Tag: HTseq

Forum:LncRNA pipeline 0 HI ALL, I AM WORKING ON FINDING LNCRNA, I WOULD LIKE TO CHECK IF MY PIPELINE IS RIGHT FIRST I MAP USING STAR AND THEN SORT IT AND THEN GO FOR HTSEQ -GET THE COUNT DATA AND DO DESEQ. FOR LNCRNA EXTRACTION FROM RNA SEQ, I AM…

“Current Protocols in Molecular Biology“, 1991, JOHN WILEY & SONS, pages: 6.3.1 – 6.3.6 “Quantitative monitoring of gene expression patterns with a complementary DNA microarray.“, SCIENCE, vol. 270, no. 5235, 1995, pages 467 – 70 ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 – 410 ALTSCHUL ET…

Kalscheuer VM, Freude K, Musante L, Jensen LR, Yntema HG, Gécz J, et al. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation. Nat Genet. 2003;35:313–5. Article  CAS  PubMed  Google Scholar  Lenski C, Abidi F, Meindl A, Gibson A, Platzer M, Kooy F, et al. Novel truncating…

CPTAC data, download, merge 1 Hey friends I downloaded RNA seq data of CPTAC from GDC portal. I want to merge them as one file. I have my python script and manifest file in the same folder and I am running the following code in the command prompt to merge…

HTseq reports missing attribute name 1 Hello, I am running this htseq command htseq-count -r pos -t gene -i gene -s yes -f bam \ /Volumes/cachannel/ZebraFinchBrain/CB-4a_genomemapping/sorted_alignmentcb4a.bam \ /Volumes/cachannel/ZebraFinchBrain/GCF_003957565.2/Taeniopygia_guttata.bTaeGut1_v1.p.110.chr.gff3 > \ /Volumes/cachannel/ZebraFinchBrain/HTSEQ_withautomate/output_counts.txt However I get this error: Error processing GFF file (line 75 of file /Volumes/cachannel/ZebraFinchBrain/GCF_003957565.2/Taeniopygia_guttata.bTaeGut1_v1.p.110.chr.gff3): Feature gene:ENSTGUG00000013637 does not contain…

Cell growth and transfections Procyclic form (PCF) T. brucei, strain 29-1354, which carries integrated genes for the T7 polymerase and the tetracycline repressor, was grown in SDM-79 medium supplemented with 10% fetal calf serum, in the presence of 50 μg/ml hygromycin. Cells were grown in the presence of 15 μg/ml G418 for…

Issues while running htseq-count 0 My data is Candida glabrata and when i use htseq-count, no read is mapped to the gene_id. Thank you for your time and help. Foad htseq-count GSNO_SRR1582646.sam Candida_glabrata_genome.gtf > GSNO_SRR1582646.count 10975 GFF lines processed. 8843 alignment record pairs processed. head GSNO_SRR1582646.count gene-CAGL0A00165g 0 gene-CAGL0A00187g 0…

Subjects The study was conducted in accordance with the Declaration of Helsinki and all subjects or their parents/guardian gave informed written consent for genetic testing. DNA testing and storage in the Beta Cell Research Bank was approved by the Wales Research Ethics Committee 5 Bangor (REC 17/WA/0327, IRAS project ID…

Hi, I am getting error while running HTseq. This is the command and the error: htseq-count -q -f bam -s yes Ac1_mapped/ac1_mappedAligned.bam /global/home/users/catalinacastro/star/genome/genomic_v2.gtf count.txt Error occurred when processing GFF file (line 637338 of file /global/home/users/catalinacastro/star/genome/genomic_v2.gtf): not enough values to unpack (expected 9, got 1) [Exception type: ValueError, raised in init.py:221]…

Error with HTseq RNAseq read count 0 Hi, I am getting error while running HTseq. This is the command and the error: htseq-count -q -f bam -s yes Ac1_mapped/ac1_mappedAligned.bam /global/home/users/catalinacastro/star/genome/genomic_v2.gtf count.txt Error occurred when processing GFF file (line 637338 of file /global/home/users/catalinacastro/star/genome/genomic_v2.gtf): not enough values to unpack (expected 9, got…

