Categories
Tag: shell
Bioinformatics Developer (Intermediate To Senior) in New Zealand
Job Details Auckland, Auckland, New Zealand Netvalue Ltd Posted 1 day ago Want updates for this and similar Jobs? This advertiser has chosen not to accept applicants from your region. Full Job Description Bioinformatics Developer (Intermediate to Senior) Bioinformatics Developer (Intermediate to Senior) 15 openings But enough about us, what…
gmx solvate – GROMACS 2023.4 documentation
Description gmx solvate can do one of 2 things: 1) Generate a box of solvent. Specify -cs and -box. Or specify -cs and -cp with a structure file with a box, but without atoms. 2) Solvate a solute configuration, e.g. a protein, in a bath of solvent molecules. Specify -cp…
Shedding Light on BIA-ALCL Risks
In a society that celebrates individuality and self-expression, the journey to aesthetics takes many forms. One such road, taken by countless women seeking empowerment and confidence, is breast augmentation. This blog dives deep into the dark and flip side of breast augmentation- Allergan breast implant lawsuits. Before answering the query…
Stochastic biological system-of-systems modelling for iPSC culture
Cell proliferation and aggregation dynamics modeling The aggregation process is characterized by the dynamic evolution of a density profile of aggregates. Let \(\phi (x,t)\) denote the average number of aggregates or clusters of size \(x\) (i.e., mass and volume) at time \(t\), where mass is equal to a buoyant density…
Revolutionizing acne treatment with CRISPR technology
Eligo Bioscience is a gene-editing company focused on addressing diseases driven by the expression of bacterial genes from the microbiome, and in its crosshairs, initially, is moderate to severe acne vulgaris, an inflammatory disease that affects about 3% of the global population. This week, we talk to Xavier Duportet, CEO…
80 parttime, contract internship, remotely Banking, Bioinformatics, Digital, e-commerce, Finance, Information Technology, Investment, Research industry
Job Category Any CategoryJobInternshipWork from Home Job Type Any Job TypesFull-timePart-timeContractVolunteer Location Any CountryUKCanadaAustraliaPakistanIrelandGermanyUSASwedenNew ZealandMalaysiaRussiaNetherlandDubaiSwitzerlandJapanVietnamItalyDenmarkOnlineGeorgiaLatviaSingaporeChinaNetherlandsIndiaFranceBelgiumBrazilColombiaEuropeEstoniaThailandNorwayNigeriaQatarCambodiaUAESouth KoreaAustriaTurkeyworldwideADB CountriesIndonesiaSaudi Arabia Industry Any Industry athletic apparel and footwear Refugee AgencyAccredited registrarAeronauticsAerospaceAirlineappliance manufacturerArtificial Intelligencearts, entertainment, and recreation sectorAstronomical ResearchAutomationAutomativeAviationBankingBioinformaticsBroadcastingBusiness Administrationcar manufacturingchemicalCivic and Social OrganizationsCivil EngineeringConsumer goodsCreativity and Innovation DevelopmentCyber SecurityDairyingData analyticsDevelopmentDigitale-commerceEducationEducationElectric Power GenerationEnergyEngineeringEngineering Professional…
Pytorch_all_l Benchmarks – OpenBenchmarking.org
AMD Ryzen 9 5900X 12-Core testing with a ASUS TUF GAMING B550M-PLUS (WI-FI) (1801 BIOS) and MSI NVIDIA GeForce RTX 3080 10GB on Ubuntu 22.04 via the Phoronix Test Suite. Compare your own system(s) to this result file with the Phoronix Test Suite by running the command: phoronix-test-suite benchmark 2312292-NE-PYTORCHAL51…
extract sequence from genome by region
extract sequence from genome by region 2 fasta • 277 views • link updated 1 hour ago by Ram 42k • written 6 hours ago by gernophil ▴ 40 you can integrate Bioio in Python by using subprocess module. subprocess is a built-in Python module. here is an example: import…
Bioinformatics scientist | GENOMINES
Job Description Who we are Genomines is a young biotechnology company based in Paris and Saclay, specialized in sustainable extraction of Nickel from plants. The mission of Genomines is to usher in a new era of sustainable mining by using genetically enhanced plants to extract metals from soil (agromining). Through…
Sr. Software Engineer in Test (Bioinformatics or Data Sciences) / SDET – Key Infotek LLC
Job Title: Sr. Software Engineer in Test (Bioinformatics or Data Sciences) Location: Mississauga, CAD Pay Rate: DOE Requirements: B.S. or M.S. in Computer Science, Data Sciences, Bioinformatics, Biomedical engineering or equivalent field 5+ years of experience in software development or software test engineering or data engineering Proficiency in Python,…
Vimerse InfoTech Inc hiring Sr. Software Engineer (Bioinformatics) in Mississauga, Ontario, Canada
Job Title: Sr. Software Engineer in Test (Bioinformatics or Data Sciences) Location: Mississauga, CAD Impact Healthcare Roche Sequencing is not only changing science, but we are changing lives. Our software teams are laying the groundwork for the future by developing powerful bioinformatics algorithms, data analysis tools, and software/systems infrastructures so…
Frontiers Publishing Partnerships | Construction of recombinant adenovirus-5 vector to prevent replication-competent adenovirus occurrence
Introduction In recent years, recombinant adenoviral vectors have been used in different fields of biomedical sciences such as in vitro and in vivo gene transfer, vaccine development, and gene therapy (Russell, 2000; Mitani and Kubo, 2002). Multiple features of recombinant adenoviral vectors such as high packaging capacity for transgene insertion,…
Google Announced Gemini, And Imagen 2 API For Developers
Google has recently announced the Gemini AI, along with Imagen 2 and Duet AU for developers. These can be used to develop tools and integrate them into their products and services. All of these are available with Gemini, Imagen 2, and Duet AI on Vertex AI (Google Cloud API solution…
132releng-armv7-default][misc/py-pytorch] Failed for py39-pytorch-2.1.1_1 in configure
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/ampere3/data/132releng-armv7-default/1dd4264fe4a8/logs/py39-pytorch-2.1.1_1.log Build URL: pkg-status.freebsd.org/ampere3/build.html?mastername=132releng-armv7-default&build=1dd4264fe4a8 Log: =>> Building misc/py-pytorch build started at Tue Dec 19…
KeyInfo hiring SDET must have (Bioinformatics or Data Sciences) in Canada
Job Title: Sr. Software Engineer in Test (Bioinformatics or Data Sciences) Remote Description: Responsibilities: • Implement and maintain an end-to-end automation test framework for running UI integration tests and quality dashboards using various tools: Java, JavaScript/TypeScript, Cypress, Selenium WebDriver, Cucumber, TestNG, Junit • Design and develop requirements based test cases • Implement automated…
Gingerbread Trim – This Old House
Home Sweet Home Photo by Nancy Andrews Victorian builders used “gingerbread trim”—fancifully cut and pierced frieze boards, scrolled brackets, sawn balusters, and braced arches—to transform simple frame cottages into one-of-a-kind homes. Carpenter Gothic Photo by Nancy Andrews North America’s romance with gingerbread trim dates to the 1830s and ’40s, when…
Bioinformatics Analyst I-II in Seattle, WA for Fred Hutchinson Cancer Center
Details Posted: 17-Dec-23 Location: Seattle, Washington Type: Full-time Salary: Open Overview Fred Hutchinson Cancer Center is an independent, nonprofit organization providing adult cancer treatment and groundbreaking research focused on cancer and infectious diseases. Based in Seattle, Fred Hutch is the only National Cancer Institute-designated cancer center in Washington. With a…
Unix and Shell Scripting for Bioinformatics course
News:Unix and Shell Scripting for Bioinformatics course 0 Dear all, There are still a few seats available for our online course on Unix and Shell Scripting for Bioinformatics! Dates: 15-19 January 2024 Course Overview: Dive into the world of high-throughput biology Master essential Unix commands for data analysis Connect to…
eXtremeRate Replacement Decorative Trim Shell with Accent Rings Compatible with PS5 Controller – Cherry Blossoms Pink
eXtremeRate Regular price $15.99 Regular price Sale price $15.99 Unit price / per Sale Sold out Couldn’t load pickup availability Refresh We know that your controller shell is more than just a plastic accessory.It is your sidekick, your wing man, your battle buddy.This is why we use only the best…
Undefined reference to mbedTLS functions – Nordic Q&A – Nordic DevZone
Hi all! So I’m trying to use mbedTLS methods in my project. I got it to work on SDK v1.9.0 but when upgrading to v.2.4.0 I get a lot of “undefined references” to methods regarding mbedTLS.I see that there is some other issues regarding this but those haven’t solved my…
Kim Kardashian shows off her VERY trim waist as she joins Kendall Jenner, Ivanka Trump at Justin Timberlake concert in Vegas Grand Opening
Kim Kardashian showcased her jaw-dropping physique in a figure-hugging black dress while attending Justin Timberlake‘s invite-only show at the Fontainebleau in Las Vegas. While enjoying a girls’ night out with her sister Kendall Jenner and longtime pal, Ivanka Trump, on Wednesday, the reality star, 43, commanded attention in her sexy knitted frock,…
Google brings Gemini Pro to tons of new tools, and more AI news
Welcome to What’s New in AI, our weekly update where we bring you all the latest AI news, tools, and tips to help you excel in this new brave new AI-driven world. AI in the news: Google dominates once again Last week Google was in the news for the release…
Research Associate in Bioinformatics and Precision Medicine at Imperial College London
Location: St Mary’s, Paddington and South Kensington Campus Job Summary Applications are invited for the post of Research Associate/Fellow in Bioinformatics and Precision Medicine within the Department of Infectious Disease, Faculty of Medicine. You will lead analysis -omic datasets generated from clinical studies of acute infection to inform disease diagnosis…
Flooding, gusty winds forecast for Miami, Fort Lauderdale, Palm Beach. Secure holiday trim
The National Weather Service in Miami issued a flood watch Wednesday for large parts of South Florida while forecasters warned gusty winds plaguing the region over the next several days could blow away your holiday decorations. Flooding is possible in the coastal and metropolitan areas of Miami-Dade, Broward and Palm…
SRA Staffing – SRA Group hiring QA Analyst with Bioinformatics in Mississauga, Ontario, Canada
Title: QA Analyst with Bioinformatics Work location: Mississauga, Canada (Hybrid) Duration: 1 Year Plus Contract Job Description: B.S. or M.S. in Computer Science, Data Sciences, Bioinformatics, Biomedical engineering or equivalent field • Min 5 years of experience in software development or software test engineering or data engineering • Proficiency in…
Snakemake rule error
Snakemake rule error 0 I have the following rule in snakemake: rule low_coverage_contig_reads: input: bam=”data/processed/bam_files/bam/{sample}_{fraction}.bam.bai”, output: r1=”data/processed/clean_reads/low_cov/low_cov_{sample}_{fraction}_R1.fq.gz”, r2=”data/processed/clean_reads/low_cov/low_cov_{sample}_{fraction}_R2.fq.gz” threads: 8 params: bam=”data/processed/bam_files/bam/{sample}_{fraction}.bam” log: log1=”logs/{sample}_{fraction}_low_coverage_reads.log”, shell: “”” (samtools coverage {params.bam} | awk ‘NR > 1 && $7 < 10 {{print $1}}’ | tr ‘\\n’ ‘ ‘ | samtools view -u {params.bam}…
How to input list into GenomicsDBImport with snakemake?
How to input list into GenomicsDBImport with snakemake? 0 Hello! I’m currently writing a pipeline with snakemake for exome data. During joint variant calling I need to use GATK’s GenomicsDBImport, although I’m unsure how to input all the samples at once. Here’s the simplified version of the rule I’m using:…
Senior Technical Marketing Manager at imperva
SENIOR TECHNICAL MARKETING MANAGER CYBER SECURITY is a big deal. It’s in the news, growing rapidly, a critical tool for every company, and our specialty. Imperva is a public company (NASDAQ) and cybersecurity leader that delivers best-in-class solutions to protect data and applications on-premises, in the cloud, and across hybrid…
Casgevy vs. Lyfgenia: The Battle of the Sickle Cell Gene Therapies Has Begun
As a business journalism publication, BioSpace doesn’t get many news days like we had on Friday. Not just one but two major FDA approvals happened simultaneously for the first cell-based gene therapies to treat patients with sickle cell disease. While the FDA’s decision regarding Vertex Pharmaceuticals and CRISPR Therapeutics’…
Gromacs 2023.3 on Apple M3 chip – User discussions
GROMACS version: 2023.3GROMACS modification: No Hi folks I know that there have been several threads on running Gromacs with Apple M1 and M1 or M2 chips (e.g. Error compiling Gromacs 2023’s checks on Mac M2), but I recently got a MacBook Pro with the M3 chip, so I was interested…
sparklyr – Databricks Connect v2
Last updated: Thu Dec 7 16:28:19 2023 Intro Databricks Connect enables the interaction with Spark clusters remotely. It is based on Spark Connect, which enables remote connectivity thanks to its new decoupled client-server architecture. This allows users to interact with the Spark cluster without having to run the jobs from…
Newcastle University hiring Research Assistant/Associate in Bioinformatics Biosciences Institute in Newcastle, England, United Kingdom
SalaryResearch Assistant: £31,396 to £32,982 per annum Research Associate: £33,996 per annum Newcastle University is a great place to work, with excellent benefits . We have a generous holiday package; plus the opportunity to buy more, great pension schemes and a number of health and wellbeing initiatives to support you….
