Tag: scRNAseq

In this tutorial we walk through a typical single-cell RNA-seq analysis using Bioconductor packages. We will try to cover data from different protocols, but some of the EDA/QC steps will be focused on the 10X Genomics Chromium protocol. We start from the output of the Cell Ranger preprocessing software. This…

Condition specific marker detection and problem with the distribution of cells from different samples 1 I have 6 scRNAseq samples and made a umap using all cells from all 6 samples and in the UMAP every sample has a different color (in total 6 colors) and the goal was to…

News:NGS Data Analysis Workshops 2024 0 Exciting News: ecSeq Bioinformatics 2024 Workshops Are Here! We’re thrilled to announce our diverse range of bioinformatics workshops for 2024, now open for registration! Whether you’re a beginner or looking to deepen your expertise, our courses are designed to elevate your skills in the…

After six years of exhilarating exploration and the analysis of a whopping 32 million cells, a scientific feat has been unleashed: the unveiling of the very first dazzling, comprehensive cellular map of a mammalian brain! Today, the meticulous mapping of the detailed brain anatomy of the adult mouse was on…

Greetings to my fellow researchers! As we delve into the ever-evolving landscape of genomics, one frontier that has truly revolutionized our understanding of cellular heterogeneity is Single Cell RNA Sequencing (scRNASeq). In my quest for proficiency in this transformative field, I embarked on a fascinating journey exploring various scRNASeq analysis…

How can i control the cluster number in scRNASeq clustering by Seurat package 2 Hi all, I analysised the 10x dataset by Seurat pkg, when i used the TSNEPlot function to plot the TSNE plot of clustering result, i found the number of cluster always different. How can i control…

Loss of ‘var’ using concatenation of AnnData objects 0 Hello all! I am doing scRNAseq analysis in python using scanpy library and am having multiple different issues during concatenation of my 16 samples (stored previously in adata_list). The following line of code results in a loss of genes (n_vars): adataConcat…

Mouse Brain Dural scRNAseq Database Other scRNAseq databases from Betsholtzlab Citation:We provide this database resource free to the scientific community. We encourage reproduction of data excerpts from the database in academic publications on the condition that it is cited with reference to the original publication (below) and the database website….

WGCNA Dendrogram Branch missing from modules 0 Hi all, Currently using hdWGCNA for network construction in a scRNAseq dataset, and I keep identifying branches on the cluster dendrogram that look robust in terms of dissimilarity, but that fail to be assigned as modules. Figure attached. The branches in question are…

ScRNAseq analysis scran :: quickcluster Error 1 @d4a334e3 Last seen 15 hours ago Germany Hello! I am having an error while doing normalization for my scRNAseq data, I would appreciate the help of anyone who countered the same problem the error is during quickcluster command as follow: clust <- quickCluster(sce)…

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Fri, 01 Dec 2023 16:47:13 +0100 Source: r-bioc-scrnaseq Architecture: source Version: 2.16.0+ds-1 Distribution: unstable Urgency: medium Maintainer: Debian R Packages Maintainers <r-pkg-t…@alioth-lists.debian.net> Changed-By: Andreas Tille <ti…@debian.org> Changes: r-bioc-scrnaseq (2.16.0+ds-1) unstable; urgency=medium . * Team upload. * New upstream version Checksums-Sha1: 886053d20feab7314d553249e052d3bbcc1e0d28…

gme December 1, 2023, 4:02pm 1 Hi, I followed the scanpy tutorial to integrate scRNAseq clusters on spatial RNAseq samples. Now I am trying to measure the colocalization and the distances between these clusters on the spatial samples. I tried to use squidpy interaction_matrix or nhood_enrichment but it does not…

labelling the clusters from the CD4 T cell scRNAseq data 0 I have some scRNAseq data from only CD4 T cell and clustered them using existing algorithms. Now I am trying to label these clusters to see which subsets of CD4 T cells I have in my data. First I…

what is the proportion of black candidates in US medical schools? 5 answers What are the current knowledge gaps about the Yellow-footed Green Pigeon in Chhattisgarh? 3 answers What is the origin of the Day of the Dead in Mexico? 5 answers How does human presence affect the number of…