Htseq-count reads with missing mate encountered 0 Hello. I ran this HTseq command htseq-count -r name -t gene -i gene -s yes -f bam /Volumes/cachannel/ZebraFinchBrain/CB-4a_genomemapping/sorted_alignmentcb4a.bam /Volumes/cachannel/ZebraFinchBrain/GCF_003957565.2/ncbi_dataset/data/GCF_003957565.2/genomic.gff > /Volumes/cachannel/ZebraFinchBrain/HTSEQ_withautomate/output_counts.txt and got the error Warning: 72583723 reads with missing mate encountered. 80015507 alignment record pairs processed. Is there a setting I am…

Hello, I have ran htseq-count numerous times and continue to get the same error. That NONE of my genes are counted as seen here. ZXDC 0 ZYG11B 0 ZYX 0 ZZEF1 0 ZZZ3 0 __no_feature 70257177 __ambiguous 0 __too_low_aQual 1509790 __not_aligned 3970775 __alignment_not_unique 4277765 However, I have a very high…

Introduction Chemoresistance is a major challenge for breast cancer treatment.1 The mechanisms of chemoresistance are complex because of crosstalk between receptor tyrosine kinases and downstream pathways, deregulation of cell-cycle and apoptosis regulators, and modulation of tumor-infiltrating immune cells.2 The ATP-binding cassette (ABC) superfamily is one of the largest families of…

zero counts for all genes in RNAseq data of Ferret 0 I have bulk RNAseq data from Ferret and trying to get counts per gene. to do so I used hisat2 and got the genome from here: hgdownload.soe.ucsc.edu/goldenPath/musFur1/bigZips/musFur1.2bit after aligning the fastq files I used htseq and the following command:…

RNA sequencing can be used to quantify protein expression using various methods. One approach is to process the RNA sequencing reads using workflows such as Tophat-HTSeq, Tophat-Cufflinks, STAR-HTSeq, Kallisto, and Salmon. These methods have been benchmarked and shown to have high correlations with wet-lab validated qPCR assays for gene expression….

Aguilera F, McDougall C, Degnan BM (2017) Co-option and de novo gene evolution underlie molluscan shell diversity. Mol Biol Evol 34(4):779–792 CAS  PubMed  PubMed Central  Google Scholar  Alexa A, Rahnenfuhrer J (2020) topGO: Enrichment analysis for gene ontology. R package version 2.40.0 Google Scholar  Arivalagan J, Yarra T, Marie B,…

Dear all, I am trying to annotate non-coding RNA in a small RNA-seq dataset. The RNACentral gff3 file that I am using has different chromosome identifiers than the genome assembly. I have loaded the gff3 file in R where I changed the chromosome identifiers using the the assembly report and…

Proper HTSeq usage on bacterial genome. Don’t quite understand –t 1 Hi everyone, I’m trying to run HTSeq on a group of BAM files generated from the alignment of an RNAseq illumina reads mapped to a reference genome. The reference genome is the sequence with highest quality available and was…

Cell culture and treatments DIvA (AsiSI-ER-U2OS)19, AID-DIvA (AID-AsiSI-ER-U2OS)23 and 53BP1-GFP DIvA20 cells were developed in U2OS (ATCC HTB-96) cells and were previously described. Authentication of the U2OS cell line was performed by the provider ATCC, which uses morphology and short tandem repeat profiling to confirm the identity of human cell…

Cell culture and treatments Human embryonic lung MRC5 fibroblasts (ATCC) and IMR90 fibroblasts (ATCC) were grown in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, D5796) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U ml−1 penicillin, 100 μg ml−1 streptomycin and 2 mM l-glutamine and maintained at 37 °C under 5% CO2. MRC5 fibroblasts were cultured in…

– In TCGA BRCA data (Legacy data),  dataset: gene expression RNAseq – IlluminaHiSeq from tcga.xenahubs.net have  20,531 identifiers corresponding to about 20000 genes. However,  in GDC TCGA BRCA data ( Harmonized Data),  dataset: gene expression RNAseq – HTSeq – Counts from hub: gdc.xenahubs.net, there are  60,489 identifiers. What is the difference between them?…

