Tag: HOMER

Introduction Short-read metagenomic sequencing is the technique most widely used to explore the natural habitat of millions of bacteria. In comparison with 16S rRNA sequencing, shotgun metagenomic sequencing (MGS) provides sequence information of the whole genomes, which can be used to identify different genes present in an individual bacterium and…

Hu T, Chitnis N, Monos D, Dinh A. Next-generation sequencing technologies: an overview. Hum Immunol. 2021;82(11):801–11. Article  CAS  Google Scholar  Jeon SA, Park JL, Park SJ, Kim JH, Goh SH, Han JY, Kim SY. Comparison between MGI and Illumina sequencing platforms for whole genome sequencing. Genes Genomics. 2021;43(7):713–24. Article  CAS …

Tissue preparation and nucleus isolation All experimental procedures using live animals were approved by the SALK Institute Animal Care and Use Committee under protocol number 18-00006. Adult C57BL/6J male mice were purchased from Jackson Laboratories. Brains were extracted from 56–63-day-old mice and sectioned into 600 µm coronal sections along the anterior–posterior…

Overlapping and merging ChIP-seq peaks 0 Hi all, I have ChIP-seq data sets for two different proteins (let’s call them A and B) in the same cell line that need to form a dimer in order to function as an active TF. Protein A can form either a homodimer (A/A)…

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. Article  PubMed  Google Scholar  Giaquinto AN, Sung H, Miller KD, Kramer JL, Newman LA,…

Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…

Caratti S, Turrina S, Ferrian M et al (August 2015) MiSeq FGx sequencing system: a new platform for forensic genetics. Forensic Sci Int Genet Suppl Ser 5:e98–e100. doi.org/10.1016/j.fsigss.2015.09.040 Elkins KM, Garloff AT, Zeller CB (2023) Additional predictions for forensic DNA phenotyping of externally visible characteristics using the ForenSeq and Imagen…

Oppler Z, Keeffe K, McCoy K, Brisson D. Evolutionary genetics of Borrelia. Curr Issues Mol Biol. 2021;42:97–112. doi.org/10.21775/cimb.042.097.2. Article  PubMed  Google Scholar  Margos G, Fingerle V, Cutler S, Gofton A, Stevenson B, Estrada-Peña A. Controversies in bacterial taxonomy: the example of the genus Borrelia. Ticks Tick Borne Dis. 2020;11:101335. doi.org/10.1016/j.ttbdis.2019.101335….

Find Genes in Homer Analysis that have the enriched Motif 0 Hello, I recently did a Homer analysis using a set of genes to find enriched Motifs. It worked and now I am interested in knowing for one certain Motif, which genes lead to the enrichment of this Motif. Feels…

Introduction The development of multicellular organisms requires the activation of different gene batteries which specify the identity of each individual cell type. Such shifts in cellular identity are driven by shifts in the gene regulatory network (GRN) consisting of transcription factors (TFs) binding to the enhancers and promoters of their…

Abstract Mycobacterium avium complex (MAC) infections are a significant clinical challenge. Determining drug-susceptibility profiles and the genetic basis of drug resistance is crucial for guiding effective treatment strategies. This study aimed to determine the drug-susceptibility profiles of MAC clinical isolates and to investigate the genetic basis conferring drug resistance using…

Developing an epigenetic screening platform in human T cells Staphylococcus aureus Cas9 (SaCas9) has been extensively used for genome editing in vivo as its compact size (3,159 bp) relative to the conventional Streptococcus pyogenes Cas9 (SpCas9) enables packaging into adeno-associated virus26,27,28. However, SaCas9 has not been widely used for targeted gene…

distance between chip peaks and individual TSS 0 I have generated my peak data through chip sequencing data and I have individual transcription sites coordinates from RNA sequencing data. How to compare the distance between these TSS and peaks, so that I can find the closest TSS to peak and…

To begin open MATLAB, then navigate to the folder where the raw and irs files are saved. Select and open the folder. Type Homer3 into the command window of MATLAB to launch the Homer3 GUI. Homer3 will detect the nirs files and ask to convert them to snirf format to…

