Tag: VEP

Anamnesis vitae A 13 year old male born was as result of the VII pregnancy, from unrelated parents. Other pregnancies resulted in: I-II silent miscarriage in the second trimester; III – female, born in 2003 (III-3 Fig. 1) that has the following phenotypic features: genu valgum, hip dysplasia, combined thoracolumbar scoliosis,…

Annotate variants with ensembl rest api 0 I have a variant file (.vcf.gz), and I want to annotate this file using the Ensembl Rest API, particularly the Vep Rest API. I am new to this variant annotation; however, I have seen a couple of codes from the Ensembl page on…

Company DescriptionGenomics England partners with the NHS to provide whole genome sequencing diagnostics. We also equip researchers to find the causes of disease and develop new treatments – with patients and participants at the heart of it all. Our mission is to continue refining, scaling, and evolving our ability to…

Company Description Genomics England partners with the NHS to provide whole genome sequencing diagnostics. We also equip researchers to find the causes of disease and develop new treatments – with patients and participants at the heart of it all. Our mission is to continue refining, scaling, and evolving our…

Does GNOMAD use all LOFTEE LoF filters? 0 Hi all, I have some lof variants and I want to know if they have already been detected in GNOMAD (I am essentially curious if my lof variants are novel). In order to make this comparison to GNOMAD I have run my…

Intradermal delivery of DNA vaccines via electroporation (ID-EP) has shown clinical promise, but the use of needle electrodes is typically required to achieve consistent results. Here, delivery of a DNA vaccine targeting the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is achieved using noninvasive intradermal vacuum-EP (ID-VEP), which functions by pulling…

Loftee no splice site annotations 1 Hello! I am using Loftee in my VEP pipeline and after some fights with my code everything works now, but the splice site annotations…meaning that I dont get them. There is no error at all, but my vcf files do not contain a single…

3.1. Atypical Morphology of Protein Bodies in the Endosperm of Seeds from Glutelin Gene-Edited Transgenic Rice ER-derived PB-I vacuoles begin to form in response to the aggregation of β-/γ-zeins (maize) and 10-kDa prolamins (rice) and then expand by co-aggregation of α-/δ-zeins (maize) and 13-/16-kDa prolamins (rice) [3,22,23]. Saito’s group reported…

[maftools]Too many multi_hit and missense mutation 0 Describe the issue When using maftools to plot mutational summary data, I encountered some issues: I use WES data to generate a filtered VCF file, and then utilize VEP for annotation to obtain an MAF file. The MAF file contains an excessive number…

AlphaMissense_hg38.tsv.gz tabix indexing issue VEP 1 Hi! I’m experiencing the issue with the tabix indexing of AlphaMissense_hg38.tsv.gz file. I’ve installed alphamissense plugin in VEP and have downloaded the requested files and launch the tabix command before use it. The error tells me that it can not be indexed directly because…

Appropriate genome reference for converting TCGA VCF files to MAF 0 I have a directory of MAF files obtained from TCGA and I want to convert it to VCF format. Reference: GRCh38.d1.vd1 Reference Sequence Source: gdc.cancer.gov/about-data/gdc-data-processing/gdc-reference-files maf2vcf.pl –input-maf maf/* –output-dir VCF -ref-fasta /home/melchua/.vep/homo_sapiens/GRCh38/GRCh38.d1.vd1.fa.tar.gz Traceback: Use of uninitialized value $lines in…

Identification of CH cases from WGS in ISL and UKB We used WGS from 45,510 Icelanders and 130,709 British ancestry participants from the UKB17,18. Average sequencing depth was 33× for UKB and 38× for ISL. Participants with prior diagnoses of hematological disorders or grossly abnormal hematology measurements on entry were…

In VEP annotation, how is the codon field interpreted? 0 After annotating with VEP a VCF file, we obtain different fields. One of them is called Codons which represents the affected codon in the transcript of the gene. Below is a screenshot of Insertions from a sample: HGVSp_Short RefSeq Codons…