Python3 high-throughput genome sequencing read analysis utilities HTSeq can be used to performing a number of common analysis tasks when working with high-throughput genome sequencing reads: * Getting statistical summaries about the base-call quality scores to study the data quality. * Calculating a coverage vector and exporting it for visualization…

How to check RNAseq support for annotated genes? 2 Hello All, I have a set of annotated genes in gff3 format and corresponding RNA-seq data. What is the recommended approach and are there specific tools and parameters to determine the percentage of genes supported by the RNA-seq data?” Regards, B…

Introduction Single-cell RNA sequencing (RNA-seq) was first achieved by using a quantitative cDNA amplification method and applied to mouse oocytes (Kurimoto et al, 2006; Tang et al, 2009). It has since provided unprecedented opportunities for the study of cellular differentiations, states, and diseases in various biological fields, including developmental biology,…

Technique for Quantifying the Effects of siRNA on Gene Expression One technique that can be used to quantify the effects of siRNA on gene expression is RNA sequencing (RNA-seq). RNA-seq is a high-throughput sequencing method that allows for the measurement of gene expression levels by quantifying the abundance of RNA…

htseq-count reports count values for deleted genes 0 I am using htseq-count on BAM files from a bacterial species. We are comparing WT strains as well as two strains with genes knocked out. The knockouts have been verified with whole genome sequencing, but do retain the first 15 and last…

Clinical samples and plasma preparation Blood samples from control individuals and patients with multiple myeloma, liver cancer, and lung cancer were obtained from Oregon Health and Science University (OHSU) by Knight Cancer Institute Biolibrary and Oregon Clinical and Translational Research Institute (OCTRI). All samples were collected under OHSU institutional review…

This course consists of a live session on counting and differential expression analysis in R and a Q&A session to answer all the questions that arise when trying the analysis on your own data. The live session will demonstrate R tools to generate count files like featureCounts, and summarizeOverlaps are…

Calculating FPKM and TPM by hand from htseq-count output? 0 Hello! I am counting reads with htseq-count, and wasted some hours trying to find an extant software that would calculate FPKM and/or TPM from that output, so I wrote a script myself. There is just one question mark – should…

Hello I am doing a transcriptome analysis on Pseudomonas putida and I have been trying to do a read count using Htseq -count. The program always give an error. I have tried different genome references (fna) and annotation files (gtf ang gff) but it does not work. The mapping works…

Single end RNAseq data strandedness infer-experiment-py 2 Hi all, I have a single end RNAseq data and would like to understand the strandedness of the data. From wet-lab input I know “Stranded cDNA library was generated by reverse transcribing the RNA molecules”. I used infer-experiment-py The output is: This is…

Glutamate abnormalities in the medial prefrontal cortex (mPFC) are associated with cognitive deficits. We previously showed that homozygous deletion of CNS glutamate dehydrogenase 1 (Glud1), a metabolic enzyme critical for glutamate metabolism, leads to schizophrenia-like behavioral abnormalities and increased mPFC glutamate; mice heterozygous for CNS Glud1 deletion (C-Glud1+/- mice) showed…

How to to lncRNA analysis from WTS data ? 0 Hi, I have WTS data with me and I have to do mRNA analysis, lncRNA analysis etc. using the data. Until now what I have done is map the pre-processed data to reference genome using Hisat2 and do quantification using…

LncRNA Differential Expression and Analysis of lncRNA and mRNA co-expression. 1 Hi All, I am about to undertake RNA-Seq analysis to assess the lncRNA expression induced in viral infected human cells. Experimental Conditions: I have three conditions that I need to test; wildtype virus infected, mutant virus infected, and uninfected….