What is the function of the Wnt3a non-canonical pathway in skin? 3 answers What is selectivity index (SI) in cancer studies? 3 answers What is the role of clathrin in exocytosis? 5 answers What is the told of Wnt in alveolar development? 5 answers What are the parameters on TRPV6…

cNMF vs LIGER 0 Hello, there are two methods for scRNAseq sample integration/batch-correction that employ Nonnegative Matrix Factorization (NMF), one is cNMF and the other is LIGER. Does anyone have pointers where these two were compared? I liked using LIGER and haven’t used cNMF yet, but maybe I should give…

It is said in Spanish, “si no existe, créalo” or “if it does not exist, create it.” This is exactly what sometimes occurs at the Fred Hutch. When we do not have the tools to test a hypothesis, we must be creative! A great example is a collaboration between Dr. Susan Bullman,…

. 2023 Nov 17:12:RP89338. doi: 10.7554/eLife.89338. Affiliations Expand Affiliation 1 Vollum Institute, Oregon Health & Science University, Portland, United States. Item in Clipboard Jimmy J Kelly et al. Elife. 2023. Show details Display options Display options Format AbstractPubMedPMID . 2023 Nov 17:12:RP89338. doi: 10.7554/eLife.89338. Affiliation 1 Vollum Institute, Oregon Health &…

MAJOR Computational Biology Research Lab (MCBRL) uses computer science algorithms to solve biology related problems, bioinformatics software development and develop bioinformatics cloud computing platforms or services for handling and analyzing large-scale biological data.. The workflow of hdWGCNA analysis for Single-cell Spatial Transcriptomics data RNA-seq Schematicsc/nRNA-seq Schematic ” RNA-seq Schematic 空间转录共表达网络分析流程…

We are seeking a motivated Computational Biologist with hands on experience to join our team dedicated to advancing our Cardiometabolic Disease (CMD) portfolio. As a scientist in CMD, you will:Be part of creative and enthusiastic teams working on target identification and validation (TIDVAL) for heart failure, NASH, fibrosis, inflammation, obesity,…

Both MPH and ATX increase the locomotor activity of wild-type Drosophila To investigate the cell type-specific molecular mechanisms of ADHD drugs in the brain at single-cell resolution, we conducted behavioral experiments and scRNASEQ in wild-type (WT) adult male Drosophila melanogaster following exposure to MPH, ATX, and control treatment. Here, we…

keep getting error while trying to convert Seurat object into a H5ad file 2 I am trying to convert rds file (or Seurat object) to h5ad files using the following command in R: library(scater) library(Seurat) library(cowplot) pbmc_ad <- Convert(from = pbmc, to = “anndata”, filename = “results/pbmc3k.h5ad”) in which pbmc…

scRNA-seq quality control 0 Hi, Based on the literature, some genes like Gm42418, AY036118 and Malat1 are indicators of rRNA contamination or low quality cells and are suggested to be removed from the count matrix before normalization. I am dealing with a dataset that after removal of controversial genes (MT…

I am doing some analysis on a public scRNAseq datasets in order to see differential gene expression between two clusters. The basal sample information about it: tissue_donor_1_treatment, tissue_donor_2_treatment, tissue_donor_1_control, tissue_donor_1_control, All of them produced under the same sequencing conditions. # In my opinion, I want to divide them into two…

DOI: 10.18129/B9.bioc.ClusterFoldSimilarity   This is the development version of ClusterFoldSimilarity; to use it, please install the devel version of Bioconductor. Calculate similarity of clusters from different single cell samples using foldchanges Bioconductor version: Development (3.19) This package calculates a similarity coefficient using the fold changes of shared features (e.g. genes)…

Hi, I used STARsolo but my bam files, below, are missing barcode and UMI info: (/scratch/work/malonzm1/.conda_envs/scvi-env) [malonzm1@login3]/scratch/cs/pan-autoimmune/data/star/scRNAseq/GSE151177/SRR11848679% samtools view SRR11848679Aligned.out.bam|head -n5 NB500961:910:HJ5TWBGXC:1:23304:10007:9225 0 chr1 6100902 255 55M * 0 0 TTCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1 NB500961:910:HJ5TWBGXC:1:13111:23716:1741 0 chr1 6100902 255 4S51M * 0 0 GAGATTCGGAGCCCACACTGTTTCCCACTCAGCTTTGTGCTAATATCCAAGGTCC…

