (ATSDR) (2002) Toxicological profile for copper. Atlanta, GA: Centers for Disease Control Ahemad M (2012) Implications of bacterial resistance against heavy metals in bioremediation: A review. IIOAB J 3:39–46 CAS  Google Scholar  Alcamán-Arias ME, Pedrós-Alió C, Tamames J, Fernández C, Pérez-Pantoja D, Vásquez M,…

Continue Reading Genome-resolved metagenomics revealed metal-resistance, geochemical cycles in a Himalayan hot spring

Genomic insights into the coupling of a Chlorella-like microeukaryote and sulfur bacteria in the chemocline of permanently stratified Lake Cadagno

Philippi M, Kitzinger K, Berg JS, Tschitschko B, Kidane AT, Littmann S, et al. Purple sulfur bacteria fix N2 via molybdenum-nitrogenase in a low molybdenum Proterozoic ocean analogue. Nat Commun. 2021;12:4774. Article  CAS  PubMed  PubMed Central  Google Scholar  Xiong Y, Guilbaud R, Peacock CL, Cox RP, Canfield DE, Krom MD,…

Continue Reading Genomic insights into the coupling of a Chlorella-like microeukaryote and sulfur bacteria in the chemocline of permanently stratified Lake Cadagno

The Genetic Response Of An Earth Plant – Off World – In Microgravity

The specific assay and tissue types for each dataset are indicated with network clustering based on hardware. See Supplementary Data 1 and 2 for the Matrix driving this visualization. Note the hardware used to analyze plant response to spaceflight often defines the types of tissue that are available and so…

Continue Reading The Genetic Response Of An Earth Plant – Off World – In Microgravity

The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities

C. elegans strains All strains were cultured under standard conditions78 and were always incubated at 20 °C during the experiments. The strains used were N2 (Bristol; WT): DREAM: MT8839 lin-52(n771) III, MT10430 lin-35(n745) I, MT15107 lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III), MT8879 dpl-1(n2994) II, MT11147 dpl-1(n3643) II, JJ1549 efl-1(se1) V, BJS634…

Continue Reading The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities

The persistence and stabilization of auxiliary genes in the human skin virome | Virology Journal

Breitbart M, Bonnain C, Malki K, Sawaya NA. Phage puppet masters of the marine microbial realm. Nat Microbiol. 2018;3:754–66. Article  CAS  PubMed  Google Scholar  Suttle CA. Marine viruses—major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–12. Article  CAS  PubMed  Google Scholar  Breitbart M. Marine viruses: truth or dare. Ann…

Continue Reading The persistence and stabilization of auxiliary genes in the human skin virome | Virology Journal

Homer annotatePeaks for enrichment analysis

Homer annotatePeaks for enrichment analysis 0 I want to test differentially methylated regions (DMRs; identified in whole genome bisulfite sequencing data) for enrichment of certain genomic features. For example, do I see more DMRs in promoters than I would expect by chance? It was suggested to me that a simple…

Continue Reading Homer annotatePeaks for enrichment analysis

ChIPseq w/ polyploid genome : Xenopus laevis

ChIPseq w/ polyploid genome : Xenopus laevis 0 Hello, I have recently undertaken reanalyzing a transcription factor ChIPseq done in Xenopus laevis. I started with the raw data, which includes two replicates for a transcription factor chip, and a DNA input control file. These are all fastq files. After aligning…

Continue Reading ChIPseq w/ polyploid genome : Xenopus laevis

Problem with homer in findMotifs.pl when using input and bg fasta

I am using the following command: findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp The input and bg fasta have this structure and the bg fasta include all sequences in input plus many others: >ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+) ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG However I get the following…

Continue Reading Problem with homer in findMotifs.pl when using input and bg fasta

Co-diversification of an intestinal Mycoplasma and its salmonid host

Alberdi A, Aizpurua O, Bohmann K, Zepeda-Mendoza ML, Gilbert MTP. Do vertebrate gut metagenomes confer rapid ecological adaptation? Trends Ecol Evol 2016;31:689–99. Article  PubMed  Google Scholar  Groussin M, Mazel F, Alm EJ. Co-evolution and co-speciation of host-gut bacteria systems. Cell Host Microbe. 2020;28:12–22. Article  CAS  PubMed  Google Scholar  Alberdi A,…