The Seibold Laboratory is a cutting-edge, NIH funded, laboratory focused on elucidating the pathobiological basis of asthma and other complex lung and allergic diseases. Our goal is to discover pathobiological subgroups of disease (termed disease endotypes) and the genetic, environmental, and immune factors driving their development. We are accomplishing these…

Counting intronic reads in bulk RNA-seq 0 My experience with single-cell RNA-seq shows that the inclusion of intronic reads improves the sensitivity for several genes of interest, which otherwise have zero expression when only exonic reads are considered. While single-cell sequencing quantifiers now often have options to count intronic reads,…

Hi all, I am working with the RNA-Seq data on human (24Cases-20 controls) to find differentially expressed genes. my RNA-Seq data is unstranded. Here is the comments that I used to align the fastq files: ls *_1P.fastq.gz | parallel –bar -j8 ‘R2=$(echo {} | sed s/_1/_2/) && out=$(echo {} |…

Introduction Carbon nanotubes (CNTs) are nano-sized one-dimensional tubular structures rolled by single (single-walled CNTs, SWCNTs) or multiple layers (multi-walled CNTs, MWCNTs) of graphene with unique electrochemical, mechanical and thermal properties, which render them as attracted engineered nanomaterials for various commercial applications.1–4 An increase in the production and utilization of CNTs…

No differentially expressed genes after multiple testing correction in mice 0 Hi all, I am working with the RNA-seq data on mice (group A N=3 vs group B N=3). Mice are littermates, of which group A overexpresses a human transgene which I verified. I have had .cram files from mouse…

htseq-count : dosen’t show options in bash ln ubuntu 1 foad@Linux:~/Example/Sam$ htseq-count -h usage: htseq-count [options] alignment_file gff_file This script takes one or more alignment files in SAM/BAM format and a feature file in GFF format and calculates for each feature the number of reads mapping to it. See htseq.readthedocs.io/en/master/count.html…

single exon quantification using RNA-seq 0 Hi, I have done the RNA-seq (mRNA) on gene knockout mice. I have evaluated the gene knockout from protein level. However, after RNA-seq data analysis, I didn’t see down-regulation of this gene. I used the pipeline Hisat2-HTseq to do the RNA-seq analysis. Technicholy, this…

Media The minimal marine media, MBL media, was used for serial dilution growth of Tritonibacter mobilis A3R06. It contained 10 mM NH4Cl, 10 mM Na2HPO4, 1 mM Na2SO4, 50 mM HEPES buffer (pH 8.2), NaCl (20 g/liter), MgCl2*6H2O (3 g/l), CaCl2*2H2O (0.15 g/l), and KCl (0.5 g/l). Glucose was added as the only carbon source at a…

problem with downloading htseq 0 hi, I want to download htseq from pypi.org/project/HTSeq/ but I face this error: ERROR: Could not install packages due to an OSError: HTTPSConnectionPool(host=”files.pythonhosted.org“, port=443): Max retries exceeded with url: /packages/a8/0f/04405b7fa4aab62adc7d7d12af3aaeb5015acffffdc0a03f372b7083c0fa/HTSeq- 2.0.2-cp310-cp310-manylinux_2_17_x86_64.manylinux2014_x86_64.whl (Caused by ReadTimeoutError(“HTTPSConnectionPool(host=”files.pythonhosted.org“, port=443): Read timed out. (read timeout=15)”)) I tried both “pip install…

HTSeq count stranded setting 0 Hello, In HTSeq’s manual for the stranded parameter, they state: “For stranded=no, a read is considered overlapping with a feature regardless of whether it is mapped to the same or the opposite strand as the feature. For stranded=yes and single-end reads, the read has to…

I have quality controlled paired end environmental transcriptomic data that I want to map against a reference database of 8 cyanobacterial genomes. I made this reference by joining together the fasta files of each genome. I performed this mapping with BWA v0.7.3a but noticed that when I tried to count…

B16 melanin(+) tdTomato cell line generation The generation and characterization of a lentivirus encoding tdTomato has been described previously22. The B16-D5-HER2 stable cell line was a generous gift from Louis Weiner (Georgetown University)13,23. Cell lines were cultured in DMEM Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% (v/v) fetal…

Mice Rosa26-YFP48, Rosa-tDTomato49, K14creER, Lgr5creER (ref. 50), KrasLSLG12D (ref. 51) and Trp53fl/fl (ref. 52) mice were obtained from the NCI mouse repository and Jackson Laboratories. Rhojfl/fl mice53 were a gift from A. Uemura. All mice used in this study were composed of males and females with mixed genetic background. Mouse…