Research Assistant/Associate in Bioinformatics Biosciences Institute at Newcastle University
Company description: We are a world class research-intensive university. We deliver teaching and learning of the highest quality. We play a leading role in economic, social and cultural development of the North East of England. Attracting and retaining high-calibre people is fundamental to our continued success. Job description: The Role…
Google set to overtake ChatGPT with launch of AI model, Gemini
PARIS: An investigation by Agence France-Presse into the strike in southern Lebanon on October 13 that killed a Reuters journalist and injured six others, including two from AFP, points to a tank shell only used by the Israeli army in this high-tension border region.Two strikes hit the group of journalists…
get gene name from rsID
get gene name from rsID 1 I’ve got a list of rs IDs in xlsx format. I need to get the gene name for each rsID. When I use this command, I get the gene name esearch -db snp -query “rs573455” | esummary | xtract -pattern GENE_E -element NAME |…
Jams To Trim The Tree To, And Watch Some Hockey Too
My family isn’t huge on Christmas music, but we all have our favorites that get played around the holidays. We are huge Caniacs, and we have a favorite Hurricane. Why not pair these up and see what happens? Seth Jarvis- Merry Christmas From The Family by Robery Earl Keen. REK…
Translational Pathology Bioinformatics Scientist job with Eli Lilly and Company
At Lilly, we unite caring with discovery to make life better for people around the world. We are a global healthcare leader headquartered in Indianapolis, Indiana. Our employees around the world work to discover and bring life-changing medicines to those who need them, improve the understanding and management of disease,…
Understanding Google Colab commands to running deep learning projects using Kaggle data API | by Sachinsoni | Dec, 2023
!mkdir -p ~/.kaggle!cp kaggle.json ~/.kaggle/ 1. About !mkdir -p ~/ .kaggle !mkdir -p ~/.kaggle: This line uses the mkdir command to create a directory named .kaggle in the user’s home directory (~). The -p option ensures that the command creates parent directories as needed. This command is used to make…
Bioinformatics/Artificial Intelligence/Data Science work from home job/internship at Corteva Agriscience
Corteva, Inc. is a major American agricultural chemical and seed company that was the agricultural unit of DowDuPont prior to being spun off as an independent public company. DowDuPont announced the Corteva name in February 2018. As the world’s only major agriscience company completely dedicated to agriculture, we’re building a…
How To Separate Illumina Based Strand Specific Rna-Seq Alignments By Strand
Today we have run into the task of having to split strand specific RNA-Seq data by strand and we had to make an effort to get it right (hopefully it is right). Maybe there is even an easier way to do it. The Illumina strand specific protocol is such that…
Function ‘SubBackward0’ returned nan values in its 1th output – autograd
I am trying to implement a model where the forward function calls to an external function that computes the values using the model’s parametes. class R_model(torch.nn.Module): def __init__(self,) : super().__init__() self.Kx = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Ky = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Kz = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) def forward(self): return generate_r(Kx=self.Kx, Ky=self.Ky,…
sagemath crashes on start (output in messagem body)
Package: sagemathVersion: 9.5-6Severity: importantFile: /usr/bin/sage Dear Maintainer, I can’t start sage on console. Starting it, I get the following: $ sage┌────────────────────────────────────────────────────────────────────┐│ SageMath version 9.5, Release Date: 2022-01-30 ││ Using Python 3.11.6. Type “help()” for help. │└────────────────────────────────────────────────────────────────────┘ Error in sys.excepthook:Traceback (most recent call last):File “/usr/lib/python3.11/pathlib.py”, line 1251, in is_dirreturn S_ISDIR(self.stat().st_mode)^^^^^^^^^AttributeError: ‘str’…
Detecting the Language of a Person’s Name using a PyTorch RNN
In this tutorial, we’ll build a Recurrent Neural Network (RNN) in PyTorch that will classify people’s names by their languages. We assume that the reader has a basic understanding of PyTorch and machine learning in Python. At the end of this tutorial, we’ll be able to predict the language of…
140releng-powerpc64le-quarterly][misc/py-pytorch] Failed for py39-pytorch-2.0.1 in configure
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/foul2/data/140releng-powerpc64le-quarterly/84b4661ec108/logs/py39-pytorch-2.0.1.log Build URL: pkg-status.freebsd.org/foul2/build.html?mastername=140releng-powerpc64le-quarterly&build=84b4661ec108 Log: =>> Building misc/py-pytorch build started at Sun Dec 3…
140releng-powerpc64le-quarterly][biology/cytoscape] Failed for cytoscape-3.6.1 in build
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/foul2/data/140releng-powerpc64le-quarterly/84b4661ec108/logs/cytoscape-3.6.1.log Build URL: pkg-status.freebsd.org/foul2/build.html?mastername=140releng-powerpc64le-quarterly&build=84b4661ec108 Log: =>> Building biology/cytoscape build started at Sat Dec 2…
systemd autopkgtest regression on arm64 and s390x on mantic
Is seems the container fails to boot. From a bad run: 9109s autopkgtest [10:39:17]: test tests-in-lxd: [———————– 9145s 2023-11-28T10:39:50Z INFO Waiting for automatic snapd restart… 9259s lxd 5.19-8635f82 from Canonical** installed 9288s Creating autopkgtest-prepare-jhI 9475s Retrieving image: metadata: 100% (323.81MB/s) Retrieving image: rootfs: 1% (3.53MB/s) <SNIP> Retrieving image: rootfs: 100%…
proxy – Failed to Download Packages from Github via Devtools in RStudio
I am just beginning to learn R and have built up an RStudio Server by WSL (Ubuntu 22.04.2)(yes, my PC is on Win11 and just want to use Unix environment). So here it is, I tried to download some packages by devtools::install_github(), yet the console simply showed: Error: Failed to…
Re: How do you stop a batch prediction job on Vert…
To stop a Vertex AI batch prediction job, you can follow these steps: Google Cloud Console: Go to the Google Cloud Console: console.cloud.google.com/. Navigate to the Vertex AI section or AI Platform (if you’re using an older version). Look for the batch prediction job you want to stop. Stopping the…
Brazil Leads in Sugarcane Bioenergy Research, Review Reveals
Publications on sugarcane have increased exponentially since 2006 worldwide, and Brazil has had more articles published on the topic than any other country in the period, according to a review in BioEnergy Research. The number of articles on the subject averaged about five per year between 1999 and 2006 but…
Scientist II, Bioinformatics, Machine Learning Job
Job Description Tome Biosciences is the programmable gene insertion company. Using CRISPR, our technologies allow us to insert any genetic sequence of any size at any location into any genome. We are writing the final chapter in genomic medicines, delivering cures to patients through cell and genome engineering. Tome is…
main-powerpc64le-default][misc/py-pytorch] Failed for py39-pytorch-2.1.1 in configure
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/foul2/data/main-powerpc64le-default/p5b346a1c0cc2_sfb51ddb20d/logs/py39-pytorch-2.1.1.log Build URL: pkg-status.freebsd.org/foul2/build.html?mastername=main-powerpc64le-default&build=p5b346a1c0cc2_sfb51ddb20d Log: =>> Building misc/py-pytorch build started at Fri Nov 24…
Post-Doctoral Associate – Bioinformatics & Computational Biology Job in Minnesota
Required Qualifications: • A PhD degree in related field (Bioinformatics, Computer Science, Statistics, etc.) obtained in the last 1~2 years.• Strong quantitative data analysis background (machine learning, biostatistics, etc.) and/or computational genomics/genetics experiences (spatial transcriptomics, single-cell sequencing, high-throughput omics sequencing data analysis, TWAS/GWAS, etc.) or other relevant areas.• Strong…
resources – Snakemake, slurm and memory
I am struggling to understand how snakemake submits jobs to slurm. When I have a basic slurm sbatch script I usually add a line, such as #SBATCH –mem=5Gto determine that slurm may use 5 gigabytes (and no more) of memory. Now, I am using snakemake together with slurm with snakemake…
Vertex Review | Automated AI System That Generates $912.35/Day
Vertex Review Welcome to the Vertex Review blog post. Vertex is for those who are still lagging behind in the video marketing era. Vertex can do it all for you without having to record a video yourself, use a video editor, and show your face on camera. The world’s first…
Automation Script for installing virtual environment with installation of tensor flow and PyTorch on mac os metal | by Vineeth Krishna | Nov, 2023
TensorFlow, TensorFlow-Metal, and PyTorch are powerful deep learning frameworks widely used in various applications. To effectively manage these frameworks and their dependencies, it’s recommended to work within a virtual environment. A virtual environment isolates the project’s dependencies from the global Python environment, preventing conflicts and ensuring compatibility. This article provides…
132amd64-default][science/votca] Failed for votca-2023 in package
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/beefy16/data/132amd64-default/5b346a1c0cc2/logs/votca-2023.log Build URL: pkg-status.freebsd.org/beefy16/build.html?mastername=132amd64-default&build=5b346a1c0cc2 Log: =>> Building science/votca build started at Tue Nov 21…
R-Studio 9.3.191.259
R-Studio is a family of powerful and cost-effective data recovery and undelete utilities. Empowered by the new unique data recovery technologies, it is the most comprehensive solution for data recovery from FAT12/16/32, NTFS, NTFS5 (created or updated by Windows 2000), and Ext2FS (LINUX file system) partitions. It functions on local…
EMDB < EMD-14025
Field: Choose…EMDB IDTitleAuthorORCIDEM methodCurrent statusDeposition dateRelease dateDeposition siteLast processing siteFitted modelsRaw dataResolutionResolution methodSoftwareLigand nameComplex nameDomain nameDrug nameGO term nameInterPro term nameChEBI term nameExternal reference Publication titlePublication yearJournalPublication author Sample typeSample nameOrganismOrganism (NCBI code)StrainOrganTissueCellOrganelleCellular LocationE.C. numberMolecular Weight methodMolecular Weight (Da)Recombinant ExpressionRecombinant organismRecombinant organism (NCBI code)Recombinant strainRecombinant expression cellRecombinant expression plasmidDNA/RNA classificationDNA/RNA…
The Biostar Herald for Monday, November 20, 2023
The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, and was edited by Istvan…
How to obtain full alignment results?
How to obtain full alignment results? 0 Hi, When I prepare to align my short reads to the human pan-genome graph genome, the result is only a path, 1. what I want is to provide me all the sequences that have a mismatch and full alignment with this reads? And…
140releng-armv7-default][misc/py-pytorch] Failed for py39-pytorch-2.1.0 in configure
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/ampere3/data/140releng-armv7-default/d5268d5f7157/logs/py39-pytorch-2.1.0.log Build URL: pkg-status.freebsd.org/ampere3/build.html?mastername=140releng-armv7-default&build=d5268d5f7157 Log: =>> Building misc/py-pytorch build started at Sun Nov 19…
EMDB < EMD-16930
Field: Choose…EMDB IDTitleAuthorORCIDEM methodCurrent statusDeposition dateRelease dateDeposition siteLast processing siteFitted modelsRaw dataResolutionResolution methodSoftwareLigand nameComplex nameDomain nameDrug nameGO term nameInterPro term nameChEBI term nameExternal reference Publication titlePublication yearJournalPublication author Sample typeSample nameOrganismOrganism (NCBI code)StrainOrganTissueCellOrganelleCellular LocationE.C. numberMolecular Weight methodMolecular Weight (Da)Recombinant ExpressionRecombinant organismRecombinant organism (NCBI code)Recombinant strainRecombinant expression cellRecombinant expression plasmidDNA/RNA classificationDNA/RNA…
Senior Bioinformatics Scientist Job in Cambridgeshire, Career, Permanent Jobs in Illumina
What if the work you did every day could impact the lives of people you know? Or all of humanity? At Illumina, we are expanding access to genomic technology to realize health equity for billions of people around the world. Our efforts enable life-changing discoveries that are transforming human…