Continue Reading Co-diversification of an intestinal Mycoplasma and its salmonid host

addGeneAnnotation.pl: not found

addGeneAnnotation.pl: not found 2 hey community, I am facing a problem related to the quantification step of RNAseq analysis: I have run this command ‘ /home/aarmich/Documents/000TOOLS/homer/bin/analyzeRepeats.pl rna hg38 -count genes -d /home/aarmich/Documents/000TOOLS/homer/A549ctrl_RNAseq_hg38 /home/aarmich/Documents/000TOOLS/homer/A549TGFB_RNAseq_hg38 -noadj > lastt.txt and terminal is responding like this: missing NM_003718… missing NM_152604… missing NM_001114132… missing NR_149079……

Continue Reading addGeneAnnotation.pl: not found

Dissecting cell identity via network inference and in silico gene perturbation

CellOverview of the Oracle algorithm The CellOracle workflow is made up of several steps. We Tested and implemented CellOracle Python Versions 3.6 and 3.8 were developed and made available for use in the Jupyter Notepad environment CellOracle code can be downloaded open-source on GitHub.github.com/morris-lab/CellOracle), along with detailed descriptions of functions…

Continue Reading Dissecting cell identity via network inference and in silico gene perturbation

Closed genomes uncover a saltwater species of Candidatus Electronema and shed new light on the boundary between marine and freshwater cable bacteria

Pfeffer C, Larsen S, Song J, Dong M, Besenbacher F, Meyer RL, et al. Filamentous bacteria transport electrons over centimetre distances. Nature. 2012;491:218–21. Article  CAS  Google Scholar  Lovley DR, Holmes DE. Electromicrobiology: the ecophysiology of phylogenetically diverse electroactive microorganisms. Nat Rev Microbiol. 2022;20:5–19. Article  CAS  Google Scholar  Bjerg JT, Boschker…

Continue Reading Closed genomes uncover a saltwater species of Candidatus Electronema and shed new light on the boundary between marine and freshwater cable bacteria

Performance evaluation of six popular short-read simulators

Acinas SG, Sarma-Rupavtarm R, Klepac-Ceraj V, Polz MF (2005) PCR-induced sequence artifacts and bias: insights from comparison of two 16S rRNA clone libraries constructed from the same sample. Appl Environ Microbiol 71(12):8966–8969 Article  CAS  Google Scholar  Alosaimi S, Bandiang A, van Biljon N, Awany D, Thami PK, Tchamga MSS et…

Continue Reading Performance evaluation of six popular short-read simulators

Contrasting levels of hybridization across the two contact zones between two hedgehog species revealed by genome-wide SNP data

Ai H, Fang X, Yang B, Huang Z, Chen H, Mao L et al. (2015) Adaptation and possible ancient interspecies introgression in pigs identified by whole-genome sequencing. Nat Genet 47:217–225 CAS  PubMed  Article  Google Scholar  Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC…

Continue Reading Contrasting levels of hybridization across the two contact zones between two hedgehog species revealed by genome-wide SNP data

Genome hg19**not found in homer config

I want to use the Homer to do annotation. After I input “annotatePeaks.pl 31512_TH0_D0.bed hg19 > 31512_TH0_D0.ann.txt” , it shows “!!!!Genome hg19 not found in /home/jenny/NGStools/homer/.//config.txt” I used the command “perl /home/jenny/NGStools/homer/configureHomer.pl -install hg19” to install it, and I am sure I installed the hg19 for the homer Then input…

Continue Reading Genome hg19**not found in homer config

Convert bedGraph to Homer tag directory?

Convert bedGraph to Homer tag directory? 0 Hi, I am new to ChIP-seq analysis. When taking published data in .bedGraph format (generated by Homer), is there any way to convert back to Homer tag directory? (other than aligning from the raw .fasta). I suppose extracting columns into .bed format and…

Continue Reading Convert bedGraph to Homer tag directory?

Create junctions from Bed file for IGV visualization

Create junctions from Bed file for IGV visualization 0 Any advice for creating junctions file from a bed-like file? My bed file looks like this: chr start end chr star end I have tried to copy the format used in TopHat (junctions file). But I can’t see the junctions in…

Continue Reading Create junctions from Bed file for IGV visualization

How to map query coordinates on to genome gff annoation files ?