Fungi, ain’t a kingdom most of us will know much about. The only thing I can guess at is that in bacteria there has resurgence in methods for de novo assembly specifically aimed at reducing the total number of contigs in an assembly. The ‘new wave’ is summarised in this…

BULK mRNA-seq with UMIs. Does it make sense to run bedtools genomecov? 0 Hi, I am using BULK rna-seq which includes UMI added after cDNA fragmentation, before PCR amplification (see my previous post BULK mRNA-seq with UMIs. Do I need to normalize by gene length? ). I am trying to…

Weird looking dispersion & MA plot? 0 I have 99 samples (96 treated, 3 untreated cells) subjected to bulk RNA seq. All the Fastqc parameters look fine + the sequencing depth is pretty similar across all samples. I generated gene counts for all of them with htseq and ran DeSeq2…

Stringtie does not work with NCBI GTF file? 1 Hi all, I wanted to rerun my DGE analysis to see if there were any differences between HTseq-count -> edgeR and StringTie-Ballgown. However, when I tried to run my stringtie command using the same BAM file, I got an error: “Error:…

Calculating RPKM for DESeq 1 Hi friends DESeq works via count table and create DE genes by count fold change, but it’s better to know about gene RPKM values. Is there any possible way to use / show RPKM for DESeq’s output? And how can i normalized those RPKM values?…

HTseq no features 0 I have got some problem when analyzing my RNAseq data and I would like to seek for a help. Here is the brief description of my pipeline: Obtained fasta file of 150 PE reads from Novaseq platform followed by non-stranded library prep I conducted fastQC and…

Inagaki, F., Takai, K., Kobayashi, H., Nealson, K. H. & Horikoshi, K. Sulfurimonas autotrophica gen. nov., sp. nov., a novel sulfur-oxidizing e-proteobacterium isolated from hydrothermal sediments in the Mid-Okinawa Trough. Int. J. Syst. Evol. Microbiol. 53, 1801–1805 (2003). Article  CAS  PubMed  Google Scholar  Timmer-Ten Hoor, A. A new type of…

BS1_Pdp1_0-1.5.+.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.-.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.bam   49.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.bw   48.00b   October 14 2022 at 00:06 BS1_Pdp1_0-1.5.htseq-count   57.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.+.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.-.bw   50.00b   October 14 2022 at 00:06 BS1_Pdp1_14-16.bam…

BS1_Blimp-1_kay_mCherry_0-1.5.+.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.-.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.bam   64.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.bw   63.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_0-1.5.htseq-count   72.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.+.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.-.bw   65.00b   October 14 2022 at 00:06 BS1_Blimp-1_kay_mCherry_10-12.bam…

BS1_Fer1_Camta_CG10209_mCherry_0-1.5.+.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.-.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.bam   78.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.bw   77.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_0-1.5.htseq-count   86.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.+.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.-.bw   79.00b   October 14 2022 at 00:06 BS1_Fer1_Camta_CG10209_mCherry_12-14.bam…

BS1_Fer1_0-1.5.+.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.-.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.bam   56.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.bw   55.00b   October 14 2022 at 00:06 BS1_Fer1_0-1.5.htseq-count   64.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.+.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.-.bw   57.00b   October 14 2022 at 00:06 BS1_Fer1_12-14.bam…

BS1_Ets65A_CG32006_mCherry_0-1.5.+.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.-.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.bam   70.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.bw   69.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_0-1.5.htseq-count   78.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.+.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.-.bw   71.00b   October 14 2022 at 00:06 BS1_Ets65A_CG32006_mCherry_12-14.bam…

BS1_Sox15_0-1.5.+.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.-.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.bam   49.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.bw   48.00b   October 14 2022 at 00:06 BS1_Sox15_0-1.5.htseq-count   57.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.+.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.-.bw   50.00b   October 14 2022 at 00:06 BS1_Sox15_10-12.bam…

Hi all, I’m trying to create a conda environment through a .yml file that has all the required dependencies for a certain project but I run into environment conflicts. I figured out the source of this conflict, which stems from two specific dependencies, but for some reason, creating an environment…

Ethics statement and animals All animals and experimental protocols used in this study were approved by the Beijing Institute of Animal Science, Chinese Academy of Agricultural Sciences (the scientific research department responsible for animal welfare issues) (No.: IASCAAS-AE20140615). In this study, experimental chickens (JXH) were selected on H/L, with the…