I have a vcf file that I annoteted with VEP, for human data. I have run VEP to annotate my files with some additional parameters (as shown below in the ##VEP-command-line). However, my output is rather strange (mainly the INFO column). ##VEP=”v108″ time=”2023-04-27 15:13:08″ cache=”workflow/resources/variants/cache_vep/homo_sapiens/108_GRCh38″ ensembl-funcgen=108.56bb136 ensembl-variation=108.a885ada ensembl-io=108.58d13c1 ensembl=108.d8a9c80 1000genomes=”phase3″…

How to make 4-column annotation file 1 Hi everyone, I’ve been following regenie to perform analyses. In its 2nd step a 4-column annotation file is needed. The format is 1:55039839:T:C PCSK9 LoF 1:55039842:G:A PCSK9 missense According to snpEFF documentation, its output is in vcf format, which I think might be…

Locally annotating SNP IDs and Gene names of called variants 0 I have GWAS results after variant calling. The VCF file only had CHR (1:22) and POS (12345678 etc) information but the ID column has all “.”, namely no rsIDs in it. After GWAS analysis I have a list of…

Issues with FilterRNAMutationsNoPoN in RNA-Mutect Workflow for Tumour Mutational Burden Estimation 0 Hello community, I am currently working on estimating tumour mutational burden using the RNA-Mutect-WMN pipeline. The process requires an output from RNA-Mutect, which in turn needs the output of Mutect2. I have proceeded with the following steps: Acquired…

Ensembl’s POST “vep/:species/region”: multiple alternate alleles for a single variant in R 1 I am working with this POST request from Ensembl. Let us suppose, as a starting example, that we have the following variant (in the form of a R code snippet): { “variants” : [“21 26960070 26960070 G…

PASAPASA was originally developed at The Institute for Genomic Research in 2002 as an effort to automatically improve gene structures in Arabidopsis thaliana. Since then, it has been applied to numerous Eukaryotic genome annotation projects including Rice, Aspergillus species, Plasmodium falciparum, Schistosoma mansoni, Aedes aegypti, mouse, human, among others. Functions of PASA…

Tutorial:NGS one-liner to call variants 0 This is a tutorial about creating a pipeline for sequence analysis in a single line. It is made for capture/amplicon short read sequencing in mind for human DNA and tested with reference exome sequencing data described here. I share the process and debuging steps…

Tutorial:NGS oneliner 0 This is a tutorial about creating a pipeline for sequence analysis in a single line.I share the process and debuging steps gone through while putting it together.Source is available at: github.com/barslmn/ngsoneliner/I couldn’t make a longer post, complete version of this post: omics.sbs/blog/NGSoneliner/NGSoneliner.html Pipeline # fastp –in1 “$R1″…

VEP ensemble docker and plugins 0 Hi, I have used VEP in local using docker and cache and ran this command sudo docker run \ -v /mnt/dodl_drive/sarek_cc/vep:/data ensemblorg/ensembl-vep \ vep -i input_sample.vcf \ –cache \ –output_file output_sample.vcf \ –everything which ran successfully and the output VCF also is as expected….

Simulated patient initialization We simulate patients for each of the 2134 diseases in Orphanet20 (orphadata.org, accessed October 29, 2019) that do not correspond to a group of clinically heterogeneous disorders (i.e., Orphanet’s “Category” classification31), have at least one associated phenotype, and have at least one causal gene. For Orphanet diseases…

Position: Bioinformatics Data Analyst Company: GenomicStar – A SaaS based Precision Medicine Platform Job Purpose: The Bioinformatics Data Analyst will play a critical role in the development, validation, and implementation of data analysis pipelines for various genetic test panels, incorporating state-of-the-art AI techniques. This role is integral to our commitment…

AlphaMissense Plugin VEP 0 I’ve installed alphamissense plugin in VEP, but I can’t use it. I’ve downloaded the requested files and launch the tabix command before use it. Then I’ve launched the command but I got this error: WARNING: Failed to instantiate plugin AlphaMissense: ERROR: No file specified Try using…

Issue VEP installation MacOS 0 Hi, I’m trying to install VEP on Mac. I’ve tried on the Anaconda Navigator, but I couldn’t install. I also tried through the terminal, but also in this way I can’t install. The last error that I’ve got is: User cram/cram_io.c:61:10: fatal error: ‘lzma.h’ file…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, Shred, and was edited by…

Filtering VCF to divide with equal sizes 1 Hello everyone! I have a very large VCF file (>400gb), and I want to divide it to use with VEP. VEP recommends separating the vcf, so I generated a list of contigs, based on the header, with 3^7 bases for each chromosome….