Irreversible Electroporation Ablators Market Size 2023 – 2030 Global Industrial Analysis, Key Geographical Regions, Market Share, Top Key Players, Product Types and Forecast Research Report
{“payload”:{“allShortcutsEnabled”:false,”fileTree”:{“”:{“items”:[{“name”:”1-4-butanediol-market.md”,”path”:”1-4-butanediol-market.md”,”contentType”:”file”},{“name”:”13-propanediol-pdo-market.md”,”path”:”13-propanediol-pdo-market.md”,”contentType”:”file”},{“name”:”14-butanediol-market.md”,”path”:”14-butanediol-market.md”,”contentType”:”file”},{“name”:”2-chloroethanol-market.md”,”path”:”2-chloroethanol-market.md”,”contentType”:”file”},{“name”:”26-dimethylnaphtalene-cas-581-42-0-market.md”,”path”:”26-dimethylnaphtalene-cas-581-42-0-market.md”,”contentType”:”file”},{“name”:”3-bottle-gas-service-carts-market.md”,”path”:”3-bottle-gas-service-carts-market.md”,”contentType”:”file”},{“name”:”3-cyanopyridine-market.md”,”path”:”3-cyanopyridine-market.md”,”contentType”:”file”},{“name”:”3d-printing-with-metal-powders-market.md”,”path”:”3d-printing-with-metal-powders-market.md”,”contentType”:”file”},{“name”:”76mm-camouflage-ammunition-market.md”,”path”:”76mm-camouflage-ammunition-market.md”,”contentType”:”file”},{“name”:”a1-adrenergic-agonist-market.md”,”path”:”a1-adrenergic-agonist-market.md”,”contentType”:”file”},{“name”:”abs-football-helmet-market.md”,”path”:”abs-football-helmet-market.md”,”contentType”:”file”},{“name”:”accounts-receivable-accounts-payable-automation-market.md”,”path”:”accounts-receivable-accounts-payable-automation-market.md”,”contentType”:”file”},{“name”:”active-noise-and-vibration-control-systems-market.md”,”path”:”active-noise-and-vibration-control-systems-market.md”,”contentType”:”file”},{“name”:”adas-devicecomponents-market.md”,”path”:”adas-devicecomponents-market.md”,”contentType”:”file”},{“name”:”advanced-animal-ventilators-market.md”,”path”:”advanced-animal-ventilators-market.md”,”contentType”:”file”},{“name”:”aerospace-elastomers-market.md”,”path”:”aerospace-elastomers-market.md”,”contentType”:”file”},{“name”:”aerospace-metal-matrix-composites-market.md”,”path”:”aerospace-metal-matrix-composites-market.md”,”contentType”:”file”},{“name”:”aerospace-radome-market.md”,”path”:”aerospace-radome-market.md”,”contentType”:”file”},{“name”:”aerospace-testing-inspection-and-certification-market.md”,”path”:”aerospace-testing-inspection-and-certification-market.md”,”contentType”:”file”},{“name”:”afis-automated-fingerprint-identification-system-market.md”,”path”:”afis-automated-fingerprint-identification-system-market.md”,”contentType”:”file”},{“name”:”agricultural-water-soluble-fertilizer-market.md”,”path”:”agricultural-water-soluble-fertilizer-market.md”,”contentType”:”file”},{“name”:”agriculture-tires-market.md”,”path”:”agriculture-tires-market.md”,”contentType”:”file”},{“name”:”air-traffic-control-equipment-atc-market.md”,”path”:”air-traffic-control-equipment-atc-market.md”,”contentType”:”file”},{“name”:”aircraft-interior-fasteners-market.md”,”path”:”aircraft-interior-fasteners-market.md”,”contentType”:”file”},{“name”:”aluminium-based-master-alloy-market.md”,”path”:”aluminium-based-master-alloy-market.md”,”contentType”:”file”},{“name”:”aluminum-castings-market.md”,”path”:”aluminum-castings-market.md”,”contentType”:”file”},{“name”:”aluminum-chlorhydrate-market.md”,”path”:”aluminum-chlorhydrate-market.md”,”contentType”:”file”},{“name”:”aluminum-composite-panel-market.md”,”path”:”aluminum-composite-panel-market.md”,”contentType”:”file”},{“name”:”ambient-vaporizer-market.md”,”path”:”ambient-vaporizer-market.md”,”contentType”:”file”},{“name”:”amino-acid-based-surfactants-market.md”,”path”:”amino-acid-based-surfactants-market.md”,”contentType”:”file”},{“name”:”aminoglycosides-antibiotics-market.md”,”path”:”aminoglycosides-antibiotics-market.md”,”contentType”:”file”},{“name”:”amyotrophic-lateral-sclerosis-lou-gehrigs-disease-treatment-market.md”,”path”:”amyotrophic-lateral-sclerosis-lou-gehrigs-disease-treatment-market.md”,”contentType”:”file”},{“name”:”animal-feed-probiotic-bacteria-market.md”,”path”:”animal-feed-probiotic-bacteria-market.md”,”contentType”:”file”},{“name”:”animal-necropsy-tables-market.md”,”path”:”animal-necropsy-tables-market.md”,”contentType”:”file”},{“name”:”animation-vfx-and-games-market.md”,”path”:”animation-vfx-and-games-market.md”,”contentType”:”file”},{“name”:”anti-smoking-products-market.md”,”path”:”anti-smoking-products-market.md”,”contentType”:”file”},{“name”:”anti-vibration-mounts-market.md”,”path”:”anti-vibration-mounts-market.md”,”contentType”:”file”},{“name”:”antispasmodics-drug-market.md”,”path”:”antispasmodics-drug-market.md”,”contentType”:”file”},{“name”:”antivascular-endothelial-growth-factor-therapy-market.md”,”path”:”antivascular-endothelial-growth-factor-therapy-market.md”,”contentType”:”file”},{“name”:”aquarium-lighting-equipment-market.md”,”path”:”aquarium-lighting-equipment-market.md”,”contentType”:”file”},{“name”:”arbidol-hydrochloridecovid-19-market.md”,”path”:”arbidol-hydrochloridecovid-19-market.md”,”contentType”:”file”},{“name”:”aspartame-free-proteins-market.md”,”path”:”aspartame-free-proteins-market.md”,”contentType”:”file”},{“name”:”asphalt-content-binder-ignition-furnace-market.md”,”path”:”asphalt-content-binder-ignition-furnace-market.md”,”contentType”:”file”},{“name”:”auto-lacing-shoes-market.md”,”path”:”auto-lacing-shoes-market.md”,”contentType”:”file”},{“name”:”automated-endoscope-reprocessors-market.md”,”path”:”automated-endoscope-reprocessors-market.md”,”contentType”:”file”},{“name”:”automatic-license-plate-recognition-alpr-market.md”,”path”:”automatic-license-plate-recognition-alpr-market.md”,”contentType”:”file”},{“name”:”automation-industrial-monitors-market.md”,”path”:”automation-industrial-monitors-market.md”,”contentType”:”file”},{“name”:”automotive-acc-system-market.md”,”path”:”automotive-acc-system-market.md”,”contentType”:”file”},{“name”:”automotive-aftermarket-appearance-chemicals-market.md”,”path”:”automotive-aftermarket-appearance-chemicals-market.md”,”contentType”:”file”},{“name”:”automotive-anti-lock-braking-system-abs-market.md”,”path”:”automotive-anti-lock-braking-system-abs-market.md”,”contentType”:”file”},{“name”:”automotive-component-outsourcing-market.md”,”path”:”automotive-component-outsourcing-market.md”,”contentType”:”file”},{“name”:”automotive-ee-architectures-market.md”,”path”:”automotive-ee-architectures-market.md”,”contentType”:”file”},{“name”:”automotive-electric-seat-switch-market.md”,”path”:”automotive-electric-seat-switch-market.md”,”contentType”:”file”},{“name”:”automotive-fuel-pump-motors-market.md”,”path”:”automotive-fuel-pump-motors-market.md”,”contentType”:”file”},{“name”:”automotive-green-tires-market.md”,”path”:”automotive-green-tires-market.md”,”contentType”:”file”},{“name”:”automotive-mirror-systems-market.md”,”path”:”automotive-mirror-systems-market.md”,”contentType”:”file”},{“name”:”automotive-multimedia-touchpad-market.md”,”path”:”automotive-multimedia-touchpad-market.md”,”contentType”:”file”},{“name”:”automotive-occupant-classification-system-ocs-market.md”,”path”:”automotive-occupant-classification-system-ocs-market.md”,”contentType”:”file”},{“name”:”automotive-open-die-forgings-market.md”,”path”:”automotive-open-die-forgings-market.md”,”contentType”:”file”},{“name”:”automotive-solar-control-glass-market.md”,”path”:”automotive-solar-control-glass-market.md”,”contentType”:”file”},{“name”:”automotive-vehicle-insurance-market.md”,”path”:”automotive-vehicle-insurance-market.md”,”contentType”:”file”},{“name”:”automotive-whiplash-protection-systems-market.md”,”path”:”automotive-whiplash-protection-systems-market.md”,”contentType”:”file”},{“name”:”avalanche-photodiode-apd-market.md”,”path”:”avalanche-photodiode-apd-market.md”,”contentType”:”file”},{“name”:”baby-care-products-market.md”,”path”:”baby-care-products-market.md”,”contentType”:”file”},{“name”:”baby-nipples-market.md”,”path”:”baby-nipples-market.md”,”contentType”:”file”},{“name”:”baby-safety-seats-market.md”,”path”:”baby-safety-seats-market.md”,”contentType”:”file”},{“name”:”balanced-armature-magnetic-speakers-market.md”,”path”:”balanced-armature-magnetic-speakers-market.md”,”contentType”:”file”},{“name”:”battery-monitoring-systems-market.md”,”path”:”battery-monitoring-systems-market.md”,”contentType”:”file”},{“name”:”behavioralmental-health-software-market.md”,”path”:”behavioralmental-health-software-market.md”,”contentType”:”file”},{“name”:”bi-metal-band-saw-blade-market.md”,”path”:”bi-metal-band-saw-blade-market.md”,”contentType”:”file”},{“name”:”bio-based-adipic-acid-market.md”,”path”:”bio-based-adipic-acid-market.md”,”contentType”:”file”},{“name”:”bio-based-functional-polymers-market.md”,”path”:”bio-based-functional-polymers-market.md”,”contentType”:”file”},{“name”:”bio-based-polyethylene-market.md”,”path”:”bio-based-polyethylene-market.md”,”contentType”:”file”},{“name”:”bio-mems-market.md”,”path”:”bio-mems-market.md”,”contentType”:”file”},{“name”:”biogenic-stimulant-market.md”,”path”:”biogenic-stimulant-market.md”,”contentType”:”file”},{“name”:”blister-packaging-equipment-market.md”,”path”:”blister-packaging-equipment-market.md”,”contentType”:”file”},{“name”:”blockchain-for-supply-chain-market.md”,”path”:”blockchain-for-supply-chain-market.md”,”contentType”:”file”},{“name”:”blood-glucose-monitoring-system-market.md”,”path”:”blood-glucose-monitoring-system-market.md”,”contentType”:”file”},{“name”:”bone-allograft-and-xenograft-market.md”,”path”:”bone-allograft-and-xenograft-market.md”,”contentType”:”file”},{“name”:”brake-override-system-market.md”,”path”:”brake-override-system-market.md”,”contentType”:”file”},{“name”:”bread-and-baked-food-market.md”,”path”:”bread-and-baked-food-market.md”,”contentType”:”file”},{“name”:”brushless-dc-market.md”,”path”:”brushless-dc-market.md”,”contentType”:”file”},{“name”:”business-jet-market.md”,”path”:”business-jet-market.md”,”contentType”:”file”},{“name”:”c15-c22-fatty-alcohols-market.md”,”path”:”c15-c22-fatty-alcohols-market.md”,”contentType”:”file”},{“name”:”cable-cars-ropeways-market.md”,”path”:”cable-cars-ropeways-market.md”,”contentType”:”file”},{“name”:”cardiac-electrophysiology-mapping-navigation-and-recording-devices-market.md”,”path”:”cardiac-electrophysiology-mapping-navigation-and-recording-devices-market.md”,”contentType”:”file”},{“name”:”carpet-tile-market.md”,”path”:”carpet-tile-market.md”,”contentType”:”file”},{“name”:”carrier-wi-fi-equipment-market.md”,”path”:”carrier-wi-fi-equipment-market.md”,”contentType”:”file”},{“name”:”cellular-based-m2m-vas-market.md”,”path”:”cellular-based-m2m-vas-market.md”,”contentType”:”file”},{“name”:”cellular-connected-drone-market.md”,”path”:”cellular-connected-drone-market.md”,”contentType”:”file”},{“name”:”ceramic-coated-isolating-bearings-market.md”,”path”:”ceramic-coated-isolating-bearings-market.md”,”contentType”:”file”},{“name”:”ceramic-composite-membranes-market.md”,”path”:”ceramic-composite-membranes-market.md”,”contentType”:”file”},{“name”:”cfd-in-aerospace-and-defense-market.md”,”path”:”cfd-in-aerospace-and-defense-market.md”,”contentType”:”file”},{“name”:”charging-equipment-for-ev-market.md”,”path”:”charging-equipment-for-ev-market.md”,”contentType”:”file”},{“name”:”chemotherapy-induced-nausea-and-vomiting-drugs-market.md”,”path”:”chemotherapy-induced-nausea-and-vomiting-drugs-market.md”,”contentType”:”file”},{“name”:”children-dining-chairs-market.md”,”path”:”children-dining-chairs-market.md”,”contentType”:”file”},{“name”:”childrens-footwear-market.md”,”path”:”childrens-footwear-market.md”,”contentType”:”file”},{“name”:”childrens-warm-plush-jacket-market.md”,”path”:”childrens-warm-plush-jacket-market.md”,”contentType”:”file”},{“name”:”civil-aircraft-floor-standing-weighing-system-market.md”,”path”:”civil-aircraft-floor-standing-weighing-system-market.md”,”contentType”:”file”},{“name”:”civil-aircraft-interior-cleaning-and-detailing-services-market.md”,”path”:”civil-aircraft-interior-cleaning-and-detailing-services-market.md”,”contentType”:”file”},{“name”:”civil-aircraft-stand-entry-guidance-system-market.md”,”path”:”civil-aircraft-stand-entry-guidance-system-market.md”,”contentType”:”file”},{“name”:”classroom-microscope-slide-sets-market.md”,”path”:”classroom-microscope-slide-sets-market.md”,”contentType”:”file”},{“name”:”cold-box-casting-resin-market.md”,”path”:”cold-box-casting-resin-market.md”,”contentType”:”file”},{“name”:”comicmanga-pen-market.md”,”path”:”comicmanga-pen-market.md”,”contentType”:”file”},{“name”:”commercial-beverage-blenders-market.md”,”path”:”commercial-beverage-blenders-market.md”,”contentType”:”file”},{“name”:”commercial-photo-printer-market.md”,”path”:”commercial-photo-printer-market.md”,”contentType”:”file”},{“name”:”commercial-vehicle-air-deflector-market.md”,”path”:”commercial-vehicle-air-deflector-market.md”,”contentType”:”file”},{“name”:”commercial-vehicle-fuel-tank-market.md”,”path”:”commercial-vehicle-fuel-tank-market.md”,”contentType”:”file”},{“name”:”construction-flooring-chemical-market.md”,”path”:”construction-flooring-chemical-market.md”,”contentType”:”file”},{“name”:”consumer-goods-remote-controllers-market.md”,”path”:”consumer-goods-remote-controllers-market.md”,”contentType”:”file”},{“name”:”coronary-artery-bypass-grafts-cabg-market.md”,”path”:”coronary-artery-bypass-grafts-cabg-market.md”,”contentType”:”file”},{“name”:”cotton-wool-buds-pads-cotton-socks-market.md”,”path”:”cotton-wool-buds-pads-cotton-socks-market.md”,”contentType”:”file”},{“name”:”crispr-and-crispr-associated-genes-market.md”,”path”:”crispr-and-crispr-associated-genes-market.md”,”contentType”:”file”},{“name”:”custom-dry-ingredients-blend-market.md”,”path”:”custom-dry-ingredients-blend-market.md”,”contentType”:”file”},{“name”:”dc-electric-nutrunner-market.md”,”path”:”dc-electric-nutrunner-market.md”,”contentType”:”file”},{“name”:”defatted-wheat-germ-powder-market.md”,”path”:”defatted-wheat-germ-powder-market.md”,”contentType”:”file”},{“name”:”dental-acrylic-materials-market.md”,”path”:”dental-acrylic-materials-market.md”,”contentType”:”file”},{“name”:”dental-gel-materials-market.md”,”path”:”dental-gel-materials-market.md”,”contentType”:”file”},{“name”:”dental-heating-ovens-market.md”,”path”:”dental-heating-ovens-market.md”,”contentType”:”file”},{“name”:”dental-hygiene-devices-market.md”,”path”:”dental-hygiene-devices-market.md”,”contentType”:”file”},{“name”:”dental-implant-market.md”,”path”:”dental-implant-market.md”,”contentType”:”file”},{“name”:”dental-laboratory-lamps-market.md”,”path”:”dental-laboratory-lamps-market.md”,”contentType”:”file”},{“name”:”dental-laboratory-microwave-ovens-market.md”,”path”:”dental-laboratory-microwave-ovens-market.md”,”contentType”:”file”},{“name”:”dental-low-speed-handpiece-market.md”,”path”:”dental-low-speed-handpiece-market.md”,”contentType”:”file”},{“name”:”dental-micro-sandblasters-market.md”,”path”:”dental-micro-sandblasters-market.md”,”contentType”:”file”},{“name”:”dental-thermoformers-market.md”,”path”:”dental-thermoformers-market.md”,”contentType”:”file”},{“name”:”depyrogenation-tunnels-market.md”,”path”:”depyrogenation-tunnels-market.md”,”contentType”:”file”},{“name”:”desalination-system-market.md”,”path”:”desalination-system-market.md”,”contentType”:”file”},{“name”:”desk-calendar-market.md”,”path”:”desk-calendar-market.md”,”contentType”:”file”},{“name”:”dg-ground-mounted-solar-pv-market.md”,”path”:”dg-ground-mounted-solar-pv-market.md”,”contentType”:”file”},{“name”:”digital-analytical-balances-market.md”,”path”:”digital-analytical-balances-market.md”,”contentType”:”file”},{“name”:”digital-automotive-battery-analyzers-market.md”,”path”:”digital-automotive-battery-analyzers-market.md”,”contentType”:”file”},{“name”:”digital-pcr-dpcr-market.md”,”path”:”digital-pcr-dpcr-market.md”,”contentType”:”file”},{“name”:”digital-power-ics-market.md”,”path”:”digital-power-ics-market.md”,”contentType”:”file”},{“name”:”digital-signage-bar-type-display-market.md”,”path”:”digital-signage-bar-type-display-market.md”,”contentType”:”file”},{“name”:”dimeric-fatty-acid-market.md”,”path”:”dimeric-fatty-acid-market.md”,”contentType”:”file”},{“name”:”disposable-inflation-devices-market.md”,”path”:”disposable-inflation-devices-market.md”,”contentType”:”file”},{“name”:”diving-semi-drysuits-market.md”,”path”:”diving-semi-drysuits-market.md”,”contentType”:”file”},{“name”:”down-jacket-liquid-detergent-market.md”,”path”:”down-jacket-liquid-detergent-market.md”,”contentType”:”file”},{“name”:”doxorubicin-market.md”,”path”:”doxorubicin-market.md”,”contentType”:”file”},{“name”:”drawing-tools-equipment-market.md”,”path”:”drawing-tools-equipment-market.md”,”contentType”:”file”},{“name”:”drugs-of-abuse-testing-devices-market.md”,”path”:”drugs-of-abuse-testing-devices-market.md”,”contentType”:”file”},{“name”:”dual-control-switch-market.md”,”path”:”dual-control-switch-market.md”,”contentType”:”file”},{“name”:”dust-blower-sprays-market.md”,”path”:”dust-blower-sprays-market.md”,”contentType”:”file”},{“name”:”dynamic-voltage-restorer-dvr-market.md”,”path”:”dynamic-voltage-restorer-dvr-market.md”,”contentType”:”file”},{“name”:”ecg-monitor-with-patch-market.md”,”path”:”ecg-monitor-with-patch-market.md”,”contentType”:”file”},{“name”:”eco-drive-radio-controlled-watch-market.md”,”path”:”eco-drive-radio-controlled-watch-market.md”,”contentType”:”file”},{“name”:”eco-fibres-market.md”,”path”:”eco-fibres-market.md”,”contentType”:”file”},{“name”:”eco-friendly-plastic-bags-market.md”,”path”:”eco-friendly-plastic-bags-market.md”,”contentType”:”file”},{“name”:”efficient-foliar-fertilizer-market.md”,”path”:”efficient-foliar-fertilizer-market.md”,”contentType”:”file”},{“name”:”elapegademase-lvlr-market.md”,”path”:”elapegademase-lvlr-market.md”,”contentType”:”file”},{“name”:”electric-elevator-and-escalator-market.md”,”path”:”electric-elevator-and-escalator-market.md”,”contentType”:”file”},{“name”:”electric-enclosure-market.md”,”path”:”electric-enclosure-market.md”,”contentType”:”file”},{“name”:”electric-face-cleanser-market.md”,”path”:”electric-face-cleanser-market.md”,”contentType”:”file”},{“name”:”electro-diagnostic-devices-market.md”,”path”:”electro-diagnostic-devices-market.md”,”contentType”:”file”},{“name”:”electron-beam-physical-vapor-deposition-coating-market.md”,”path”:”electron-beam-physical-vapor-deposition-coating-market.md”,”contentType”:”file”},{“name”:”electronic-roll-towel-dispenser-market.md”,”path”:”electronic-roll-towel-dispenser-market.md”,”contentType”:”file”},{“name”:”electronic-veterinary-thermometers-market.md”,”path”:”electronic-veterinary-thermometers-market.md”,”contentType”:”file”},{“name”:”electrostatic-precipitators-market.md”,”path”:”electrostatic-precipitators-market.md”,”contentType”:”file”},{“name”:”emergency-external-defibrillators-market.md”,”path”:”emergency-external-defibrillators-market.md”,”contentType”:”file”},{“name”:”emergency-shower-and-eyewash-stations-market.md”,”path”:”emergency-shower-and-eyewash-stations-market.md”,”contentType”:”file”},{“name”:”emulsion-sealants-market.md”,”path”:”emulsion-sealants-market.md”,”contentType”:”file”},{“name”:”endodontic-obturator-ovens-market.md”,”path”:”endodontic-obturator-ovens-market.md”,”contentType”:”file”},{“name”:”enhanced-fire-detection-and-suppression-systems-market.md”,”path”:”enhanced-fire-detection-and-suppression-systems-market.md”,”contentType”:”file”},{“name”:”ent-and-bronchoscopy-devices-market.md”,”path”:”ent-and-bronchoscopy-devices-market.md”,”contentType”:”file”},{“name”:”entertainment-consumer-electronics-market.md”,”path”:”entertainment-consumer-electronics-market.md”,”contentType”:”file”},{“name”:”epoxy-resin-for-marine-composites-market.md”,”path”:”epoxy-resin-for-marine-composites-market.md”,”contentType”:”file”},{“name”:”epoxy-resins-market.md”,”path”:”epoxy-resins-market.md”,”contentType”:”file”},{“name”:”epoxy-surface-coating-market.md”,”path”:”epoxy-surface-coating-market.md”,”contentType”:”file”},{“name”:”ergonomics-dental-laboratory-ovens-market.md”,”path”:”ergonomics-dental-laboratory-ovens-market.md”,”contentType”:”file”},{“name”:”esd-safe-mat-market.md”,”path”:”esd-safe-mat-market.md”,”contentType”:”file”},{“name”:”evar-stent-grafts-market.md”,”path”:”evar-stent-grafts-market.md”,”contentType”:”file”},{“name”:”explosion-proof-electric-motors-market.md”,”path”:”explosion-proof-electric-motors-market.md”,”contentType”:”file”},{“name”:”eye-makeup-remover-market.md”,”path”:”eye-makeup-remover-market.md”,”contentType”:”file”},{“name”:”fabric-mesh-for-industrial-dryer-market.md”,”path”:”fabric-mesh-for-industrial-dryer-market.md”,”contentType”:”file”},{“name”:”faced-fire-resisting-insulated-panels-market.md”,”path”:”faced-fire-resisting-insulated-panels-market.md”,”contentType”:”file”},{“name”:”fashion-and-apparels-print-label-market.md”,”path”:”fashion-and-apparels-print-label-market.md”,”contentType”:”file”},{“name”:”ferro-chrome-market.md”,”path”:”ferro-chrome-market.md”,”contentType”:”file”},{“name”:”field-jacke-market.md”,”path”:”field-jacke-market.md”,”contentType”:”file”},{“name”:”film-thickness-measuring-system-market.md”,”path”:”film-thickness-measuring-system-market.md”,”contentType”:”file”},{“name”:”fine-ultra-fine-abrasive-flap-disc-market.md”,”path”:”fine-ultra-fine-abrasive-flap-disc-market.md”,”contentType”:”file”},{“name”:”fish-tank-market.md”,”path”:”fish-tank-market.md”,”contentType”:”file”},{“name”:”flat-rolled-stainless-steel-market.md”,”path”:”flat-rolled-stainless-steel-market.md”,”contentType”:”file”},{“name”:”floating-houses-market.md”,”path”:”floating-houses-market.md”,”contentType”:”file”},{“name”:”floor-standing-aircraft-weighing-scales-market.md”,”path”:”floor-standing-aircraft-weighing-scales-market.md”,”contentType”:”file”},{“name”:”fluoro-polymer-film-market.md”,”path”:”fluoro-polymer-film-market.md”,”contentType”:”file”},{“name”:”fluoroelastomer-market.md”,”path”:”fluoroelastomer-market.md”,”contentType”:”file”},{“name”:”fly-ash-and-ceramic-microsphere-market.md”,”path”:”fly-ash-and-ceramic-microsphere-market.md”,”contentType”:”file”},{“name”:”foam-pouches-market.md”,”path”:”foam-pouches-market.md”,”contentType”:”file”},{“name”:”foil-balloons-market.md”,”path”:”foil-balloons-market.md”,”contentType”:”file”},{“name”:”folders-blade-folding-knives-market.md”,”path”:”folders-blade-folding-knives-market.md”,”contentType”:”file”},{“name”:”food-beverages-filter-paper-market.md”,”path”:”food-beverages-filter-paper-market.md”,”contentType”:”file”},{“name”:”food-clean-label-ingredients-market.md”,”path”:”food-clean-label-ingredients-market.md”,”contentType”:”file”},{“name”:”food-grade-grease-market.md”,”path”:”food-grade-grease-market.md”,”contentType”:”file”},{“name”:”foot-care-packaging-market.md”,”path”:”foot-care-packaging-market.md”,”contentType”:”file”},{“name”:”foot-cream-lotion-market.md”,”path”:”foot-cream-lotion-market.md”,”contentType”:”file”},{“name”:”four-shaft-industrial-shredders-market.md”,”path”:”four-shaft-industrial-shredders-market.md”,”contentType”:”file”},{“name”:”frontotemporal-disorders-treatment-market.md”,”path”:”frontotemporal-disorders-treatment-market.md”,”contentType”:”file”},{“name”:”frp-tank-in-the-water-and-wastewater-market.md”,”path”:”frp-tank-in-the-water-and-wastewater-market.md”,”contentType”:”file”},{“name”:”gallium-nitride-charger-market.md”,”path”:”gallium-nitride-charger-market.md”,”contentType”:”file”},{“name”:”gallium-nitrite-semiconductor-devices-market.md”,”path”:”gallium-nitrite-semiconductor-devices-market.md”,”contentType”:”file”},{“name”:”gaming-headsets-and-gaming-headphones-market.md”,”path”:”gaming-headsets-and-gaming-headphones-market.md”,”contentType”:”file”},{“name”:”gan-based-power-device-market.md”,”path”:”gan-based-power-device-market.md”,”contentType”:”file”},{“name”:”gan-power-modules-market.md”,”path”:”gan-power-modules-market.md”,”contentType”:”file”},{“name”:”gas-analyzers-market.md”,”path”:”gas-analyzers-market.md”,”contentType”:”file”},{“name”:”gas-and-oil-drill-bits-market.md”,”path”:”gas-and-oil-drill-bits-market.md”,”contentType”:”file”},{“name”:”gas-detectors-for-shipping-market.md”,”path”:”gas-detectors-for-shipping-market.md”,”contentType”:”file”},{“name”:”gas-fueled-smoker-market.md”,”path”:”gas-fueled-smoker-market.md”,”contentType”:”file”},{“name”:”gas-service-carts-for-civil-aircraft-market.md”,”path”:”gas-service-carts-for-civil-aircraft-market.md”,”contentType”:”file”},{“name”:”gastrointestinal-endoscopy-devices-market.md”,”path”:”gastrointestinal-endoscopy-devices-market.md”,”contentType”:”file”},{“name”:”geothermal-heat-pumps-market.md”,”path”:”geothermal-heat-pumps-market.md”,”contentType”:”file”},{“name”:”gifford-mcmahon-cryocoolers-market.md”,”path”:”gifford-mcmahon-cryocoolers-market.md”,”contentType”:”file”},{“name”:”gigabit-passive-optical-network-gpon-chipset-market.md”,”path”:”gigabit-passive-optical-network-gpon-chipset-market.md”,”contentType”:”file”},{“name”:”glass-fiber-reinforced-plastic-water-tank-market.md”,”path”:”glass-fiber-reinforced-plastic-water-tank-market.md”,”contentType”:”file”},{“name”:”glass-to-metal-seals-market.md”,”path”:”glass-to-metal-seals-market.md”,”contentType”:”file”},{“name”:”glucagon-like-peptide-1-glp-1-agonists-market.md”,”path”:”glucagon-like-peptide-1-glp-1-agonists-market.md”,”contentType”:”file”},{“name”:”gold-jewelry-gold-bar-and-silver-market.md”,”path”:”gold-jewelry-gold-bar