How to map query coordinates on to genome gff annoation files ? 0 Hello Researchers I have a project where i got stuck on :- mapping query coordinates on to gff annoation files, means i have to find all the total counts of gene, mRNA, exon, CDS, 3′-utr, 5′-utr, promoter,…

Continue Reading How to map query coordinates on to genome gff annoation files ?

merging .narrowPeak files with all of the columns they have

merging .narrowPeak files with all of the columns they have 0 Hello, I want to ask about merging concept of .narrowPeak files generated by macs2. I am merging them with HOMER mergePeaks as I found the most informative one (compared to the bedops, bedtools). However, for the downstream analyses I…

Continue Reading merging .narrowPeak files with all of the columns they have

How to prepare HiCUP output as input for HOMER?

HiC analysis: How to prepare HiCUP output as input for HOMER? 0 Hi everyone, I am new to HiC and using HiCUP to analyse HiC data (I will try other pipelines and combination of software eventually). /tools/hicup –zip –bowtie2 /tools/bowtie2-2.3.4.1-linux-x86_64/bowtie2 –index /hg38/hg38 –digest /hg38/Digest_hg38_HindIII_None_15-12-15_27-10-2021.txt R1.fastq R2.fastq For now, I aligned…

Continue Reading How to prepare HiCUP output as input for HOMER?

Frontiers | Accelerating Complete Phytoplasma Genome Assembly by Immunoprecipitation-Based Enrichment and MinION-Based DNA Sequencing for Comparative Analyses

Introduction Phytoplasmas are wall-less bacterial pathogens that are known to infect numerous plant species and lead to significant agricultural losses (Gurr et al., 2016; Kumari et al., 2019; Pierro et al., 2019). They are parasitic bacteria multiplying exclusively in phloem sieve elements and are transmitted between plants by phloem-feeding insects…

Continue Reading Frontiers | Accelerating Complete Phytoplasma Genome Assembly by Immunoprecipitation-Based Enrichment and MinION-Based DNA Sequencing for Comparative Analyses

Exavir Therapeutics announces preclinical data demonstrating complete elimination of HIV from human cells with LNP-delivered Tat-targeted CRISPR-Cas9

Early candidate from XVIR-TAT series demonstrated genetic elimination of HIV and robust anti-retroviral activity with CRISPR-Cas9 based excision Exavir lipid nanoparticles (LNPs) with mRNA encoding Cas9 nuclease and proprietary Tat-targeted gRNAs demonstrated up to 100% HIV suppression in infected human cells Exavir is optimizing LNP formulations for tissue tropism, and…

Continue Reading Exavir Therapeutics announces preclinical data demonstrating complete elimination of HIV from human cells with LNP-delivered Tat-targeted CRISPR-Cas9

ChIP-seq analysis differential peak analysis regarding spike-in

ChIP-seq analysis differential peak analysis regarding spike-in 0 Hi, I have 4 human ChIP-seq datasets, including drug A treated H3K4me3 and IgG, and drug B treated H3K4me3 and IgG. Meanwhile, sacCer3 spike-in data is added to human ChIP-seq data. Here is what I did: After aligning, I got 8 bam…

Continue Reading ChIP-seq analysis differential peak analysis regarding spike-in

Bioconductor – Bioconductor 3.14 Released

Home Bioconductor 3.14 Released October 27, 2021 Bioconductors: We are pleased to announce Bioconductor 3.14, consisting of 2083 software packages, 408 experiment data packages, 904 annotation packages, 29 workflows and 8 books. There are 89 new software packages, 13 new data experiment packages, 10 new annotation packages, 1 new workflow,…

Continue Reading Bioconductor – Bioconductor 3.14 Released

Finding Instance of Specific Motifs

Homer – Finding Instance of Specific Motifs 0 Hello everyone! I’m relatively new to bioinformatics, so sorry if this question sounds silly! I have started to use Homer to find a specific motif in a list of genes. The matter is: when I run findMotifsGenome.pl using -find <motif file> ,…

Continue Reading Finding Instance of Specific Motifs