Zack TI, Schumacher SE, Carter SL, Cherniack AD, Saksena G, Tabak B, Lawrence MS, Zhang C-Z, Wala J, Mermel CH. Pan-cancer patterns of somatic copy number alteration. Nat Genet. 2013;45:1134–40. Article  CAS  PubMed  PubMed Central  Google Scholar  Dixon JR, Xu J, Dileep V, Zhan Y, Song F, Le VT, Yardımcı…

Cross validate RNA-seq and ATAC-seq 1 Hi, I have RNA-seq and ATAC-seq for the same samples. I wish to cross-validate two datasets. I got DEGs from RNA-seq and DARs from ATAC-seq. I annotated DARs (differentially accessible regions) using Homer, so I got their nearest gene information. Would it be reasonable…

Models for single-cell ATAC-seq data In single-cell ATAC-seq data, \(x_{ij}\) is the number of unique reads mapping to peak or region j in cell i. Although \(x_{ij}\) can take non-negative integer values, it is common to “binarize” the accessibility data (e.g., [19, 74, 133,134,135]), meaning that \(x_{ij} = 1\) when…

Get the strongest TF binding regions for Chip-Seq 0 Hi All, Is there a package / program that finds the peaks with the most differential pileup between the condition and input? For example, I am currently calling peaks with HOMER and MACS2; these programs automatically determine if the amount of…

Chapman HD, Rathinam T. Focused review: the role of drug combinations for the control of coccidiosis in commercially reared chickens. Int J Parasitol Drugs Drug Resist. 2022;18:32–42. PubMed  PubMed Central  Google Scholar  Peek HW, Landman WJM. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 2011;31:143–61. CAS …

De Rubeis S, He X, Goldberg AP, Poultney CS, Samocha K, Cicek AE, et al. Synaptic, transcriptional and chromatin genes disrupted in autism. Nature. 2014;515:209–15. Article  PubMed  PubMed Central  Google Scholar  Iossifov I, O’Roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, et al. The contribution of de novo…

UCSD Layoff from Career Appointment: Apply by 10/18/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 10/27/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. The Moores Cancer Center (MCC) is one of just 54 NCI-designated…

Today, Craft Recordings announces its exclusive line-up of titles for RSD Black Friday, taking place on November 24 at participating independent retailers. This year’s releases include seven limited-edition pressings from a wide range of genres and eras, encompassing everything from midcentury jazz to post-millennium punk. For jazz aficionados, offerings include…

Richardson TL, Jackson GA. Small phytoplankton and carbon export from the surface ocean. Science. 2007;315:838–40. Article  CAS  PubMed  Google Scholar  Flombaum P, Gallegos JL, Gordillo RA, Rincón J, Zabala LL, Jiao N, et al. Present and future global distributions of the marine Cyanobacteria Prochlorococcus and Synechococcus. Proc Natl Acad Sci…

Samples for H3K27ac ChIP–seq Samples were collected by the GTEx Consortium. The donor enrollment and consent, informed consent approval, histopathological review procedures, and biospecimen procurement methods and fixation were the same as previously described22. No compensation was provided to the families of participants. Massachusetts Institute of Technology Committee on the…

Source: Youtube.com The era of big data has revolutionized the way we analyze and interpret complex biological systems. In the field of genomics, Chip-Seq (Chromatin Immunoprecipitation Sequencing) data has become a valuable resource for understanding gene regulation and the functionality of the genome. Chip-Seq data provides insights into the binding…

Details Posted: 12-Sep-23 Location: La Jolla, California Salary: Open This position is a contract/limited position with the possibility of extension/career conversion. UCSD Layoff from Career Appointment: Apply by 09/13/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 09/25/2023. Eligible…

This position is a contract/limited position with the possibility of extension/career conversion. UCSD Layoff from Career Appointment: Apply by 09/13/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 09/25/2023. Eligible Special Selection clients should contact their Disability Counselor for…

Mboowa G, Sserwadda I, Bulafu D, Chaplain D, Wewedru I, Seni J, et al. Transmission Dynamics of Antimicrobial Resistance at a National Referral Hospital in Uganda. Am J Trop Med Hyg. 2021;105(2):498–506. Article  CAS  PubMed  PubMed Central  Google Scholar  Rossolini GM, Arena F, Pecile P. Pollini SJCoip. Update on the…