-and-silver-market.md”,”contentType”:”file”},{“name”:”hair-care-products-market.md”,”path”:”hair-care-products-market.md”,”contentType”:”file”},{“name”:”hand-applicator-market.md”,”path”:”hand-applicator-market.md”,”contentType”:”file”},{“name”:”handmade-carpets-market.md”,”path”:”handmade-carpets-market.md”,”contentType”:”file”},{“name”:”hd-video-surveillance-system-market.md”,”path”:”hd-video-surveillance-system-market.md”,”contentType”:”file”},{“name”:”healthcare-workwear-market.md”,”path”:”healthcare-workwear-market.md”,”contentType”:”file”},{“name”:”heating-furnace-market.md”,”path”:”heating-furnace-market.md”,”contentType”:”file”},{“name”:”heating-ventilation-and-air-conditioning-hvac-market.md”,”path”:”heating-ventilation-and-air-conditioning-hvac-market.md”,”contentType”:”file”},{“name”:”high-intensity-focused-ultrasound-system-market.md”,”path”:”high-intensity-focused-ultrasound-system-market.md”,”contentType”:”file”},{“name”:”high-protein-cat-food-market.md”,”path”:”high-protein-cat-food-market.md”,”contentType”:”file”},{“name”:”high-purity-alumina-market.md”,”path”:”high-purity-alumina-market.md”,”contentType”:”file”},{“name”:”high-temperature-prepreg-market.md”,”path”:”high-temperature-prepreg-market.md”,”contentType”:”file”},{“name”:”homogenized-tobacco-leaf-htl-cigars-market.md”,”path”:”homogenized-tobacco-leaf-htl-cigars-market.md”,”contentType”:”file”},{“name”:”hospital-lighting-market.md”,”path”:”hospital-lighting-market.md”,”contentType”:”file”},{“name”:”hotel-coffee-table-market.md”,”path”:”hotel-coffee-table-market.md”,”contentType”:”file”},{“name”:”household-kitchen-rail-kits-market.md”,”path”:”household-kitchen-rail-kits-market.md”,”contentType”:”file”},{“name”:”humidity-control-cabinets-market.md”,”path”:”humidity-control-cabinets-market.md”,”contentType”:”file”},{“name”:”hunting-weapon-market.md”,”path”:”hunting-weapon-market.md”,”contentType”:”file”},{“name”:”hyaluronic-acid-based-biomaterials-market.md”,”path”:”hyaluronic-acid-based-biomaterials-market.md”,”contentType”:”file”},{“name”:”hybrid-dental-vacuum-pumps-market.md”,”path”:”hybrid-dental-vacuum-pumps-market.md”,”contentType”:”file”},{“name”:”hypercholesterolemia-drugs-market.md”,”path”:”hypercholesterolemia-drugs-market.md”,”contentType”:”file”},{“name”:”in-mold-labels-market.md”,”path”:”in-mold-labels-market.md”,”contentType”:”file”},{“name”:”in-vehicle-networking-market.md”,”path”:”in-vehicle-networking-market.md”,”contentType”:”file”},{“name”:”in-vitro-diagnostic-services-market.md”,”path”:”in-vitro-diagnostic-services-market.md”,”contentType”:”file”},{“name”:”indoor-sportswear-and-fitness-apparel-market.md”,”path”:”indoor-sportswear-and-fitness-apparel-market.md”,”contentType”:”file”},{“name”:”industrial-and-bar-b-que-charcoal-market.md”,”path”:”industrial-and-bar-b-que-charcoal-market.md”,”contentType”:”file”},{“name”:”industrial-infrared-scanner-market.md”,”path”:”industrial-infrared-scanner-market.md”,”contentType”:”file”},{“name”:”industrial-inkjet-printer-market.md”,”path”:”industrial-inkjet-printer-market.md”,”contentType”:”file”},{“name”:”industrial-wipes-market.md”,”path”:”industrial-wipes-market.md”,”contentType”:”file”},{“name”:”infrared-thermometers-for-clinical-usage-market.md”,”path”:”infrared-thermometers-for-clinical-usage-market.md”,”contentType”:”file”},{“name”:”inline-oil-particle-counters-market.md”,”path”:”inline-oil-particle-counters-market.md”,”contentType”:”file”},{“name”:”inline-viscosity-sensors-market.md”,”path”:”inline-viscosity-sensors-market.md”,”contentType”:”file”},{“name”:”instant-drinking-machines-market.md”,”path”:”instant-drinking-machines-market.md”,”contentType”:”file”},{“name”:”insulated-cooler-container-market.md”,”path”:”insulated-cooler-container-market.md”,”contentType”:”file”},{“name”:”intelligent-electromagnetic-flowmeters-market.md”,”path”:”intelligent-electromagnetic-flowmeters-market.md”,”contentType”:”file”},{“name”:”intelligent-emergency-response-systems-market.md”,”path”:”intelligent-emergency-response-systems-market.md”,”contentType”:”file”},{“name”:”intravascular-temperature-management-system-market.md”,”path”:”intravascular-temperature-management-system-market.md”,”contentType”:”file”},{“name”:”ip-derivatives-market.md”,”path”:”ip-derivatives-market.md”,”contentType”:”file”},{“name”:”irreversible-electroporation-ablators-market.md”,”path”:”irreversible-electroporation-ablators-market.md”,”contentType”:”file”},{“name”:”kids-camera-market.md”,”path”:”kids-camera-market.md”,”contentType”:”file”},{“name”:”kitchen-cabinets-market.md”,”path”:”kitchen-cabinets-market.md”,”contentType”:”file”},{“name”:”kitchen-collection-market.md”,”path”:”kitchen-collection-market.md”,”contentType”:”file”},{“name”:”laboratory-ovens-unit-market.md”,”path”:”laboratory-ovens-unit-market.md”,”contentType”:”file”},{“name”:”lactic-acid-and-poly-lactic-acid-pla-market.md”,”path”:”lactic-acid-and-poly-lactic-acid-pla-market.md”,”contentType”:”file”},{“name”:”lambert-eaton-myasthenic-syndrome-lems-therapeutics-market.md”,”path”:”lambert-eaton-myasthenic-syndrome-lems-therapeutics-market.md”,”contentType”:”file”},{“name”:”led-backlight-display-driver-ics-market.md”,”path”:”led-backlight-display-driver-ics-market.md”,”contentType”:”file”},{“name”:”led-dental-curing-units-market.md”,”path”:”led-dental-curing-units-market.md”,”contentType”:”file”},{“name”:”led-obstruct-lighting-market.md”,”path”:”led-obstruct-lighting-market.md”,”contentType”:”file”},{“name”:”left-handed-commercial-entrance-doors-market.md”,”path”:”left-handed-commercial-entrance-doors-market.md”,”contentType”:”file”},{“name”:”left-handed-inswing-commercial-front-doors-market.md”,”path”:”left-handed-inswing-commercial-front-doors-market.md”,”contentType”:”file”},{“name”:”left-handed-inswing-entry-door-market.md”,”path”:”left-handed-inswing-entry-door-market.md”,”contentType”:”file”},{“name”:”left-handed-outswing-commercial-entrance-doors-market.md”,”path”:”left-handed-outswing-commercial-entrance-doors-market.md”,”contentType”:”file”},{“name”:”left-handed-outswing-commercial-entry-door-market.md”,”path”:”left-handed-outswing-commercial-entry-door-market.md”,”contentType”:”file”},{“name”:”left-handed-outswing-commercial-front-entry-door-market.md”,”path”:”left-handed-outswing-commercial-front-entry-door-market.md”,”contentType”:”file”},{“name”:”lever-lid-can-market.md”,”path”:”lever-lid-can-market.md”,”contentType”:”file”},{“name”:”light-tower-market.md”,”path”:”light-tower-market.md”,”contentType”:”file”},{“name”:”lightning-rod-towers-market.md”,”path”:”lightning-rod-towers-market.md”,”contentType”:”file”},{“name”:”linear-low-density-polyethylene-lldpe-market.md”,”path”:”linear-low-density-polyethylene-lldpe-market.md”,”contentType”:”file”},{“name”:”liquid-sanitary-napkins-market.md”,”path”:”liquid-sanitary-napkins-market.md”,”contentType”:”file”},{“name”:”lithium-ion-battery-separator-lithium-battery-separator-market.md”,”path”:”lithium-ion-battery-separator-lithium-battery-separator-market.md”,”contentType”:”file”},{“name”:”lithium-ion-energy-accumulator-market.md”,”path”:”lithium-ion-energy-accumulator-market.md”,”contentType”:”file”},{“name”:”low-and-medium-voltage-insulating-gloves-market.md”,”path”:”low-and-medium-voltage-insulating-gloves-market.md”,”contentType”:”file”},{“name”:”low-dielectric-glass-fibre-market.md”,”path”:”low-dielectric-glass-fibre-market.md”,”contentType”:”file”},{“name”:”low-migration-ink-market.md”,”path”:”low-migration-ink-market.md”,”contentType”:”file”},{“name”:”magnesium-alloy-die-casting-machines-market.md”,”path”:”magnesium-alloy-die-casting-machines-market.md”,”contentType”:”file”},{“name”:”man-made-fabrics-market.md”,”path”:”man-made-fabrics-market.md”,”contentType”:”file”},{“name”:”manicure-micromotors-market.md”,”path”:”manicure-micromotors-market.md”,”contentType”:”file”},{“name”:”manual-dental-micro-sandblasters-market.md”,”path”:”manual-dental-micro-sandblasters-market.md”,”contentType”:”file”},{“name”:”maraging-steel-market.md”,”path”:”maraging-steel-market.md”,”contentType”:”file”},{“name”:”meal-fibers-market.md”,”path”:”meal-fibers-market.md”,”contentType”:”file”},{“name”:”meat-ingredients-market.md”,”path”:”meat-ingredients-market.md”,”contentType”:”file”},{“name”:”meat-safety-testing-equipment-market.md”,”path”:”meat-safety-testing-equipment-market.md”,”contentType”:”file”},{“name”:”mechanical-liner-hanger-systems-market.md”,”path”:”mechanical-liner-hanger-systems-market.md”,”contentType”:”file”},{“name”:”medical-device-coating-market.md”,”path”:”medical-device-coating-market.md”,”contentType”:”file”},{“name”:”medical-electrical-bathtub-market.md”,”path”:”medical-electrical-bathtub-market.md”,”contentType”:”file”},{“name”:”medical-enterprise-data-storage-market.md”,”path”:”medical-enterprise-data-storage-market.md”,”contentType”:”file”},{“name”:”medical-implants-sterile-packaging-market.md”,”path”:”medical-implants-sterile-packaging-market.md”,”contentType”:”file”},{“name”:”medication-compliance-management-market.md”,”path”:”medication-compliance-management-market.md”,”contentType”:”file”},{“name”:”medicine-packaging-machines-market.md”,”path”:”medicine-packaging-machines-market.md”,”contentType”:”file”},{“name”:”medium-chain-triglycerides-mcts-supplements-market.md”,”path”:”medium-chain-triglycerides-mcts-supplements-market.md”,”contentType”:”file”},{“name”:”mesh-bag-market.md”,”path”:”mesh-bag-market.md”,”contentType”:”file”},{“name”:”meso-erythritol-market.md”,”path”:”meso-erythritol-market.md”,”contentType”:”file”},{“name”:”metal-automotive-exterior-trim-market.md”,”path”:”metal-automotive-exterior-trim-market.md”,”contentType”:”file”},{“name”:”metal-canned-food-x-ray-inspection-systems-market.md”,”path”:”metal-canned-food-x-ray-inspection-systems-market.md”,”contentType”:”file”},{“name”:”metal-carbide-nanoparticles-market.md”,”path”:”metal-carbide-nanoparticles-market.md”,”contentType”:”file”},{“name”:”metal-dental-flasks-market.md”,”path”:”metal-dental-flasks-market.md”,”contentType”:”file”},{“name”:”metallic-brake-pads-market.md”,”path”:”metallic-brake-pads-market.md”,”contentType”:”file”},{“name”:”microfiber-sponges-scouring-pads-market.md”,”path”:”microfiber-sponges-scouring-pads-market.md”,”contentType”:”file”},{“name”:”microgrid-monitoring-systems-market.md”,”path”:”microgrid-monitoring-systems-market.md”,”contentType”:”file”},{“name”:”military-aircraft-weighing-platform-market.md”,”path”:”military-aircraft-weighing-platform-market.md”,”contentType”:”file”},{“name”:”mirrorless-interchangeable-lens-camera-market.md”,”path”:”mirrorless-interchangeable-lens-camera-market.md”,”contentType”:”file”},{“name”:”mobile-waterproof-shell-market.md”,”path”:”mobile-waterproof-shell-market.md”,”contentType”:”file”},{“name”:”moist-snuff-market.md”,”path”:”moist-snuff-market.md”,”contentType”:”file”},{“name”:”molecular-biology-enzymes-kits-and-reagents-market.md”,”path”:”molecular-biology-enzymes-kits-and-reagents-market.md”,”contentType”:”file”},{“name”:”motion-control-encoders-market.md”,”path”:”motion-control-encoders-market.md”,”contentType”:”file”},{“name”:”moulded-case-circuit-breaker-mccb-market.md”,”path”:”moulded-case-circuit-breaker-mccb-market.md”,”contentType”:”file”},{“name”:”multifunctional-baby-stroller-market.md”,”path”:”multifunctional-baby-stroller-market.md”,”contentType”:”file”},{“name”:”n-ethyl-para-base-ester-market.md”,”path”:”n-ethyl-para-base-ester-market.md”,”contentType”:”file”},{“name”:”n-hydroxy-caprylohydroxamic-acid-market.md”,”path”:”n-hydroxy-caprylohydroxamic-acid-market.md”,”contentType”:”file”},{“name”:”nanotube-x-ray-tube-cnt-x-ray-tube-market.md”,”path”:”nanotube-x-ray-tube-cnt-x-ray-tube-market.md”,”contentType”:”file”},{“name”:”natural-fiber-composites-nfc-market.md”,”path”:”natural-fiber-composites-nfc-market.md”,”contentType”:”file”},{“name”:”natural-plant-deodorant-market.md”,”path”:”natural-plant-deodorant-market.md”,”contentType”:”file”},{“name”:”new-energy-vehicle-drive-motor-market.md”,”path”:”new-energy-vehicle-drive-motor-market.md”,”contentType”:”file”},{“name”:”next-generation-advanced-batteries-market.md”,”path”:”next-generation-advanced-batteries-market.md”,”contentType”:”file”},{“name”:”non-alcoholic-wine-and-beer-market.md”,”path”:”non-alcoholic-wine-and-beer-market.md”,”contentType”:”file”},{“name”:”non-dairy-creamer-non-dairy-creamer-market.md”,”path”:”non-dairy-creamer-non-dairy-creamer-market.md”,”contentType”:”file”},{“name”:”non-honeycomb-sandwich-panel-core-materials-market.md”,”path”:”non-honeycomb-sandwich-panel-core-materials-market.md”,”contentType”:”file”},{“name”:”non-rechargeable-alkaline-battery-market.md”,”path”:”non-rechargeable-alkaline-battery-market.md”,”contentType”:”file”},{“name”:”non-slip-material-rolls-market.md”,”path”:”non-slip-material-rolls-market.md”,”contentType”:”file”},{“name”:”non-tire-synthetic-rubber-market.md”,”path”:”non-tire-synthetic-rubber-market.md”,”contentType”:”file”},{“name”:”non-volatile-next-generation-memory-technologies-market.md”,”path”:”non-volatile-next-generation-memory-technologies-market.md”,”contentType”:”file”},{“name”:”non-woven-construction-fabrics-market.md”,”path”:”non-woven-construction-fabrics-market.md”,”contentType”:”file”},{“name”:”o-cresol-market.md”,”path”:”o-cresol-market.md”,”contentType”:”file”},{“name”:”obstructive-sleep-apnea-therapeutic-devices-market.md”,”path”:”obstructive-sleep-apnea-therapeutic-devices-market.md”,”contentType”:”file”},{“name”:”offline-recipe-box-delivery-service-market.md”,”path”:”offline-recipe-box-delivery-service-market.md”,”contentType”:”file”},{“name”:”offline-recipe-delivery-box-market.md”,”path”:”offline-recipe-delivery-box-market.md”,”contentType”:”file”},{“name”:”offshore-support-vessels-operation-market.md”,”path”:”offshore-support-vessels-operation-market.md”,”contentType”:”file”},{“name”:”oil-free-medical-vacuum-pumps-market.md”,”path”:”oil-free-medical-vacuum-pumps-market.md”,”contentType”:”file”},{“name”:”online-meal-delivery-kit-market.md”,”path”:”online-meal-delivery-kit-market.md”,”contentType”:”file”},{“name”:”open-cockpit-gyroplanes-market.md”,”path”:”open-cockpit-gyroplanes-market.md”,”contentType”:”file”},{“name”:”optical-menstrual-cup-market.md”,”path”:”optical-menstrual-cup-market.md”,”contentType”:”file”},{“name”:”organic-elemental-analyzer-oea-market.md”,”path”:”organic-elemental-analyzer-oea-market.md”,”contentType”:”file”},{“name”:”organic-whole-liquid-milk-market.md”,”path”:”organic-whole-liquid-milk-market.md”,”contentType”:”file”},{“name”:”organo-phosphorus-market.md”,”path”:”organo-phosphorus-market.md”,”contentType”:”file”},{“name”:”oriented-cold-rolled-electrical-steel-market.md”,”path”:”oriented-cold-rolled-electrical-steel-market.md”,”contentType”:”file”},{“name”:”outdoor-sports-gps-device-market.md”,”path”:”outdoor-sports-gps-device-market.md”,”contentType”:”file”},{“name”:”outdoors-infant-passive-muff-market.md”,”path”:”outdoors-infant-passive-muff-market.md”,”contentType”:”file”},{“name”:”oven-bags-and-pouches-market.md”,”path”:”oven-bags-and-pouches-market.md”,”contentType”:”file”},{“name”:”oxygen-service-carts-market.md”,”path”:”oxygen-service-carts-market.md”,”contentType”:”file”},{“name”:”papr-filter-element-market.md”,”path”:”papr-filter-element-market.md”,”contentType”:”file”},{“name”:”particle-board-for-construction-market.md”,”path”:”particle-board-for-construction-market.md”,”contentType”:”file”},{“name”:”passenger-car-lighting-market.md”,”path”:”passenger-car-lighting-market.md”,”contentType”:”file”},{“name”:”passenger-rail-equipment-manufacturing-and-services-market.md”,”path”:”passenger-rail-equipment-manufacturing-and-services-market.md”,”contentType”:”file”},{“name”:”passenger-vehicle-thermostats-market.md”,”path”:”passenger-vehicle-thermostats-market.md”,”contentType”:”file”},{“name”:”peptides-biosimilars-market.md”,”path”:”peptides-biosimilars-market.md”,”contentType”:”file”},{“name”:”pet-chewing-snacks-market.md”,”path”:”pet-chewing-snacks-market.md”,”contentType”:”file”},{“name”:”pet-preform-equipment-market.md”,”path”:”pet-preform-equipment-market.md”,”contentType”:”file”},{“name”:”pharma-grade-sodium-bicarbonate-market.md”,”path”:”pharma-grade-sodium-bicarbonate-market.md”,”contentType”:”file”},{“name”:”pharmaceutical-grade-pvdc-market.md”,”path”:”pharmaceutical-grade-pvdc-market.md”,”contentType”:”file”},{“name”:”pig-ointment-market.md”,”path”:”pig-ointment-market.md”,”contentType”:”file”},{“name”:”pile-driving-vibrators-market.md”,”path”:”pile-driving-vibrators-market.md”,”contentType”:”file”},{“name”:”plant-based-butter-alternative-market.md”,”path”:”plant-based-butter-alternative-market.md”,”contentType”:”file”},{“name”:”plastic-bearings-market.md”,”path”:”plastic-bearings-market.md”,”contentType”:”file”},{“name”:”pocket-flask-market.md”,”path”:”pocket-flask-market.md”,”contentType”:”file”},{“name”:”polycarbonate-films-market.md”,”path”:”polycarbonate-films-market.md”,”contentType”:”file”},{“name”:”polymer-stabilizer-market.md”,”path”:”polymer-stabilizer-market.md”,”contentType”:”file”},{“name”:”portable-analytical-instruments-market.md”,”path”:”portable-analytical-instruments-market.md”,”contentType”:”file”},{“name”:”portable-dental-vacuum-pumps-market.md”,”path”:”portable-dental-vacuum-pumps-market.md”,”contentType”:”file”},{“name”:”portable-or-wearable-charging-cable-market.md”,”path”:”portable-or-wearable-charging-cable-market.md”,”contentType”:”file”},{“name”:”pos-systems-for-restaurants-market.md”,”path”:”pos-systems-for-restaurants-market.md”,”contentType”:”file”},{“name”:”powder-free-nitrile-disposable-gloves-market.md”,”path”:”powder-free-nitrile-disposable-gloves-market.md”,”contentType”:”file”},{“name”:”power-lawn-mowers-market.md”,”path”:”power-lawn-mowers-market.md”,”contentType”:”file”},{“name”:”pre-education-machine-market.md”,”path”:”pre-education-machine-market.md”,”contentType”:”file”},{“name”:”precious-metal-powders-and-flakes-market.md”,”path”:”precious-metal-powders-and-flakes-market.md”,”contentType”:”file”},{“name”:”pressure-sensitive-adhesives-tape-market.md”,”path”:”pressure-sensitive-adhesives-tape-market.md”,”contentType”:”file”},{“name”:”pulse-arc-dental-laboratory-sealers-market.md”,”path”:”pulse-arc-dental-laboratory-sealers-market.md”,”contentType”:”file”},{“name”:”pump-tube-market.md”,”path”:”pump-tube-market.md”,”contentType”:”file”},{“name”:”pur-hot-melts-adhesives-market.md”,”path”:”pur-hot-melts-adhesives-market.md”,”contentType”:”file”},{“name”:”quantum-dot-display-qled-market.md”,”path”:”quantum-dot-display-qled-market.md”,”contentType”:”file”},{“name”:”quilting-ruler-market.md”,”path”:”quilting-ruler-market.md”,”contentType”:”file”},{“name”:”radiation-curable-coatings-market.md”,”path”:”radiation-curable-coatings-market.md”,”contentType”:”file”},{“name”:”radiation-detection-monitoring-and-safety-market.md”,”path”:”radiation-detection-monitoring-and-safety-market.md”,”contentType”:”file”},{“name”:”railway-overhead-catenary-system-ocs-market.md”,”path”:”railway-overhead-catenary-system-ocs-market.md”,”contentType”:”file”},{“name”:”recreational-vehicles-generators-market.md”,”path”:”recreational-vehicles-generators-market.md”,”contentType”:”file”},{“name”:”residential-cooking-grills-market.md”,”path”:”residential-cooking-grills-market.md”,”contentType”:”file”},{“name”:”residential-ice-cream-machine-market.md”,”path”:”residential-ice-cream-machine-market.md”,”contentType”:”file”},{“name”:”residential-portable-dehumidifier-market.md”,”path”:”residential-portable-dehumidifier-market.md”,”contentType”:”file”},{“name”:”residential-salt-based-water-softeners-market.md”,”path”:”residential-salt-based-water-softeners-market.md”,”contentType”:”file”},{“name”:”residential-stationary-generator-market.md”,”path”:”residential-stationary-generator-market.md”,”contentType”:”file”},{“name”:”residential-uv-water-purifiers-market.md”,”path”:”residential-uv-water-purifiers-market.md”,”contentType”:”file”},{“name”:”retail-self-checkout-terminals-market.md”,”path”:”retail-self-checkout-terminals-market.md”,”contentType”:”file”},{“name”:”reusable-launch-systems-market.md”,”path”:”reusable-launch-systems-market.md”,”contentType”:”file”},{“name”:”rfid-blood-refrigerators-and-freezers-market.md”,”path”:”rfid-blood-refrigerators-and-freezers-market.md”,”contentType”:”file”},{“name”:”rfid-label-tag-printers-market.md”,”path”:”rfid-label-tag-printers-market.md”,”contentType”:”file”},{“name”:”rfid-tags-for-livestock-management-market.md”,”path”:”rfid-tags-for-livestock-management-market.md”,”contentType”:”file”},{“name”:”right-handed-outswing-commercial-front-entrance-doors-market.md”,”path”:”right-handed-outswing-commercial-front-entrance-doors-market.md”,”contentType”:”file”},{“name”:”right-handed-outswing-commercial-front-entry-door-market.md”,”path”:”right-handed-outswing-commercial-front-entry-door-market.md”,”contentType”:”file”},{“name”:”road-stud-and-delineator-market.md”,”path”:”road-stud-and-delineator-market.md”,”contentType”:”file”},{“name”:”robotic-pharmacy-prescription-dispensing-systems-market.md”,”path”:”robotic-pharmacy-prescription-dispensing-systems-market.md”,”contentType”:”file”},{“name”:”roof-sheets-and-roof-panels-market.md”,”path”:”roof-sheets-and-roof-panels-market.md”,”contentType”:”file”},{“name”:”round-nylon-string-trimmer-line-market.md”,”path”:”round-nylon-string-trimmer-line-market.md”,”contentType”:”file”},{“name”:”rubiks-cube-market.md”,”path”:”rubiks-cube-market.md”,”contentType”:”file”},{“name”:”sachet-packaging-market.md”,”path”:”sachet-packaging-market.md”,”contentType”:”file”},{“name”:”safes-and-vaults-in-banking-market.md”,”path”:”safes-and-vaults-in-banking-market.md”,”contentType”:”file”},{“name”:”sawhorse-market.md”,”path”:”sawhorse-market.md”,”contentType”:”file”},{“name”:”school-assessment-tools-market.md”,”path”:”school-assessment-tools-market.md”,”contentType”:”file”},{“name”:”scientific-and-technical-publication-market.md”,”path”:”scientific-and-technical-publication-market.md”,”contentType”:”file”},{“name”:”secondary-oral-hygiene-market.md”,”path”:”secondary-oral-hygiene-market.md”,”contentType”:”file”},{“name”:”sedimentation-and-centrifugation-equipment-market.md”,”path”:”sedimentation-and-centrifugation-equipment-market.md”,”contentType”:”file”},{“name”:”self-boarding-gates-market.md”,”path”:”self-boarding-gates-market.md”,”contentType”:”file”},{“name”:”self-contained-breathing-apparatus-market.md”,”path”:”self-contained-breathing-apparatus-market.md”,”contentType”:”file”},{“name”:”self-healing-cutting-mats-market.md”,”path”:”self-healing-cutting-mats-market.md”,”contentType”:”file”},{“name”:”self-storage-software-market.md”,”path”:”self-storage-software-market.md”,”contentType”:”file”},{“name”:”semiconductor-fabrication-material-market.md”,”path”:”semiconductor-fabrication-material-market.md”,”contentType”:”file”},{“name”:”semiconductor-wafer-grinding-equipment-market.md”,”path”:”semiconductor-wafer-grinding-equipment-market.md”,”contentType”:”file”},{“name”:”serum-free-freezing-media-market.md”,”path”:”serum-free-freezing-media-market.md”,”contentType”:”file”},{“name”:”shade-cloth-market.md”,”path”:”shade-cloth-market.md”,”contentType”:”file”},{“name”:”shelf-mounted-robots-market.md”,”path”:”shelf-mounted-robots-market.md”,”contentType”:”file”},{“name”:”shotcrete-and-sprayed-cement-market.md”,”path”:”shotcrete-and-sprayed-cement-market.md”,”contentType”:”file”},{“name”:”shower-enclosure-and-cubicles-market.md”,”path”:”shower-enclosure-and-cubicles-market.md”,”contentType”:”file”},{“name”:”side-post-parasols-market.md”,”path”:”side-post-parasols-market.md”,”contentType”:”file”},{“name”:”silica-gel-desiccant-rotors-market.md”,”path”:”silica-gel-desiccant-rotors-market.md”,”contentType”:”file”},{“name”:”silicon-carbide-abrasive-adhesive-discs-market.md”,”path”:”silicon-carbide-abrasive-adhesive-discs-market.md”,”contentType”:”file”},{“name”:”silicon-carbide-for-semiconductor-applications-market.md”,”path”:”silicon-carbide-for-semiconductor-applications-market.md”,”contentType”:”file”},{“name”:”silicone-based-fouling-release-coatings-market.md”,”path”:”silicone-based-fouling-release-coatings-market.md”,”contentType”:”file”},{“name”:”skid-steer-loaders-market.md”,”path”:”skid-steer-loaders-market.md”,”contentType”:”file”},{“name”:”skinner-blade-market.md”,”path”:”skinner-blade-market.md”,”contentType”:”file”},{“name”:”small-cell-power-amplifiers-market.md”,”path”:”small-cell-power-amplifiers-market.md”,”contentType”:”file”},{“name”:”smart-baggage-handling-solutions-market.md”,”path”:”smart-baggage-handling-solutions-market.md”,”contentType”:”file”},{“name”:”smart-bike-trainers-market.md”,”path”:”smart-bike-trainers-market.md”,”contentType”:”file”},{“name”:”smart-pneumatics-market.md”,”path”:”smart-pneumatics-market.md”,”contentType”:”file”},{“name”:”smart-water-monitoring-devices-market.md”,”path”:”smart-water-monitoring-devices-market.md”,”contentType”:”file”},{“name”:”smart-wearables-for-nuclear-energy-market.md”,”path”:”smart-wearables-for-nuclear-energy-market.md”,”contentType”:”file”},{“name”:”softshell-heat-jacket-market.md”,”path”:”softshell-heat-jacket-market.md”,”contentType”:”file”},{“name”:”software-for-3d-printers-market.md”,”path”:”software-for-3d-printers-market.md”,”contentType”:”file”},{“name”:”solar-control-glass-market.md”,”path”:”solar-control-glass-