Credit: iStock/agsandrew A new, freely available AI catalog has classified the potential effects of millions of missense genetic mutations, which could help establish the cause of diseases such as cystic fibrosis, sickle-cell anemia, and cancer. The AlphaMissense resource from Google DeepMind categorized 89% of all 71 million possible missense variants….

About the team/job Recent advances in technology and analysis have revealed significant opportunities to further our understanding of the diversity and impact of human genetics (such as the first full length telomere-to-telomere human genome and the first release of the human pangenome). As a result, we are excited to launch…

Hi Chris, Thanks for the quick reply. I am getting used to eccentricities and the mentality of “right tool for right job”. BCF is highly optimized but the file floats which ends up taking entire space. My 2TiB dataset ended up taking 4.3 TiB in bcf file format while the…

Introduction nf-core/sarek is a workflow designed to detect variants on whole genome or targeted sequencing data. Initially designed for Human, and Mouse, it can work on any species with a reference genome. Sarek can also handle tumour / normal pairs and could include additional relapses. The pipeline is built using…

Hello everyone! I searched the forum but coundn`t find a question that is like mine I have a multisample annotated VCF file (with dbNSFP plugin) to which I have filtered using VEP, like so: /scratch/ensembl-vep-109/ensembl-vep/filter_vep –force_overwrite –input_file {1} –output_file /home/filtering/2/2_{1/.}.vcf –only_matched –filter “(clinvar_clnsig is Pathogenic) or (clinvar_clnsig is Likely_pathogenic) After…

Finding Unique values on specific INFO field of the VCF file 0 Hello everyone! I searched the forum but coundn`t find a question that is like mine I have a VCF file to which I have filtered using VEP, like so: /scratch/ensembl-vep-109/ensembl-vep/filter_vep –force_overwrite –input_file {1} –output_file /home/filtering/2/2_{1/.}.vcf –only_matched –filter “(clinvar_clnsig…

Ann.vcf format 0 Hello everyone! I used a pipeline named Sarek to run my WES data. The pipeline used two programs to annotate VEP and SnpEff and give to me an ann.vcf file. I don’t know how to use or open this file in excel for do the filters and…

Installing ensemble VEP by running INSTALL.pl takes too long. 0 How long does it usually take to install ensemble VEP with INSTALL.pl? I am running INSTALL.pl and I think it’s taking too long. I am trying to install ensemble VEP with this code: git clone github.com/Ensembl/ensembl-vep.git cd ensembl-vep perl INSTALL.pl…

Can I annotate a 32GB vcf file containing 300 samples at once using ANNOVAR? 1 I have a 32 GB VCF file containing 300 samples. I also have access to a cluster computing system. Do you recommend annotating this large file all at once, or splitting it to two files…

I’m analyzing the WES data of a patient, after calling variants by GATK, I use Ensembl Variant Effect Predictor (VEP) to annotate my vcf file. Here is one record from the output file: #Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra chr11_64341844_GTTGTGGTCTGAGGTCTTGGGCCATCAGTGATGTCACAACCAGATGGCCCAAGACCCCAGACCACAACCCCATGTCTGGT/- chr11:64341844-64341923- ENSG00000278359…

Offline Usage of the Go Plugin 1 I’m using Veb in offline mode. I want to add the GO terms. From what I’ve read, it seems like I need the ‘–database’ connection. But isn’t there another way to run the GO plugin offline? ensembl veb go-terms • 229 views •…