I presume that downloading script produces some output. I would split your rule into two rules, one specifically for downloading and the other only for running the annotation. The downloading rule will have declared only the output directive, which would be the input for the second rule. rule download_genome: output:…

Filtering transcription factor and HOMER and ENCODE 0 Hello, I have a list of transcription factors identified by HOMER tool form MACS2 peak called. I want to filter this list as it has about 70 TFs. Does anyone know about ENCODE transcription factor database and how to use that database…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, and was edited by Istvan…

homer motif search 0 I have used findMotifsGenome.pl from HOMER to find motif, its output have many files including knownResults.html and homerResults.html. which output file should I consider for my downstream studies and what is difference between these two files? search motif HOMER • 23 views Login before adding your…

Assign gene to peak in bulk ATAC-seq 0 Hi all, I have some questions about bulk ATAC-seq that I don’t understand, hope that you can help. If we have a task to identify which genes in a sample (such as diseased) are in open chromatin region, is that using differential…

Interpreting HOMER peak calling score and annotation file 0 Hello, I used homer for peak calling and peak annotation for two different conditions. I want to count the differential peaks, which are the peaks that exist in one file but not the other. My question is: Do I simply see…

Susanibar-Adaniya S, Barta SK. 2021 Update on diffuse large B cell lymphoma: a review of current data and potential applications on risk stratification and management. Am J Hematol. 2021;96:617–29. Article  PubMed  PubMed Central  Google Scholar  Rovira J, Valera A, Colomo L, Setoain X, Rodriguez S, Martinez-Trillos A, et al. Prognosis…

Help with an error with Homer 0 Hi all, I looked for this error but still don’t know why. Would you please have a suggestion? Thank you so much! findMotifsGenome.pl homer_format hg38 MotifOutput/ -size 200 -mask -len 8 -preparsedDir preparsed_dir I got these files in the output folder: hg38r.200.cgbins hg38r.200.cgfreq…

Klepzig KD, Adams AS, Handelsman J, Raffa KF. Symbioses: a key driver of insect physiological processes, ecological interactions, evolutionary diversification, and impacts on humans. Environ Entomol. 2009;38:67–77. CAS  PubMed  Google Scholar  Dale C, Moran NA. Molecular interactions between bacterial symbionts and their hosts. Cell. 2006;126:453–65. CAS  PubMed  Google Scholar  Salem…

Payroll Title:BIOINFORMATICS PROGR 1 Department:CELLULAR & MOLECULAR MEDICINE Hiring Pay Scale$55,000 – $92,000 / Year Worksite:Hybrid Remote Appointment Type:Career Appointment Percent:100% Union:Uncovered Total Openings:1 Work Schedule:Days, 8 hrs/day, Monday – Friday #123642 Bioinformatics Programmer – Hybrid/RemoteExtended Deadline: Fri 8/4/2023 Apply Now UC San Diego values equity, diversity, and inclusion….

UCSD Layoff from Career Appointment: Apply by 6/14/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 6/26/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. This position may have the ability to work in a Hybrid…

Help to get differential_peaks.bed to use for findMotifsGenome.pl? 0 Hi all, I am trying to use the command findMotifsGenome.pl from HOMER that needs differential_peaks.bed file as input. I used nf-core/atac-seq then DiffBind but not sure how to get differential_peaks.bed file. Would you please have a suggestion? Do I need to…

Homer motif analysis: “Very close % of target vs % of Background sequences with Motif” & “SeqBias at 1st rank” 1 Hi everyone. I’m trying to find the motifs bound by my ChIP-ed protein using Homer. I don’t have knowledge regarding NGS analysis. The analysis was done by my labmate…

Messiah SE, Xie L, Mathew MS, Delclos GL, Kohl HW 3rd, Kahn JS. Results of COVID-19 surveillance in a large United States pediatric healthcare system over one year. Child (Basel). 2021;8:752. Google Scholar  Cloete J, Kruger A, Masha M, du Plessis NM, Mawela D, Tshukudu M, et al. Paediatric hospitalisations…