market.md”,”contentType”:”file”},{“name”:”solar-control-spandrel-curtain-wall-market.md”,”path”:”solar-control-spandrel-curtain-wall-market.md”,”contentType”:”file”},{“name”:”solar-pv-backsheet-market.md”,”path”:”solar-pv-backsheet-market.md”,”contentType”:”file”},{“name”:”soluble-meal-fibers-market.md”,”path”:”soluble-meal-fibers-market.md”,”contentType”:”file”},{“name”:”spectral-filters-market.md”,”path”:”spectral-filters-market.md”,”contentType”:”file”},{“name”:”sport-fly-fishing-rods-market.md”,”path”:”sport-fly-fishing-rods-market.md”,”contentType”:”file”},{“name”:”sports-licensed-products-market.md”,”path”:”sports-licensed-products-market.md”,”contentType”:”file”},{“name”:”sputter-coating-market.md”,”path”:”sputter-coating-market.md”,”contentType”:”file”},{“name”:”stand-mixers-market.md”,”path”:”stand-mixers-market.md”,”contentType”:”file”},{“name”:”sterilization-technology-market.md”,”path”:”sterilization-technology-market.md”,”contentType”:”file”},{“name”:”stretch-and-shrink-sleeves-packaging-market.md”,”path”:”stretch-and-shrink-sleeves-packaging-market.md”,”contentType”:”file”},{“name”:”sulfur-hair-care-products-market.md”,”path”:”sulfur-hair-care-products-market.md”,”contentType”:”file”},{“name”:”super-precision-bearing-market.md”,”path”:”super-precision-bearing-market.md”,”contentType”:”file”},{“name”:”surgery-ceiling-pendant-systems-market.md”,”path”:”surgery-ceiling-pendant-systems-market.md”,”contentType”:”file”},{“name”:”tamper-evident-pots-tub-market.md”,”path”:”tamper-evident-pots-tub-market.md”,”contentType”:”file”},{“name”:”tbztd-cas-10591-85-2-market.md”,”path”:”tbztd-cas-10591-85-2-market.md”,”contentType”:”file”},{“name”:”telecentric-camera-objective-market.md”,”path”:”telecentric-camera-objective-market.md”,”contentType”:”file”},{“name”:”telecom-market.md”,”path”:”telecom-market.md”,”contentType”:”file”},{“name”:”temperature-control-cabinets-market.md”,”path”:”temperature-control-cabinets-market.md”,”contentType”:”file”},{“name”:”testing-inspection-and-certification-for-oil-gas-market.md”,”path”:”testing-inspection-and-certification-for-oil-gas-market.md”,”contentType”:”file”},{“name”:”testing-inspection-and-certification-tic-for-apparel-footwear-hand-bags-market.md”,”path”:”testing-inspection-and-certification-tic-for-apparel-footwear-hand-bags-market.md”,”contentType”:”file”},{“name”:”testing-inspection-and-certification-tic-for-metals-and-mining-market.md”,”path”:”testing-inspection-and-certification-tic-for-metals-and-mining-market.md”,”contentType”:”file”},{“name”:”textile-rubber-conveyor-belts-market.md”,”path”:”textile-rubber-conveyor-belts-market.md”,”contentType”:”file”},{“name”:”tft-lcd-photomask-market.md”,”path”:”tft-lcd-photomask-market.md”,”contentType”:”file”},{“name”:”thermoformed-shallow-market.md”,”path”:”thermoformed-shallow-market.md”,”contentType”:”file”},{“name”:”thin-film-transistor-liquid-crystal-display-market.md”,”path”:”thin-film-transistor-liquid-crystal-display-market.md”,”contentType”:”file”},{“name”:”thin-film-transistor-tft-market.md”,”path”:”thin-film-transistor-tft-market.md”,”contentType”:”file”},{“name”:”thread-locking-adhesive-market.md”,”path”:”thread-locking-adhesive-market.md”,”contentType”:”file”},{“name”:”three-piece-cans-market.md”,”path”:”three-piece-cans-market.md”,”contentType”:”file”},{“name”:”time-recorder-market.md”,”path”:”time-recorder-market.md”,”contentType”:”file”},{“name”:”tissue-paper-packaging-machines-market.md”,”path”:”tissue-paper-packaging-machines-market.md”,”contentType”:”file”},{“name”:”tourniquets-devices-market.md”,”path”:”tourniquets-devices-market.md”,”contentType”:”file”},{“name”:”transcranial-electrical-stimulators-market.md”,”path”:”transcranial-electrical-stimulators-market.md”,”contentType”:”file”},{“name”:”transfer-cabinets-market.md”,”path”:”transfer-cabinets-market.md”,”contentType”:”file”},{“name”:”trauma-fixation-devices-market.md”,”path”:”trauma-fixation-devices-market.md”,”contentType”:”file”},{“name”:”triphosgene-btc-market.md”,”path”:”triphosgene-btc-market.md”,”contentType”:”file”},{“name”:”tunnel-and-metro-market.md”,”path”:”tunnel-and-metro-market.md”,”contentType”:”file”},{“name”:”twelve-string-mandolin-market.md”,”path”:”twelve-string-mandolin-market.md”,”contentType”:”file”},{“name”:”ultra-high-strength-steel-market.md”,”path”:”ultra-high-strength-steel-market.md”,”contentType”:”file”},{“name”:”underwater-autonomous-vehicle-auv-market.md”,”path”:”underwater-autonomous-vehicle-auv-market.md”,”contentType”:”file”},{“name”:”upholstery-leather-for-automobiles-market.md”,”path”:”upholstery-leather-for-automobiles-market.md”,”contentType”:”file”},{“name”:”urinary-self-catheters-market.md”,”path”:”urinary-self-catheters-market.md”,”contentType”:”file”},{“name”:”uv-curable-resin-market.md”,”path”:”uv-curable-resin-market.md”,”contentType”:”file”},{“name”:”v2x-market-for-suv-market.md”,”path”:”v2x-market-for-suv-market.md”,”contentType”:”file”},{“name”:”variable-height-tripod-jack-market.md”,”path”:”variable-height-tripod-jack-market.md”,”contentType”:”file”},{“name”:”vehicle-to-device-v2d-communication-market.md”,”path”:”vehicle-to-device-v2d-communication-market.md”,”contentType”:”file”},{“name”:”veterinary-anthrax-vaccines-market.md”,”path”:”veterinary-anthrax-vaccines-market.md”,”contentType”:”file”},{“name”:”veterinary-medical-kits-market.md”,”path”:”veterinary-medical-kits-market.md”,”contentType”:”file”},{“name”:”vicatronic-apparatus-market.md”,”path”:”vicatronic-apparatus-market.md”,”contentType”:”file”},{“name”:”video-docking-system-market.md”,”path”:”video-docking-system-market.md”,”contentType”:”file”},{“name”:”vinegar-packaging-bottles-market.md”,”path”:”vinegar-packaging-bottles-market.md”,”contentType”:”file”},{“name”:”viscose-staple-fiber-for-apparel-market.md”,”path”:”viscose-staple-fiber-for-apparel-market.md”,”contentType”:”file”},{“name”:”wall-mount-humidity-controller-market.md”,”path”:”wall-mount-humidity-controller-market.md”,”contentType”:”file”},{“name”:”waterborne-polyester-resins-market.md”,”path”:”waterborne-polyester-resins-market.md”,”contentType”:”file”},{“name”:”waterproof-breathable-films-market.md”,”path”:”waterproof-breathable-films-market.md”,”contentType”:”file”},{“name”:”waterproof-fitness-trackers-market.md”,”path”:”waterproof-fitness-trackers-market.md”,”contentType”:”file”},{“name”:”wax-filled-pc-strand-market.md”,”path”:”wax-filled-pc-strand-market.md”,”contentType”:”file”},{“name”:”wear-resistant-printed-carpet-market.md”,”path”:”wear-resistant-printed-carpet-market.md”,”contentType”:”file”},{“name”:”wearable-medical-equipment-market.md”,”path”:”wearable-medical-equipment-market.md”,”contentType”:”file”},{“name”:”wheel-sports-protection-products-market.md”,”path”:”wheel-sports-protection-products-market.md”,”contentType”:”file”},{“name”:”wi-fi-based-smart-locks-market.md”,”path”:”wi-fi-based-smart-locks-market.md”,”contentType”:”file”},{“name”:”wi-fi-smart-sprinkler-control-system-market.md”,”path”:”wi-fi-smart-sprinkler-control-system-market.md”,”contentType”:”file”},{“name”:”wimax-networks-equipment-market.md”,”path”:”wimax-networks-equipment-market.md”,”contentType”:”file”},{“name”:”wire-wound-surface-mount-inductor-market.md”,”path”:”wire-wound-surface-mount-inductor-market.md”,”contentType”:”file”},{“name”:”wireless-printer-market.md”,”path”:”wireless-printer-market.md”,”contentType”:”file”},{“name”:”womens-moccasin-shoes-market.md”,”path”:”womens-moccasin-shoes-market.md”,”contentType”:”file”},{“name”:”woods-golf-shaft-market.md”,”path”:”woods-golf-shaft-market.md”,”contentType”:”file”}],”totalCount”:498}},”fileTreeProcessingTime”:25.885281,”foldersToFetch”:[],”reducedMotionEnabled”:null,”repo”:{“id”:714592644,”defaultBranch”:”main”,”name”:”Market-Research-Report-List-1″,”ownerLogin”:”GroverBarry”,”currentUserCanPush”:false,”isFork”:false,”isEmpty”:false,”createdAt”:”2023-11-05T10:30:13.000Z”,”ownerAvatar”:”https://avatars.githubusercontent.com/u/149185815?v=4″,”public”:true,”private”:false,”isOrgOwned”:false},”symbolsExpanded”:false,”treeExpanded”:true,”refInfo”:{“name”:”main”,”listCacheKey”:”v0:1699180214.0″,”canEdit”:false,”refType”:”branch”,”currentOid”:”5c1aeec12854a55b0da112eb989867534f04dfe9″},”path”:”irreversible-electroporation-ablators-market.md”,”currentUser”:null,”blob”:{“rawLines”:null,”stylingDirectives”:null,”csv”:null,”csvError”:null,”dependabotInfo”:{“showConfigurationBanner”:false,”configFilePath”:null,”networkDependabotPath”:”/GroverBarry/Market-Research-Report-List-1/network/updates”,”dismissConfigurationNoticePath”:”/settings/dismiss-notice/dependabot_configuration_notice”,”configurationNoticeDismissed”:null,”repoAlertsPath”:”/GroverBarry/Market-Research-Report-List-1/security/dependabot”,”repoSecurityAndAnalysisPath”:”/GroverBarry/Market-Research-Report-List-1/settings/security_analysis”,”repoOwnerIsOrg”:false,”currentUserCanAdminRepo”:false},”displayName”:”irreversible-electroporation-ablators-market.md”,”displayUrl”:”https://github.com/GroverBarry/Market-Research-Report-List-1/blob/main/irreversible-electroporation-ablators-market.md?raw=true”,”headerInfo”:{“blobSize”:”11.5 KB”,”deleteInfo”:{“deleteTooltip”:”You must be signed in to make or propose changes”},”editInfo”:{“editTooltip”:”You must be signed in to make or propose changes”},”ghDesktopPath”:”desktop.github.com”,”gitLfsPath”:null,”onBranch”:true,”shortPath”:”4f0d97a”,”siteNavLoginPath”:”/login?return_to=https%3A%2F%2Fgithub.com%2FGroverBarry%2FMarket-Research-Report-List-1%2Fblob%2Fmain%2Firreversible-electroporation-ablators-market.md”,”isCSV”:false,”isRichtext”:true,”toc”:[{“level”:1,”text”:”Irreversible Electroporation Ablators Market Size 2023 – 2030 Global Industrial Analysis, Key Geographical Regions, Market Share, Top Key Players, Product Types and Forecast Research Report”,”anchor”:”irreversible-electroporation-ablators-market-size-2023—2030-global-industrial-analysis-key-geographical-regions-market-share-top-key-players-product-types-and-forecast-research-report”,”htmlText”:”Irreversible Electroporation Ablators Market Size 2023 –…
Intro to Reproducible Publications with Quarto
This is a two day workshop on Monday – Tuesday, Dec 11-12, 2023 on a hands-on on project organization and scientific authoring with RStudioParticipants will build on using their R data analysis skills in RStudio by learning how to create quarto documents that combine code, analysis, and narrative. RStudio makes…
Advancing personalized medicine in brain cancer: exploring the role of mRNA vaccines | Journal of Translational Medicine
Personalized medicine aims to revolutionize healthcare by providing tailored treatments based on an individual’s unique characteristics. Genetic information of the host and target plays a crucial role in determining disease susceptibility and treatment response [1, 2]. By utilizing genomic analysis, biomarker identification, risk assessment, tailored treatment strategies, and continuous monitoring,…
Run PyTorch Docker Container on Ubuntu with Lambda Stack
Run PyTorch Docker Container on Ubuntu with Lambda Stack Introduction Installing Lambda Stack The One-Line Command Install Installing Nvidia Drivers Installing Deep Learning Libraries and Frameworks Keeping Libraries Up-to-Date Rebooting the System Installing Docker and Nvidia Container Toolkit Installing the Latest Version of Docker Installing the Nvidia Container Toolkit Checking…
How To Use Machine Learning In Python
Introduction Machine learning has revolutionized the way we approach problem-solving, data analysis, and decision-making. It is a branch of artificial intelligence that focuses on enabling computers to learn from data and improve their performance over time. With the growing availability of data and computing power, machine learning has become increasingly…
slurmctld.log not available after logrotate
Package: slurmctld Version: 22.05.8-4+deb12u1 Severity: normal Tags: patch X-Debbugs-Cc: alois.schlo…@gmail.com Dear Maintainer, After migrating the slurmctld from debian11/slurm20 to a host with debian12/slurm22, /var/log/slurm/slurmctld.log was rotated at midnight, to /var/log/slurm/slurmctld.log.1.gz but no /var/log/slurm/slurmctld.log was generated. syslog of logrotate showed this log message: 2023-11-17T00:00:01.825407+01:00 l74 logrotate[3441040]:…
How to correct the position of my primers
I have been having issue getting my primers to match the expected output. For instance the bases of the first primer starting on the left are off by 4 base pairs to the right of the correct position. This is what I am suppose to get: ttggcagttgggaccgttta This is what…
Using Primer3 with python to genotype a SNP at a particular position