Correct for different number of cells and individuals in single cell data analysis 0 I have scRNAseq from different donors for 4 different conditions. for different condition I have different number of donors and for different condition we have different number of cells. to make the conditions comparable, is there…

slingshot analysis on PCA but visualization on UMAP 1 Hi Bio-community, I am using slingshot for TI. I am wondering If I can use PCA as reducedDim argument in the slingshot function and for visualization the UMAP in embedCurves? Since I am getting biologically more reasonable results, if working in…

Abstract Transcriptomic data obtained by single cell (sc) RNAseq or bulk RNAseq can be mined to understand the molecular activity of cell types. Yet, lowly expressed but functional genes may remain undetected in RNAseq experiments for technical reasons, such as insufficient read depth or gene drop out in scRNAseq assays….

Testing the interaction term in single-cell RNAseq DEG analysis 0 I wonder if there is a way to test for the “interaction term” in Seurat. I have two categorical variables and would like to know if the interaction between these two variables is significantly different in a scRNAseq (2 x…

1. Install r-bioc-scrnaseq package Please follow the step by step instructions below to install r-bioc-scrnaseq package: sudo apt install r-bioc-scrnaseq Copy 2. Uninstall / Remove r-bioc-scrnaseq package This guide let you learn how to uninstall r-bioc-scrnaseq package: sudo apt remove r-bioc-scrnaseq Copy sudo apt autoclean && sudo apt autoremove Copy…

Abstract Single cell RNAseq (scRNAseq) batches range from technical-replicates to multi-tissue atlases, thus requiring robust batch-correction methods that operate effectively across this spectrum of between-batch similarity. Commonly employed benchmarks quantify removal of batch effects and preservation of within-batch variation, the preservation of biologically meaningful differences between batches has been under-researched….

Input data matrix from Seurat toolkit analysis for RNA velocity analysis using scvelo 0 Hi, I have done the scRNAseq analysis follwoing seurat toolkit vignette (SCTtransform + integrate + clustering) and now planning to run RNA velocity analysis using scvelo tool. Is it reasonable to use the SCT assay, data…

fragments file generation via Sinto from CellRanger output 0 Hi, I am following the instructions for the PASTA package (satijalab.org/seurat/articles/pasta_vignette.html). This package uses scRNA-seq data to infer alternative polyadenylation usage from scRNAseq data. It requires among many input files also a fragment file. The authors state the following must be…

Integrating 10x scRNAseq and multiomics 0 I am starting to work with some single cell sequencing data and I am trying to get my head around what the best pipeline is. I have 6 samples in total, 3 from control and 3 from a treated group. Of each, 2 were…

QC cut off for snRNAseq data 1 Hi all, Apologies if this is a silly question as I am very early on in my bioinformatics journey! I have been playing with an snRNAseq dataset in Seurat and I am currently performing QC on the dataset. Alot of the profiles look…

Single cell RNAseq bioinformatics Bioinformatic trajectory analysis of scRNAseq data obtained from Epcam+CD45− C57Bl6/J adult intestinal crypt cells and deposited as GSE188339 was performed as described35. Primers and antibodies Primer sequences are given in Supplementary Table 1 and antibodies are given in Supplementary Table 2. Generation of Chinese hamster ovary…

Hi, I know it’s stupid question but I cannot figure it out. I have a scRNAseq dataset integrated (treatment vs control) and I need to show specific genes as violin plots showing the difference between the two condition only for a subset of cell types/cluster. However I have make one…

GEO Dataset: Difficulty Understanding Matrices, Compliation 1 Hi, I am new to using GEO, novice at R (have used seurat for my own scRNA data), apologies for how basic this question is: I am trying to replicate figure 1 from a recent paper using seurat. They’ve deposited their data as…

Hi, I have scRNAseq with total of 33 clusters and I want to select only few of them (eg. cluster 0,3,6,7) and plot specific genes in a violin plot. However ideally I would like to have the clusters shown in specific order in the violin plot (eg. cluster 7,3,6,0) and…