Quach TT, Honnorat J, Kolattukudy PE, Khanna R, Duchemin AM. CRMPs: Critical molecules for neurite morphogenesis and neuropsychiatric diseases. Mol Psychiatry. 2015;20:1037–45. Article  CAS  Google Scholar  Moutal A, White KA, Chefdeville A, Laufmann RN, Vitiello PF, Feinstein D, et al. Dysregulation of CRMP2 post-translational modifications drive its pathological functions. Mol…

Job Description Overall Position Summary and Objectives Under this task order, the contractor will provide support services to satisfy the overall operational objectives. The primary objective is to provide services and deliverables through bioinformatics support services as part of an existing bioinformatics team. Minimum EducationMaster’s Resume Max Pages15 Certifications &…

McGuckin, M. A., Eri, R., Simms, L. A., Florin, T. H. & Radford-Smith, G. Intestinal barrier dysfunction in inflammatory bowel diseases. Inflamm. Bowel Dis. 15, 100–113 (2009). Article  PubMed  Google Scholar  Ahmad, R., Sorrell, M. F., Batra, S. K., Dhawan, P. & Singh, A. B. Gut permeability and mucosal inflammation:…

Costea PI, Munch R, Coelho LP, Paoli L, Sunagawa S, Bork P. metaSNV: a tool for metagenomic strain level analysis. PLoS ONE. 2017;12:1–9. Article  Google Scholar  Callahan BJ, McMurdie PJ, Holmes SP. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J. 2017;11:2639–43. Article  PubMed  PubMed…

Hi All, I did and ATAC-Seq experiment in different cell lines and I was curious to see if they have different motifs in the open chromatin. I was planning to use HOMER for this, but running from linux bash: findMotifsGenome.pl ATAC_d001_peaks_called_with_homer.txt hg38 ATACAd001_FIND_MOTIF I got this message of error (see…

Scientists have long searched for a vaccine against malaria, but it remains one of the deadliest diseases in the world. Almost half of the world’s population lives in areas where malaria transmission occurs, and an estimated 619,000 people died of the disease in 2021. Worse yet, the vast majority of…

Identify binding motifs within large super enhancer region 1 Hello, From my H3K27ac ChIP seq data, I have identified 500 super enhancer regions using Homer’s findPeaks -style super. From the super enhancer regions, I found 4 enriched binding motifs within the 500 super enhancer regions using Homer’s findMotifsGenome.pl. First, I…

Hi everyone, I am using findMotifs from Homer to find enriched motifs in a set of genes of interest. This is the first time I am doing this and I’m a bit confused with some of the results. I am getting a lot of entries with SeqBias, with combinations of…

I have two annotated .bed files that each contain 26 columns– the first 3 columns are the standard chr number, start position, and end position, while the remaining columns contain additional information. I want to merge these two annotated .bed files while retaining the information in columns 4-26. To specify,…

Plotting ATAC-seq data over RNA-seq? 0 Hi everyone, I am new to this space and have no bioinformatics background — with very limited knowledge on data processing. So I apologize ahead of time if any of my questions are extremely stupid or make no sense 🙂 I did manage to…

Patients Tumour tissues from seven HBsAg-positive patients (6 men, 1 woman; mean age 66.7 ± 8 years) with HBV-related HCC and paired adjacent non-tumour tissues from six of them were studied. The clinical, histological, and virologic characteristics of the patients are summarised in Table 1. Two normal liver samples from HBV-negative patients who…

MONMOUTH, ILLINOIS (June 30, 2023) — “The purpose of this book is to help start the debate that will determine how this century unfolds.” — Michio Kaku, author of the 2011 book Physics of the Future: How Science Will Shape Human Destiny and Our Daily Lives by the Year 2100 Everybody…

How to find peaks with specific TFs identified by HOMER 1 Hi, I have attempted to utilize HOMER to identify peaks associated with specific transcription factors (TFs). I employed “findMotifsGenome.pl” and “annotatePeaks.pl” to extract sequences linked to these TFs. In theory, the results obtained from both methods should be identical….