[E::idx_find_and_load] warning in htseq-count 0 I am running the htseq-count but get the [E::idx_find_and_load] warning. The bam files were sorted with name but without index. It is not required for index when running htseq-count, correct? *CODE: htseq-count -f bam \ -s no \ -t exon \ -m union \ -i…

Warning: Mate records missing HTSEQ 0 Hello everyone, At the end of the quantification with HTSEQ I get this warning, why is it? is it a serious problem? enrique@DE:~/analisis_maiz/quantificacion$ htseq-count -f bam ../alignements/SRR214880_sorted.bam -s no -i gene_id -r pos -t exon ../genome_anotacion/Zea_mays.Zm-B73-REFERENCE-NAM -5.0.55\ \(1\).gtf > SRR214880.txt Final: Warning: Mate records…

warning message after HTSeq 0 I have analyzed RNA-seq data with HTSeq. My command that I used is python -m HTSeq.scripts.count -f bam -r pos -s reverse -t ORF -i group -m union input.bam my.gff > output.txt Warning message is Warning: Mate records missing for 3752 records; first such record:…

Hi, I’ve been passed down some bam files from RNA-seq that I need to analyze. They were generated with pseudoalignments using Kallisto ( pachterlab.github.io/kallisto/about ) When I run htseq-count one specific bamfile crashes on a specific read: Error occured when processing input (record #149548485 in file 103805-016-011.kallisto.pseudoalignments.bam): Expected str, got…

Introduction Breast cancer is the most prevalent malignancy and the leading cause of cancer death in women worldwide.1 After its diagnosis, the most immediate challenge is to tailor treatment strategies and predict the prognosis; traditional clinicopathologic features, including estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2…

HTSeq error processing GFF file 0 Hello, I am trying to run HTSeq but it tells me that I have a problem in my GFF and GTF file, how can I fix this? enrique@L:~prueba_guess$ htseq-count -f bam SRR214880.bam -s no -i ID -r pos -t exon GCF_902167145.1_Zm-B73-REFERENCE-NAM-5.0_genomic.gff > SRR214880.txt 100000…

TCGAbiolinks HT-Seq count 0 Hi everyone! For legacy = F data, the workflow_type = HTSeq counts is still working? This is my code and it fails: query <- GDCquery(project = “TCGA-BRCA”, legacy = FALSE, data.category = “Transcriptome Profiling”, data.type = “Gene Expression Quantification”, workflow.type=”HTSeq – Counts”, sample.type = “Primary Tumor”)…

Animals As female mice/rats resist to HFD-induced obesity and NAFLD, male mice/rats were used to induce obesity and NAFLD model by HFD50. Male Wistar (~180 g body weight; 8 weeks old) rats were purchased from Shandong Laboratory Animal Center with the permission number of SCXK 2014–0007 and raised under thermoneutral housing…

Introduction Lymphoma, a cancer characterized by a malignant tumor of the immune system that originates in the lymph nodes or lymphoid tissue, is one of the most common cancers worldwide. According to GLOBOCAN, the incidence of non-Hodgkin lymphoma (NHL) in both males and females ranked top ten among all cancers…

Hi, I am analyzed some BULK mRNA-seq data that included UMIs during the sequencing. I don’t have much experience analyzing bulk RNA-seq, and it is my first time dealing with UMIs there. I have more experience in single-cell RNA-seq, and I thought that the concept of UMIs will translate directly…

Error using HTSEq_count 0 Hello, I am trying to use HTSeq_count but when I run the command I get the following error: > Traceback (most recent call last): File “/usr/local/bin/htseq-count”, line 5, in <module> HTSeq.scripts.count.main() File “/usr/local/lib/python3.7/site-packages/HTSeq/scripts/count.py”, line 473, in main args = _parse_sanitize_cmdline_arguments() File “/usr/local/lib/python3.7/site-packages/HTSeq/scripts/count.py”, line 465, in _parse_sanitize_cmdline_arguments…