How to read tsv data as dgcmatrix 0 Update: Solved. The barcodes provided in the metadata and count matrix are not the same. One is “xyz-1”, another is “xyz.1”. Just need to correct the barcodes. I will post some photos later as references for people who might encounter similar issues…

How to determine the total count for each gene in lymphotype B 0 Hello I really need help!! I don’t speak English very well so sorry I have RDS object, this file is processed, normalized (using sct transform approach) and clusters were identified (in other words it ready to use…

Is it normal if regress out the cell cycle effects but the DEGs are quite the similar (no big changes) 0 Dear experts, Is it normal after regressing out the cell cycle effects but the DEGs are quite similar (no big changes)? The scRNAseq data are from one cell type,…

Integrated Seurat object change name of the two conditions 0 Hi, I have a scRNAseq integrated seurat object composed by my control and my treatment. On this object I did all the analysis and I have all the plots needed (umap etc). Now it has been asked to use different…

Innova Solutions is immediately hiring for a Bioinformatics Scientist – II Position type: Full time, Contract Job Title: Bioinformatics Scientist – II (Associate) Location: Cambridge or Boston Massachusetts Duration: 13+ months of contract Pay range: $72 to $77 per hour on W2 Job Description: The Data, AI & Genome Sciences…

ob Description: Qualifications: Education Minimum Requirement: Ph.D. in Bioinformatics, Biostatistics, Computational biology, Computer Science, Genetics, Immunology, Mathematics, Molecular Biology, Statistics, or related field -or- Masters’ degree in the above disciplines, with 3 years of relevant experience or B.S with 6+years of relevant experience. Required Experience and Skills: Passion to solve…

JOB TITLE: Bioinformatics Scientist – II (Associate) LOCATION: Boston ( 33 Avenue Louis Pasteur, Boston, MA 02115, United States) Cambridge MA (320 Bent St, Cambridge, MA 02141, United States) DURATION: 12 months Note: we need someone experienced with analyzing and interpreting existing pipeline/Dataset (not building pipeline) which is a more…

Forum:scRNAseq Differential expression analysis 0 Hello everyone! I am a student that recently started working with transcriptomics data. I am trying to conduct my first single cell data analysis of an organoid model using mainly Seurat. I tried to conduct a differential expression analysis between different clusters using the FindMarkers()…

In GEO NCBI repository are available single cell data on PC9 untreated lung cancer cell line done in two different labs, using both 10XGenomics and Drop-seq platforms and produced from in vitro culture or xenograph experiments. set1: GSM3972657 PC9 in vitro dropseq Chicago (2500 cells) set2: SM4494347 PC9 in vitro…

Is it okay to just average the log2FC values across different cell types in pseudobulk scRNA-seq data? 0 Hi! I downloaded a differential gene expression summary data table like this from brainSCOPE. All I need is “gene” and “log2FoldChange” column. However, each gene’s data is split into multiple different cell…

VDJ reconstitution from 3′ 10x genomics platforms 0 Hi All I have scRNAseq data on B cells from 3′ 10x platform. I want to reconstitute vdj from this data. The only software I found were vdjpuzzle, TRUST4, dandelion and they all works on 5′ 10x data. Are you familiar with…

I have scRNAseq data and I am trying to do differential comparing 2 conditions (for each condition I have 3 samples). to do so I am using Seurat R package and to integrate the samples I used the following code. the part1 has code only for 1 sample (for other…

differential gene expression analysis comparing different conditions using scRNAseq 1 I have single cell RNA-seq data (10X genomics) data from PBMC and trying to do differential gene expression analysis comparing different conditions (not comparing different clusters or cell types) per cell type. I am trying to use Seurat R package…

Asymmetric/biased log2FC values for low-expressed genes in DESeq2 0 Hello everyone, I apologize if this question seems a bit naive. When we ran DESeq2 for our scRNAseq data (where we first pseudobulked the data by samples), we observed that genes with low expression (those with low baseMean values) exhibited an…

Choosing background for ORA using scrnaseq 0 Hello everyone!! I have a query regarding what’s the right approach for doing DE analysis for scrnaseq data where we have ctrl vs treatment samples. The data was integrated with atlas and DE was performed between ctrl and treatment cells in each cluster…