Bioinformatics is a field that has revolutionized the way we analyze biological data. It has played a crucial role in the analysis of transcriptomics and gene expression data. Transcriptomics is the study of the transcriptome, which is the complete set of RNA transcripts produced by the genome of an organism….

CHICAGO: Zach Remillard singled in Elvis Andrus with the go-ahead run on a play that was overturned by video review, and the Chicago White Sox rallied with three runs in eighth inning to beat the Texas Rangers, 7-6, on Tuesday (Wednesday in Manila). Chicago White Sox’s Elvis Andrus, right, scores…

Lesnik E.A., Freier S.M. 1995. Relative thermodynamic stability of DNA, RNA, and DNA:RNA hybrid duplexes: relationship with base composition and structure. Biochemistry. 34, 10807‒10815. Article  CAS  PubMed  Google Scholar  Okou D.T., Steinberg K.M., Middle C., Cutler D.J., Albert T.J., Zwick M.E. 2007. Microarray-based genomic selection for high-throughput resequencing. Nat. Methods….

Hi everyone,I am trying to annotate a .bed file using homer annotatePeaks.pl module load homer/ annotatePeaks.pl ConsensusPeaks.bed hg38 -gtf gencode.v43.annotation.gtf.gz > ConsensusPeaks.annotatedPeaks I obtain the following error message !!!!Genome /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/hg38 not found in /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/.//config.txt To check if is available, run “perl /shared/ifbstor1/software/miniconda/envs/homer-4.11/share/homer/.//configureHomer.pl -list” If so, add it by typing “perl…

HOMER annotatePeaks.pl problem 1 I am using HOMER to get read mapping around TE (well, I need to make a heatmap). I am using following command: annotatePeaks.pl XXX.bed XXX(genome) -bedGraph XXX.bedgraph -size 200 -hist 2 -ghist -noadj -fragLength 0 > XXX.txt Before running this command, I converted my bed file…

Bell JJ. The functional roles of marine sponges. Estuarine, Coastal Shelf Sci. 2008;79:341–53. Article  Google Scholar  De Goeij JM, Van Oevelen D, Vermeij MJ, Osinga R, Middelburg JJ, de Goeij AF, et al. Surviving in a marine desert: the sponge loop retains resources within coral reefs. Science. 2013;342:108–10. Article  PubMed …

Adamack AT, Gruber B (2014) PopGenReport: simplifying basic population genetic analyses in R. Methods Ecol Evol 5:384–387. doi.org/10.1111/2041-210x.12158 Article  Google Scholar  Aguirre-Liguori JA, Ramírez-Barahona S, Gaut BS (2021) The evolutionary genomics of species’ responses to climate change. Nat Ecol Evol 5:1350–60. doi.org/10.1038/s41559-021-01526-9 Article  PubMed  Google Scholar  Ahrens CW, Rymer PD,…

UCSD Layoff from Career Appointment: Apply by 6/14/2023 for consideration with preference for rehire. All layoff applicants should contact their Employment Advisor. Special Selection Applicants: Apply by 6/26/2023. Eligible Special Selection clients should contact their Disability Counselor for assistance. This position may have the ability to work in a Hybrid…

Avise J (2008) Clonality: the genetics, ecology, and evolution of sexual abstinence in vertebrate animals. Oxford University Press, USA Book  Google Scholar  Avise JC (2015) Evolutionary perspectives on clonal reproduction in vertebrate animals. Proc Natl Acad Sci USA 112(29):8867–8873 Article  CAS  PubMed  PubMed Central  Google Scholar  Andrews S (2010) FastQC:…

Job Description Overall Position Summary and Objectives Under this task order, the contractor will provide support services to satisfy the overall operational objectives. The primary objective is to provide services and deliverables through bioinformatics support services as part of an existing bioinformatics team. Minimum EducationMaster’s Resume Max Pages15 Certifications &…

Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC Bioinforma 12:246. doi.org/10.1186/1471-2105-12-246 Article  Google Scholar  Anderegg WRL, Flint A, Huang C-Y, Flint L, Berry JA, Davis FW et al. (2015) Tree mortality predicted from drought-induced vascular damage. Nat Geosci 8:367–371 Article  CAS  Google Scholar …