I am using HTseq pipeline for DESeq2: Directory = “/Users/abhaykanodia/Desktop/smallRNA/” condition = c(“WT1”, “WT2”, “WT3”, “NTC1”, “NTC2”, “NTC3) sampleFiles= c(“AK1a_counts.txt”,”AK2a_counts.txt”,”AK3a_counts.txt”,” AK4a_counts.txt”,”AK5a_counts.txt”,”AK6a_counts.txt”) sampleName = c(“AK1”, “AK2”, “AK3”, “AK4”, “AK5”, “AK6”) sampleTable <- data.frame(sampleName = sampleName, fileName = sampleFiles, condition = condition) sampleTable The output is: sampleName fileName condition 1 AK1 AK1a_counts.txt…

Cell isolation, reprogramming and culture Approval was obtained for human cell and tissue sample collection and genetic reprogramming from the Institutional Review Board (protocols 19–252, 18–243, 21–060, 19–284 and 415-E/1776/4-2014, Ethics Committee of the province of Salzburg). Adult samples were collected in accordance with the Declaration of Helsinki after written…

smallRNA profiling using HTSeq error 1 Hello, I want to create a “count” file using HTseq. I have both BAM file and gtf file: htseq-count -f bam -s no -i AK1a_clean_Aligned.sortedByCoord.out.bam gencode.v42.chr_patch_hapl_scaff.annotation.gtf >> AK1a_counts.txt It still gives an error: htseq-count: error: the following arguments are required: featuresfilename Can someone please…

The incidence of lung adenocarcinoma (LUAD), the most common subtype of lung cancer, continues to make lung cancer the largest cause of cancer-related deaths worldwide. Long noncoding RNAs (lncRNAs) have been shown to have a significant role in both the onset and progression of lung cancer. In this study, we…

HISAT2 and HTSEQ command 0 @4fedfa78 Last seen 10 hours ago Japan Hello, For analysis of the data by rna-sequencing I selected HISAT2 and HTSeq-count for mapping and counting the genes levels, the libraryLayout is paired, I am using the below command for both but the results are not exact…

Hi everyone- I am trying to write a script to automate htseq-count on a large number of samples. The script runs but then throws the following error: “Please provide 2 arguments”. Does anyone see something obvious I am missing: #!/bin/bash for samples in *.sam do gtf = “Galaxy135-\[Escherichia_coli_str_k_12_substr_mg1655.GCA_000005845.2.29.gtf\].gtf” echo $sample …

Newest ‘htseq’ Questions – Bioinformatics Stack Exchange …

Dear Experts, I have RNAseq data from 6 different plant samples (2 control, 2 Sensitive, and 2 tolerance), and different location of one species. I am trying to see the effect of the different groups at different time points, but after going through all the posts and vignettes I am…

Dear all We are recently working with E.coli plasmid and tried to summarize the gene counts from our RNA-Seq samples. The short reads were mapped to E.coli plasmid using tophat which generated bam files accordingly. However, we were unable to obtain a gff3 version of our target plasmid genome, the…

. 2022 Apr;24(4):590-600. doi: 10.1038/s41556-022-00870-7. Epub 2022 Apr 12. Lucie Y Guo #  1   2 , Jing Bian #  3 , Alexander E Davis  4 , Pingting Liu  4 , Hannah R Kempton  3 , Xiaowei Zhang  3 , Augustine Chemparathy  3 , Baokun Gu  3 , Xueqiu Lin  3 , Draven A Rane  3 , Xiaoshu Xu  3 , Ryan M…

HTseq-Count: Long processing time 1 Hi everyone, I’m processing BAM files using htseq-count and it takes very long time to produce the counts for each file. It is about pair-end reads (around 50 million sequence each). It takes 75 minutes to count this pair; is that normal? Thanks. htseq-count –max-reads-in-buffer=24000000000…

Can I convert HTSeq count into RPKM or TPM value or standard unit of RNA-Seq 0 Now, I’m comparing RNA expressions that have RNA-Seq and HTSeq count How can I interpret it together with different unit or Can I convert HTSeq count equivalent RNA-Seq? or if you have other suggestions,…