Producing Bulk samples from 10X data 0 Hi Everyone I am aware about an approach that’s called pseudobulking in single cell where bulk-like samples are generated from scRNAseq data (in absence of bulk data) to find which genes might be important at population level. But there is something my boss…

University Health Network (UHN)  is looking for an experienced professional to fill the key role of Senior Bioinformatics Analyst in our  Donald K. Johnson Eye Institute . We are looking for a bioinformatician with demonstrated experience single-cell RNA sequencing analysis. The anticipation is that this qualified person will be able to…

UMAP graph using DimPlot pre/post integration 1 Hello all, I have a seurat object containing 3 different samples. Before integration with harmony, I can run: pbmc_harmony <- NormalizeData(pbmc_harmony, verbose = F) pbmc_harmony <- FindVariableFeatures(pbmc_harmony, selection.method = “vst”, nfeatures = 2000, verbose = F) pbmc_harmony <- ScaleData(pbmc_harmony, verbose = F) pbmc_harmony…

how to filter the scRNAseq data, by percent genes expression, counts and others 1 Dear experts, How to filter the scRNAseq data? When using the only keep the genes that have expression in above 10% of all cells, near 8,000 genes left, when only keep genes that have expression in…

Currently lost between contigs, scaffolds and chromosomes due to positionally sorted scRNAseq bam files 1 Hello everyone, I have downloaded some scRNAseq bam files from EGA, but the contents of the files look like this (header + first 3 rows of a random bam file, accessed with samtools): @HD VN:1.6…

DOI: 10.18129/B9.bioc.SummarizedBenchmark   Classes and methods for performing benchmark comparisons Bioconductor version: Release (3.17) This package defines the BenchDesign and SummarizedBenchmark classes for building, executing, and evaluating benchmark experiments of computational methods. The SummarizedBenchmark class extends the RangedSummarizedExperiment object, and is designed to provide infrastructure to store and compare the…

Optimal number of features to use when integrate multi samples by Seurat in scRNAseq 0 Dear experts, Is there a way to decide which is the optimal number of features to use when integrate multi samples by Seurat in scRNAseq? The default number in SelectIntegrationFeatures is 2000, should I try…

CellRanger output more cells than specified using –force-cells? Why? 1 Hi I have a query. I am trying to align my Plasmodium scrnaseq data against combined reference genomes of Human and PF3D7. Since these cells are from ring stage, the number of genes expressed is really low (25-50 genes expressed…

Who controls access to this dataset For each dataset that requires controlled access, there is a corresponding Data Access Committee (DAC) who determine access permissions. Access to actual data files is not managed by the EGA. If you need to request access to this data set, please contact: Thirant, Peltier…

Negative Expression in RNA Assay on Dot Plot After SCT Transform 1 I am working on single-cell data, and I have data from mice that received 2 different therapies. I merged the mice within the 1st group together and applied quality control steps, followed by applying SCT transform. I performed…

Question about umap using different numbers of pca components as initialization 0 I am new to the scRNA-seq field and I have been doing some experiments of visualization of UMAP using different numbers of PCA components for initialization. The process involves projecting scRNA-seq data (count matrix) onto various numbers of…

Innova Solutions is immediately hiring for a Bioinformatics Scientist – II Position type: Full time, Contract Job Title: Bioinformatics Scientist – II (Associate) Location: Cambridge or Boston Massachusetts Duration: 13+ months of contract Pay range: $72 to $77 per hour on W2 Job Description: The Data, AI & Genome Sciences…

We are eager to add an ambitious Bioinformatics Scientist to join our incredible team at Spectraforce Technologies Inc in Cambridge, MA.Growing your career as a Full Time Bioinformatics Scientist is an amazing opportunity to develop useful skills.If you are strong in analysis, creativity and have the right enthusiasm for the…

Title: Bioinformatics Scientist – IILocation: Either Boston or Cambridge MADuration: 12 Months Pay rate starts from $75/hr.Note: Work location is either Boston or Cambridge MA, however manager is based out in CA. Hybrid role(Requires to come 3 days/week onsite).Fixed 2 days: Either Monday and Thursday OR Tuesday and Wednesday. Friday’s…

Bioinformatics Analyst I/II Job ID: req3664Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: NIHLocation: NIH Campus 9000 Rockville Pike, Bethesda, MD 20892 USA The Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc….