Introduction Although globalization has provided opportunities for consumers to enjoy a wide range of products and expanded global food trade, the complexity of the international food supply has contributed to an increase in foodborne outbreaks (Quested et al., 2010; Hussain and Dawson, 2013). Worldwide efforts have ensured food safety by…

Asalone KC, Ryan KM, Yamadi M, Cohen AL, Farmer WG, George DJ, Joppert C, Kim K, Mughal MF, Said R, Toksoz-Exley M, Bisk E, Bracht JR (2020) Regional sequence expansion or collapse in heterozygous genome assemblies. PLoS Comput Biol. doi.org/10.1371/journal.pcbi.1008104 Article  PubMed  PubMed Central  Google Scholar  Bankevich A, Nurk S,…

Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA, et al. The population biology of invasive species. Annu Rev Ecol Syst. 2001;32:305–32. Article  Google Scholar  Allendorf FW, Lundquist LL. Introduction: population biology, evolution, and control of invasive species. Conserv Biol. 2003;17:24–30. Article  Google Scholar  Erickson AB. The…

Acclimatisation (6 January 1877) Southland Times. Page 2. paperspast.natlib.govt.nz/newspapers/ST18770105.2.7. Accessed 21 January 2022 Adamack AT, Gruber B (2014) PopGenReport: simplifying basic population genetic analyses in R. Methods Ecol Evol 5:384–387. doi.org/10.1111/2041-210x.12158 Article  Google Scholar  Andrews S (2010) FastQC. A quality control tool for high throughput sequence data. www.bioinformatics.babraham.ac.uk/projects/fastqc/ Andrews KR,…

Homer detailed annotation 1 Dear, I used HOMER annotatePeaks.pl to annotate my peaks. Here is the format for my code: annotatePeaks.pl peak.bed ref.fa -gff3 ref.gff3 > PeakAnno.txt. But, I don’t know why it is “NA” for the columns of “Focus Ratio/Region Size” and Detailed Annotation””? I am more interested in…

Steering Committee on Quality Improvement and Management, Subcommittee on Febrile Seizures American Academy of Pediatrics. Febrile seizures clinical practice guideline for the long-term management of the child with simple febrile seizures. Pediatrics. 2008;121:1281–6. Camfield P, Camfield C. Febrile seizures and genetic epilepsy with febrile seizures plus (GEFS+). Epileptic Disord. 2015;17:124–33….

Menasha J, Levy B, Hirschhorn K, Kardon NB. Incidence and spectrum of chromosome abnormalities in spontaneous abortions: new insights from a 12-year study. Genet Med. 2005;7(4):251–63. doi.org/10.1097/01.GIM.0000160075.96707.04. Article  PubMed  Google Scholar  Munné S, Chen S, Collis P, Garrisi J, Zheng X, Cekleniak N, et al. Maternal age, morphology, development and…

Daims H, Lebedeva EV, Pjevac P, Han P, Herbold C, Albertsen M, et al. Complete nitrification by Nitrospira bacteria. Nature 2015;528:504. Article  CAS  PubMed  PubMed Central  Google Scholar  van Kessel MA, Speth DR, Albertsen M, Nielsen PH, den Camp HJO, Kartal B, et al. Complete nitrification by a single microorganism….

I notice when using tools like HOMER there are two different types of outputs: de novo motifs vs known motifs and it seems no matter what the data is (type of ChIP etc.) there is always a “de novo” motif set in the results. I was hoping to reach out…

Agency for Toxic Substances and Disease Registry (ATSDR) (2002) Toxicological profile for copper. Atlanta, GA: Centers for Disease Control Ahemad M (2012) Implications of bacterial resistance against heavy metals in bioremediation: A review. IIOAB J 3:39–46 CAS  Google Scholar  Alcamán-Arias ME, Pedrós-Alió C, Tamames J, Fernández C, Pérez-Pantoja D, Vásquez M,…

Philippi M, Kitzinger K, Berg JS, Tschitschko B, Kidane AT, Littmann S, et al. Purple sulfur bacteria fix N2 via molybdenum-nitrogenase in a low molybdenum Proterozoic ocean analogue. Nat Commun. 2021;12:4774. Article  CAS  PubMed  PubMed Central  Google Scholar  Xiong Y, Guilbaud R, Peacock CL, Cox RP, Canfield DE, Krom MD,…

The specific assay and tissue types for each dataset are indicated with network clustering based on hardware. See Supplementary Data 1 and 2 for the Matrix driving this visualization. Note the hardware used to analyze plant response to spaceflight often defines the types of tissue that are available and so…

C. elegans strains All strains were cultured under standard conditions78 and were always incubated at 20 °C during the experiments. The strains used were N2 (Bristol; WT): DREAM: MT8839 lin-52(n771) III, MT10430 lin-35(n745) I, MT15107 lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III), MT8879 dpl-1(n2994) II, MT11147 dpl-1(n3643) II, JJ1549 efl-1(se1) V, BJS634…

Breitbart M, Bonnain C, Malki K, Sawaya NA. Phage puppet masters of the marine microbial realm. Nat Microbiol. 2018;3:754–66. Article  CAS  PubMed  Google Scholar  Suttle CA. Marine viruses—major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–12. Article  CAS  PubMed  Google Scholar  Breitbart M. Marine viruses: truth or dare. Ann…

Homer annotatePeaks for enrichment analysis 0 I want to test differentially methylated regions (DMRs; identified in whole genome bisulfite sequencing data) for enrichment of certain genomic features. For example, do I see more DMRs in promoters than I would expect by chance? It was suggested to me that a simple…

ChIPseq w/ polyploid genome : Xenopus laevis 0 Hello, I have recently undertaken reanalyzing a transcription factor ChIPseq done in Xenopus laevis. I started with the raw data, which includes two replicates for a transcription factor chip, and a DNA input control file. These are all fastq files. After aligning…

I am using the following command: findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp The input and bg fasta have this structure and the bg fasta include all sequences in input plus many others: >ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+) ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG However I get the following…

Alberdi A, Aizpurua O, Bohmann K, Zepeda-Mendoza ML, Gilbert MTP. Do vertebrate gut metagenomes confer rapid ecological adaptation? Trends Ecol Evol 2016;31:689–99. Article  PubMed  Google Scholar  Groussin M, Mazel F, Alm EJ. Co-evolution and co-speciation of host-gut bacteria systems. Cell Host Microbe. 2020;28:12–22. Article  CAS  PubMed  Google Scholar  Alberdi A,…

addGeneAnnotation.pl: not found 2 hey community, I am facing a problem related to the quantification step of RNAseq analysis: I have run this command ‘ /home/aarmich/Documents/000TOOLS/homer/bin/analyzeRepeats.pl rna hg38 -count genes -d /home/aarmich/Documents/000TOOLS/homer/A549ctrl_RNAseq_hg38 /home/aarmich/Documents/000TOOLS/homer/A549TGFB_RNAseq_hg38 -noadj > lastt.txt and terminal is responding like this: missing NM_003718… missing NM_152604… missing NM_001114132… missing NR_149079……

CellOverview of the Oracle algorithm The CellOracle workflow is made up of several steps. We Tested and implemented CellOracle Python Versions 3.6 and 3.8 were developed and made available for use in the Jupyter Notepad environment CellOracle code can be downloaded open-source on GitHub.github.com/morris-lab/CellOracle), along with detailed descriptions of functions…

Pfeffer C, Larsen S, Song J, Dong M, Besenbacher F, Meyer RL, et al. Filamentous bacteria transport electrons over centimetre distances. Nature. 2012;491:218–21. Article  CAS  Google Scholar  Lovley DR, Holmes DE. Electromicrobiology: the ecophysiology of phylogenetically diverse electroactive microorganisms. Nat Rev Microbiol. 2022;20:5–19. Article  CAS  Google Scholar  Bjerg JT, Boschker…