I’m trying to figure out how to genotype an SNP at a particular position. Honestly I’m not sure what that means, but here are the instructions: “The idea is that the user wants to genotype a SNP at a particular position. To do this they will need to amplify a…
Remote Senior Cloud Operations Engineer Job at Linux Foundation
Company Description The Linux Foundation is a driving force in fostering open-source collaboration and supporting communities across a range of projects, including PyTorch. We’re dedicated to enhancing and expanding our infrastructure to meet the growing demands of PyTorch and related AI projects. We are seeking a Senior Cloud Operations Engineer…
Impact of N221S missense mutation in human ribonucleotide reductase small subunit b on mitochondrial DNA depletion syndrome
hRRM2B mutagenesis study The fatal consequences of N221S mutation7 led to a thorough investigation of the impacts of N221 side chain, a conserved residue in RNR small subunit. Site-directed mutagenesis studies involving six N221 constructs were performed to elucidate the molecular mechanism of N221S related MDDS. The mutations were designed…
Use WSL as terminal in RStudio desktop on Windows
On a Windows machine, I have WSL2 installed and working. I believe I can use the WSL2 shell as my terminal in RStudio desktop (note, I am not trying to run RStudio in WSL2, at least not yet). However, although I have seen screenshots where WSL bash appears as an…
Is Breast Implant Linked to Lymphoma Risk
Breast implants are medical devices used to increase the size, shape, or fullness of a woman’s breasts. Lymphoma is a type of cancer that begins in the lymphatic system. While there have been some reports of a potential association between breast implants and lymphoma, research has not established a definitive…
Chst9 Marks a Spatially and Transcriptionally Unique Population of Oprm1 -Expressing Neurons in the Nucleus Accumbens
Abstract Opioids produce addictive, analgesic, and euphoric effects via actions at mu opioid receptors (μORs). The μOR is encoded by the Oprm1 gene and is expressed in multiple brain regions that regulate reward and motivation, such as the nucleus accumbens (NAc). Oprm1 expression in NAc medium spiny neurons (MSNs) mediates…
132arm64-default][science/votca] Failed for votca-2022.1_1 in build
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/ampere3/data/132arm64-default/d5268d5f7157/logs/votca-2022.1_1.log Build URL: pkg-status.freebsd.org/ampere3/build.html?mastername=132arm64-default&build=d5268d5f7157 Log: =>> Building science/votca build started at Fri Nov 10…
[slurm-users] REST-based CLI tools out there somewhere?
Chip Seraphine writes: > Hello, > > Our users submit their jobs from shared submit hosts, and have > expressed an understandable preference for being able to submit > directly from their own workstations. The obvious solution > (installing the slurm client on their workstations, or providing a > container that does something similar) are not…
St. Jude Children’s Research Hospital hiring Senior Bioinformatics Analyst/Bioinformatics Analyst in Memphis, Tennessee, United States
St. Jude Children’s Research Hospital is looking for a highly motivated Senior Bioinformatics Analyst/Bioinformatic Analyst to contribute to genetic research projects in the Department of Epidemiology and Cancer Control. Our research leverages comprehensive biomedical data from childhood cancer survivors participating in two world-leading cohort studies, CCSS (ccss.stjude.org/ ) and SJLIFE…
Deploying Magic Castle (virtual slurm cluster)
Magic Castle, developed by the Digital Research Alliance of Canada (formerly Compute Canada), is a terraform template to deploy a virtual slurm cluster. This template has been adapted to launch easily in CACAO. Pre-requisites You will need to setup the following before you deploy any cloud resource using CACAO: Jetstream…
How to use the Duet AI coding assistant to build your next app
If you would like a little helping hand when coding your very first app or next generation phone or web application. You might be interested to know that Google’s Duet AI can help you. By providing coding assistance during the creation process and can be integrated into your favorite IDE….
Sports Nutrition: India All Set To Pip Us As Largest Developer Base On Github By 2027 | Bengaluru News
Bengaluru: Microsoft owned code-hosting platform GitHub has added 3.5 million Indian developers taking the total tally to 13.2 million in 2023. India is one of the fastest-growing developer communities globally showing a significant jump from 9.7 million developers on the Github platform last year.With 13.2 million developers, India is expected…
EMDB < Search results
Field: Choose…EMDB IDTitleAuthorORCIDEM methodCurrent statusDeposition dateRelease dateDeposition siteLast processing siteFitted modelsRaw dataResolutionResolution methodSoftwareLigand nameComplex nameDomain nameDrug nameGO term nameInterPro term nameChEBI term nameExternal reference Publication titlePublication yearJournalPublication author Sample typeSample nameOrganismOrganism (NCBI code)StrainOrganTissueCellOrganelleCellular LocationE.C. numberMolecular Weight methodMolecular Weight (Da)Recombinant ExpressionRecombinant organismRecombinant organism (NCBI code)Recombinant strainRecombinant expression cellRecombinant expression plasmidDNA/RNA classificationDNA/RNA…
PyTorch Model to detect Pneumonia using Snowpark Container Service and Snowflake ML Features | by Karuna Nadadur | Snowflake | Nov, 2023
Author : Karuna Nadadur Co Author : Murali Gandhirajan Healthcare Delivery is undergoing rapid changes and evolution as health systems and clinics adopt digital technologies to effectively serve patients. As digital technologies get widely deployed in the patient care delivery ecosystem, it generates vast amounts of patient data. Most of…
unicode error when calling windows terminal from RStudio but not R
I have an .exe that’s meant to be called from the terminal/command line, and I want to use R to generate the program calls, iterate over different arguments, measure timings, capture output, and so forth. The executable is whisper-standalone-win. From windows command line (cmd.exe), after cd‘ing to the executable, we…
[slurm-users] Unable to submit job (ReqNodeNotAvail, UnavailableNodes)
Hi there, First of all, apologies for the rather verbose email. Newbie here, wanting to set up a minimal slurm cluster on Debian 12. I installed slurm-wlm (22.05.8) on the head node and slurmd (also 22.05.8) on the compute node via apt. I have one head, one compute node, and…
Bug#1055414: bedtools: FTBFS on i386: “intersect” tool failure
Source: bedtools Version: 2.31.0+dfsg-1 Severity: serious Tags: ftbfs Justification: ftbfs Dear Maintainer, While making a routine metadata update on a Debian patch against bedtools, Salsa CI caught a build failure on i386[1] which I could reproduce multiple times in sid and in testing with the unmodified version of the package. [1]: salsa.debian.org/med-team/bedtools/-/jobs/4891166 The…
University of Minnesota Medical School hiring Postdoctoral Associate in Bioinformatics and Computational Biology in Minneapolis, MN
Required Qualifications: • A PhD degree in related field (Bioinformatics, Computer Science, Statistics, etc.) • Strong quantitative data analysis background (machine learning, biostatistics, etc.) and/or computational genomics/genetics experiences (spatial transcriptomics, single-cell sequencing, high-throughput omics sequencing data analysis, TWAS/GWAS, etc.) or other relevant areas. • Strong programming skills: (e.g., R, Python,…
Integrating langchain4j and PaLM 2 Chat Bison Model | by Romin Irani | Google Cloud – Community | Nov, 2023
One of my repositories that has seen good traction is the Google Cloud GenAI Application templates. These are a set of application templates that use Google Cloud services (Cloud Functions , Cloud Run) to interact with Google Cloud Vertex AI models like Text Bison, Chat Bison and more. There are…
The Singh Lab – Junior/Assistant/Associate/Full Specialist in Bioinformatics or Computational Biology job in San Francisco, California at University of California – San Francisco
The Singh Lab – Junior/Assistant/Associate/Full Specialist in Bioinformatics or Computational Biology SCHOOL OF MEDICINE – Department of Anatomy Description The lab of Dr. Param Singh at UCSF (www.singhlabucsf.org) is looking for a Junior/Assistant/Associate/Full Specialist with expertise in bioinformatics or computational biology to join our team and contribute to new and…
sequence alignment – I can’t make mafft run inside my program
This is easy because MAFFT is installed via Conda, but you have not activated that Conda environment, thus it will not give you access to the program. If you type … conda activate labinf mafft This will now work. To activate this inside a shell script you simply include the…
OpenAPI spec checker | Freelancer
Develop a TypeScript utility that checks OpenAPI spec files (yaml or json), and generates findings about how the spec is written, such as security schemas, complex models, usage of operationIds and tags, etc. Please take a good look at ChatGPT’s spec in [login to view URL] , and tell me…
Ask your documents anything w/ Vertex AI Search | by happtiq | Nov, 2023
In case you also want to implement that powerful logic into your already existing web application, then this bonus section might also be of interest to you. In our scenario, we’re building upon a sample web app provided by Google’s developer advocates. Feel free to adapt it to your own…
140releng-armv7-default][misc/py-pytorch] Failed for py39-pytorch-2.0.1 in configure
You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: pkg-status.freebsd.org/ampere3/data/140releng-armv7-default/08943441f26e/logs/py39-pytorch-2.0.1.log Build URL: pkg-status.freebsd.org/ampere3/build.html?mastername=140releng-armv7-default&build=08943441f26e Log: =>> Building misc/py-pytorch build started at Thu Nov 2…
RStudio Guide | The GitLab Handbook
RStudio Guide {:toc .toc-list-icons .hidden-md .hidden-lg} {::options parse_block_html=“true” /} What is R? Similar to Python, R is an open-source statistical software that is used to clean and analyze data. It is popular within the data science community and has many packages that make statistical modeling easier for statisticians and data…
Create Custom Multimodal AI Apps Easily
Create Custom Multimodal AI Apps Easily Table of Contents: Introduction Building a Custom Multimodal AI Application using Google Cloud’s AI suite 2.1 Setting up the Environment 2.2 Crafting the Custom Web Application 2.3 Powering the System with Python Code 2.4 Utilizing the Flask Web Application Framework Incorporating the Multimodal Embeddings…
Snakemake issue with wrappers
I have issues when running a wrapper of BWA mem with Snakemake. The error message “No module named ‘snakemake_wrapper_utils’” appear (see below). However, when checking if the package is installed in Python, I found the following: import snakemake_wrapper_utils print(snakemake_wrapper_utils.__version__) 0.1.0 Did anyone have this problem? Would you know why there…
Using Google Duet AI coding assistant to speed up development
If you are looking to improve your coding or development workflow you may be interested in a new artificial intelligent coding assistant created by Google. Duet AI is a chat interface that provides answers to cloud-related queries and offers guidance on best practices. It is specifically trained on Google Cloud…
Calcasieu Pass LNG granted modified Phase 3 in-service plan
Venture Global LNG Inc. has been granted authorization by the US Federal Energy Regulatory Commission (FERC) to place Blocks 7-9 of its 10-million tonne/year (tpy) Calcasieu Pass LNG plant in service, using a modified commissioning plan that will allow individual systems or equipment to be placed in service as ready (OGJ…
EMDB < EMD-40454
Field: Choose…EMDB IDTitleAuthorORCIDEM methodCurrent statusDeposition dateRelease dateDeposition siteLast processing siteFitted modelsRaw dataResolutionResolution methodSoftwareLigand nameComplex nameDomain nameDrug nameGO term nameInterPro term nameChEBI term nameExternal reference Publication titlePublication yearJournalPublication author Sample typeSample nameOrganismOrganism (NCBI code)StrainOrganTissueCellOrganelleCellular LocationE.C. numberMolecular Weight methodMolecular Weight (Da)Recombinant ExpressionRecombinant organismRecombinant organism (NCBI code)Recombinant strainRecombinant expression cellRecombinant expression plasmidDNA/RNA classificationDNA/RNA…