Hi everyone, My apologies if the question is rather broad, but I am looking for a general solution. I am analysing several datasets in the ballpark of 500k cells, and possibly would like to integrate them. However, analysing even one of these datasets takes days even to finish. My attempts…

Data integration in scRNAseq 1 Hello people, Have a question about integration on scRNAseq data in R. I have a dataset of 10 patients – each split into healthy and diseased (Type). During analysis, should I integrate the data by patients or by Type or by both? Your input would…

Introduction nf-core/scrnaseq is a bioinformatics best-practice analysis pipeline for processing 10x Genomics single-cell RNA-seq data. This is a community effort in building a pipeline capable to support: Alevin-Fry + AlevinQC STARSolo Kallisto + BUStools Cellranger UniverSC Documentation The nf-core/scrnaseq pipeline comes with documentation about the pipeline usage, parameters and output….

Bioinformatics Analyst II/III Job ID: req3719Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: NIHLocation: NIH Campus 9000 Rockville Pike, Bethesda, MD 20892 USA The Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc….

Today it is possible to obtain genome-wide transcriptome data from single cells using high-throughput sequencing (scRNASeq). The main advantage of scRNASeq is that the cellular resolution and the genome wide scope makes it possible to address issues that are intractable using other methods, e.g. bulk RNASeq or single-cell RT-qPCR. These…

Supplemental files for papers based on scRNAseq of renal CD31+/podoplanin+ cells taken from mice subjected to angiotensin II-induced HTN (A2HTN) and salt sensitive HTN (SSHTN) models and their respective controls. Files include supplementary figures and tables are organized by shortened titles: LECs (Inflammatory Alterations to Renal Lymphatic Endothelial Cell Gene…

Feedback on mouse brain scRNA-seq quality control 0 I am working with 10X scRNA-seq data from the mouse brain. I filtered cells based on outliers in the mitochondrial gene % by cell type. If the cell type had no outliers, I filtered cells that had their highest mt gene %…

Abstract Single-cell RNA sequencing (scRNA-seq) technology has been widely used to study the differences in gene expression at the single cell level, providing insights into the research of cell development, differentiation, and functional heterogeneity. Various pipelines and workflows of scRNA-seq analysis have been developed but few considered multi-timepoint data specifically….

Single Cell RNA Seq 0 Hi Members, I need to do an assignment in single cell RNA seq using the tools tagged above. I will appreciate if anyone can help me out. I have done basic scRNA analysis but need guidance on some of the tools. Thank you in advance…

Choosing a cut-off for mitochondrial genes in brain scRNAseq 0 Choosing a cut-off for mitochondrial gene % depends on things like the organism and type of tissue. This paper recommends a general cut-off of 5% for mouse and 10% for human tissues, but I am curious to see what people…

Does ScaleData of S.Score and G2M.Score will reduce the cell numbers for G1, S, G2M 1 Dear experts, May I have your guidance after removing the cell cycle effects by ScaleData(data, vars.to.regress = c(“S.Score”, “G2M.Score”), features = rownames(data)), Will the cell numbers in the data object be reduced, or ScaleData…

Abstract Single-cell/nuclei RNA sequencing (sc/sn-RNA-seq) has revolutionized our understanding and discovery of cell phenotypes and states. Marker genes are an integral part of identifying cell types. NSForest is an existing machine learning-based program that utilizes the random forest ensemble learning method to find the minimal marker genes required to identify…

DESeq2 error after installing BiocManager 1 @f5d223cb Last seen 9 hours ago United States I am unable to install DESeq2 package even after installing BiocManager. I have looked for various sources to find a tutorial video to solve this, yet I keep on receiving unable to write error. Can you…

Error in h(simpleError(msg, call)) in monocle2 0 Want to run monocle2 for a single cell RNAseq data processed using Seurat, but encountering following problem. library(monocle) Seurat An object of class Seurat 41445 features across 55683 samples within 1 assay Active assay: RNA (41445 features, 1850 variable features) 4 dimensional reductions…

A new method developed by Yale researchers harnesses single cell genomics to uncover the diverse human immune cell types present in tumors and blood of autologous MISTRG6 PDX mice. These findings are important because how a person’s immune system interacts with tumor cells can impact cancer progression and treatment outcomes….