HTSeq Counts no longer available 1 @vm-21340 Last seen 8 hours ago Brazil I’m working with breast cancer expression data from the TCGA-BRCA project. All my scripts were written to retrieve HTSeq counts from GDC, but they seem to have been removed from the GDC Data Portal. When using GDCquery,…

Background: The application of RNA-seq technology has become more extensive and the number of analysis procedures available has increased over the past years. Selecting an appropriate workflow has become an important issue for researchers in the field. Methods: In our study, six popular analytical procedures/pipeline were compared using four RNA-seq…

htseq-count error 1 Hi, htseq-count -f bam -s yes ~/htseq-trial/SRR13826419_Aligned.sortedByName.out.bam ~refgen/gencode.v39.primary_assembly.annotation.gtf > counts.txt I am trying to run htseq-count with command above but in the err file [E::idx_find_and_load] Could not retrieve index file for ‘~/htseq-trial/SRR13826419_Aligned.sortedByName.out.bam’ 100000 GFF lines processed. 200000 GFF lines processed. 300000 GFF lines processed. 400000 GFF lines…

Feature count is very low using htseq-count 0 Hello all, I performed bbmap on my RNA-seq paired sequence data using following cmd bbmap.sh in1=J2_R1.fastq in2=J2_R2.fastq out=output_J2.sam ref=im4.fasta nodisk The header of generated sam file is @HD VN:1.4 SO:unsorted @SQ SN:k141_1006 LN:2503 @SQ SN:k141_5512 LN:5393 @SQ SN:k141_4772 LN:4387 @SQ SN:k141_3267 LN:4531…

Hello! I am trying to annotate a miRNA-seq so that it gives me mature miRNAs where I already have 5p and 3p. For this, I have used the index mm10.fa and the miRBase mmu.gff3. I have aligned with HISAT2 and am trying to count with HTSeq, however I get 0…

RNA Seq HTSeq download GDC portal 0 Hi friends, I am trying to download ht-seq file form GDC portal but it gives me one file for each patinets. Can you please let me know how to download one file including all patients together for all 60000 genes? Is there any…

TCGA Data download in terms of ease of use ,RTCGA The bag should be better , And because it’s already downloaded data , The use is relatively stable . But also because of the downloaded data , There is no guarantee that the data is new .TCGAbiolinks The package is…

Using a Mac with M1 chip, I’m trying to install the following Bioconda packages: cutadapttrim-galoresamtoolsbedtools.htseq.bowtie2.deeptools.macs2 I’ve been able to install picard and fastqc with no issues, but all others turn out one of two error messages: PackagesNotFoundError: The following packages are not available from current channels: or Found conflicts! Looking…

RNA-Seq HTseq galaxy DE analysis 0 Hi friends I have htseq data from TCGA. it contains patients name in first row and genes in first column : 200 columns and 20000 rows. I dont want deseq2 in R. this needs to be done in galaxy. my question is how to…

Significance The plant-specific H3K27me1 methyltransferases ATXR5 and ATXR6 play integral roles connecting epigenetic silencing with genomic stability. However, how H3K27me1 relates to these processes is poorly understood. In this study, we performed a comprehensive transcriptome analysis of tissue- and ploidy-specific expression in a hypomorphic atxr5/6 mutant and revealed that the…

downloading RNA seq data 0 Hi friends I am using the following code to get the data from TCGA. I want to have only one allocate of each person then I will have unique patients ID. Is there any line of code that I should add to this to get…

How to label columns in HTSeq output 0 I’ve been working to process RNAseq data and I’ve used hisat2 to align my reads to the reference genome. When I take those output files and put them into HTSeq-count using the below code, I get a count matrix but the columns…

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

Hello, I’m following the htseq-count tutorial for RNA-seq (counting the overlapping genes and exons) here htseq.readthedocs.io/en/master/tour.html. However, when I get to the point where I need to find the overlaps in the .sam file and .gtf file, I get an error. This is the code I ran originally that gave…

htseq-count Error ‘_StepVector_Iterator_obj’ object has no attribute ‘next’ 0 I am trying to run htseq-count (v. 0.13.5) on a sorted and indexed bam file. The command I entered looks like this: htseq-count -f bam -r pos -s yes -t CDS -i gene_id -m union filename_sorted.bam filename.gtf I get the following…