Acinas SG, Sarma-Rupavtarm R, Klepac-Ceraj V, Polz MF (2005) PCR-induced sequence artifacts and bias: insights from comparison of two 16S rRNA clone libraries constructed from the same sample. Appl Environ Microbiol 71(12):8966–8969 Article  CAS  Google Scholar  Alosaimi S, Bandiang A, van Biljon N, Awany D, Thami PK, Tchamga MSS et…

Ai H, Fang X, Yang B, Huang Z, Chen H, Mao L et al. (2015) Adaptation and possible ancient interspecies introgression in pigs identified by whole-genome sequencing. Nat Genet 47:217–225 CAS  PubMed  Article  Google Scholar  Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC…

I want to use the Homer to do annotation. After I input “annotatePeaks.pl 31512_TH0_D0.bed hg19 > 31512_TH0_D0.ann.txt” , it shows “!!!!Genome hg19 not found in /home/jenny/NGStools/homer/.//config.txt” I used the command “perl /home/jenny/NGStools/homer/configureHomer.pl -install hg19” to install it, and I am sure I installed the hg19 for the homer Then input…

Convert bedGraph to Homer tag directory? 0 Hi, I am new to ChIP-seq analysis. When taking published data in .bedGraph format (generated by Homer), is there any way to convert back to Homer tag directory? (other than aligning from the raw .fasta). I suppose extracting columns into .bed format and…

Create junctions from Bed file for IGV visualization 0 Any advice for creating junctions file from a bed-like file? My bed file looks like this: chr start end chr star end I have tried to copy the format used in TopHat (junctions file). But I can’t see the junctions in…

How to map query coordinates on to genome gff annoation files ? 0 Hello Researchers I have a project where i got stuck on :- mapping query coordinates on to gff annoation files, means i have to find all the total counts of gene, mRNA, exon, CDS, 3′-utr, 5′-utr, promoter,…

merging .narrowPeak files with all of the columns they have 0 Hello, I want to ask about merging concept of .narrowPeak files generated by macs2. I am merging them with HOMER mergePeaks as I found the most informative one (compared to the bedops, bedtools). However, for the downstream analyses I…

HiC analysis: How to prepare HiCUP output as input for HOMER? 0 Hi everyone, I am new to HiC and using HiCUP to analyse HiC data (I will try other pipelines and combination of software eventually). /tools/hicup –zip –bowtie2 /tools/bowtie2-2.3.4.1-linux-x86_64/bowtie2 –index /hg38/hg38 –digest /hg38/Digest_hg38_HindIII_None_15-12-15_27-10-2021.txt R1.fastq R2.fastq For now, I aligned…

Introduction Phytoplasmas are wall-less bacterial pathogens that are known to infect numerous plant species and lead to significant agricultural losses (Gurr et al., 2016; Kumari et al., 2019; Pierro et al., 2019). They are parasitic bacteria multiplying exclusively in phloem sieve elements and are transmitted between plants by phloem-feeding insects…

Early candidate from XVIR-TAT series demonstrated genetic elimination of HIV and robust anti-retroviral activity with CRISPR-Cas9 based excision Exavir lipid nanoparticles (LNPs) with mRNA encoding Cas9 nuclease and proprietary Tat-targeted gRNAs demonstrated up to 100% HIV suppression in infected human cells Exavir is optimizing LNP formulations for tissue tropism, and…

ChIP-seq analysis differential peak analysis regarding spike-in 0 Hi, I have 4 human ChIP-seq datasets, including drug A treated H3K4me3 and IgG, and drug B treated H3K4me3 and IgG. Meanwhile, sacCer3 spike-in data is added to human ChIP-seq data. Here is what I did: After aligning, I got 8 bam…

Home Bioconductor 3.14 Released October 27, 2021 Bioconductors: We are pleased to announce Bioconductor 3.14, consisting of 2083 software packages, 408 experiment data packages, 904 annotation packages, 29 workflows and 8 books. There are 89 new software packages, 13 new data experiment packages, 10 new annotation packages, 1 new workflow,…

Homer – Finding Instance of Specific Motifs 0 Hello everyone! I’m relatively new to bioinformatics, so sorry if this question sounds silly! I have started to use Homer to find a specific motif in a list of genes. The matter is: when I run findMotifsGenome.pl using -find <motif file> ,…