Job ID: req3692Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: NIHLocation: NIH Campus 9000 Rockville Pike, Bethesda, MD 20892 USAThe Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc. The lab addresses some…

Job Description AbCellera is a nimble, energetic, and quickly growing tech company that searches, decodes, and analyzes natural immune systems to find antibodies that its partners can develop into drugs to prevent and treat disease. We are not afraid of challenges and together we tackle tough problems. Today, we’re able…

How ti identify genes per terms in with topGO for scRNAseq dataset 0 Hi all, I want to to perform Gene Ontology (GO) Enrichment of Genes Expressed in specific clusters and I am following this tutorial but in the output I cannot find which genes are associated per terms. How…

Separate single cell BAM file by the cell barcode 1 Dear Biostar community, I am a bit new to Dropseq analysis (10x sequenced files, if not mistaken). I followed the standard CellRanger protocol and received an aligned BAM file of the samples and the files for downstream analysis with Seurat….

Inferring undisclosed 5mer in proprietary SMARTer oligo sequence 0 I am attempting to infer the identify of an unknown 5mer present in amplified fragments after first-strand synthesis using the smart-seq v4 kit. . I want to amplify fragments using this oligo from the original reverse-transcribed products before illumina library preparation….

Should we assume UMI-based scRNAseq data is not compositional? 0 This is a more theoretical question. Any referrals to published scientific articles on this topic would be very helpful. The main question is whether UMI-based scRNAseq data is not compositional. I acknowledge that most of the standard scRNAseq analysis pipelines…

Job ID: req3664Employee Type: exempt full-timeDivision: Bioinformatics and Computational ScienceFacility: NIHLocation: NIH Campus 9000 Rockville Pike, Bethesda, MD 20892 USAThe Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc. The lab addresses some…

Use of plotDeltaDistribution() to assess the quality of automatic annotation of scRNA seq data 0 Hello, I attempted to use the SingleR function to automatically find out the cell types of each scRNA seq clusters. After that, I use the plotDeltaDistribution() function to assess the quality of automatic annotation. From…

Enrichment analysis on scRNSseq on which genes/clusters perform ReactomeGSA and GSEA? 0 Hi all, I have a question about gene ontology/GSEA and reactome analyses on scRNAseq dataset. I don’t understand on which genes/clusters is correct to perform these analyses? Do I have to perform these analysis on all clusters (post…

The auditory system, a distinctive mammalian sensory system, possesses remarkable biophysical properties. Hereditary deafness, a prevalent sensorineural disorder, is primarily a single-gene disease exhibiting substantial genetic heterogeneity, divided into nonsyndromic (80% of cases) and syndromic (20% of cases) groups. Presently, research has identified around 125 genes associated with nonsyndromic deafness…

How to load count matrix of scRNAseq data from cel-seq2 (96 well plates) protocol into a Seurat object 0 I have count matrix scRNAseq data from cel-seq2 (96 well plates) protocol for few samples which are tab separated text files in which the rows are genes and the columns are…

Batch effect correction of RNAseq data using scRNAseq batch effect correction tools (e.g., Harmony, Liger, Seurat3) 2 Hi, I have several standard RNAseq datasets where I observed strong batch effect. So I tried various new batch effect correction tools, but they are developped for single cell RNAseq, such as Harmony,…

scRNAseq: thoughts on merging datasets generating from different version of 10x cellranger? 0 I’m using Harmony + Seurat to merge a series of datasets generated from cell ranger. Unfortunately, not all sets have available fastq I can download to align. Most of my sets I have sucessfully generated data matrices…

Hi, I would like to use the Leiden algorithm on my scRNAseq to identify the clusters but I cannot run the algorithm. If I use the default one I have no problem. I tried : FindClusters(immune.combined, resolution = 0.3, algorithm = 4) but it gives me this error: Error: Cannot…

Job Details Bioinformatics Analyst II/III Job ID: req3605 Employee Type: exempt full-time Division: Bioinformatics and Computational Science Facility: NIH Location: NIH Campus 9000 Rockville Pike, Bethesda, MD 20892 USA The Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and…