Is there any method for using WES data from Illumina Hiseq into ABSOLUTE? 2 Hey namhaesly, You need to create segmentation files for your data. You can use VarScan2 (the copynumber) function, or any other program that computes copy number information. My tool of choice is ExomeCNV though I don’t…

This study did not require any ethical approval. ESM1b In this study, we have leveraged and expanded the use of ESM1b, a protein language model developed by MetaAI20. The code and pretrained parameters for ESM1b (and other ESM models) were taken from the model’s official GitHub repository at github.com/facebookresearch/esm. Throughout…

VEP run with –af_gnomadg refuses to provide allele frequencies for extremely rare variants 0 Here are some examples. Now, I will grant you these are all extremely rare but not unknown. HGVSg gnomADg_AF actual chr20:g.63400308G>A 1.97088e-05 chr20:g.63400728C>A 1.31465e-05 chr20:g.63401127G>A 6.57263e-06 chr20:g.63402766G>A 2.6276e-05 chr20:g.63402967G>A 6.57082e-06 chr20:g.63403148G>A 1.97114e-05 chr20:g.63403351C>T 6.56927e-06 chr20:g.63403638G>A 1.31524e-05…

Problems when trying to use ensembl-vep 0 Hi. I’ve been using ensembl-vep through Docker before and managed to use it, but now I’m encountering difficulties.I’m running the commands as instructed in the ensembl-vep page.After running the commands docker pull ensemblorg/ensembl-vep and mkdir $HOME/vep_data I run docker run -t -i -v…

Biomart doesnt work in R for big input data. How to run it in Python ? 0 I am trying to use Biomart for a list of variants (with rs ids) to retrieve the consequence_types for each variant but as because my file is too big (80621 entries) i am…

Are there any ways to delete multiple jobs at Ensembl VEP? 0 I have looked at the VEP documentation regarding deleting the job. “You may delete a job by clicking the trash can icon”. This I have to delete one by one and I have lots of jobs to delete…

Hi, I am trying to understand these Manta somatic variant VCFs that I have annotated with VEP. chr10 11974892 MantaBND:6118:0:1:0:0:0:0 G ]chr1:41850074]G . PASS SVTYPE=BND;MATEID=MantaBND:6118:0:1:0:0:0:1;CIPOS=0,2;HOMLEN=2;HOMSEQ=AG;SOMATIC;SOMATICSCORE=54;BND_DEPTH=62;MATE_BND_DEPTH=0;CHR2=chr1;ENDPOSSV=41850074;SVLEN=0;RO=-+;TRA;LENSV=-1;RGENUPS=ENSCAFG00000045430___None,-9947,+;RGENISEC=ENSCAFG00000000435___BEST3,0,-;RGENDNS=ENSCAFG00000000436___RAB3IP,59491,+;LGENUPS=ENSCAFG00000000405___PLEKHG1,-146330,+;LGENISEC=ENSCAFG00000000413___MTHFD1L,0,+;LGENDNS=ENSCAFG00000000419___AKAP12,173336,+;CSQ=]chr1:41850074]G|feature_truncation|HIGH|MTHFD1L|MTHFD1L_3|Transcript|XM_038526323.1|mRNA||||||||||||1||||Canis_familiaris.UU_Cfam_GSD_1.0.gtf.gz|,]chr1:41850074]G|feature_truncation&intron_variant|HIGH|BEST3|BEST3_2|Transcript|XM_038549568.1|mRNA||4/5||||||||||-1||||Canis_familiaris.UU_Cfam_GSD_1.0.gtf.gz| PR:SR:RDISTDISC1:RDISTDISC2:RCDIS1:RCDIS2:RUT1:RUT2:DRNOISE1:DRNOISE2:CLMQ1:CLMQ2:EVALRCNOISE 7,0:25,0:0:0:0:0:1:1:0,0,0,0,0,0:0,0,0,0,0,0:0,0,186:0,0,2:1,1 9,0:29,16:0:0:0:0:1:1:0,0,0,0,3,3:0,0,0,0,15,15:0,0,487:0,0,41:0,0 I have consulted the manual github.com/Illumina/manta/blob/master/docs/userGuide/README.md#vcf-info-fields but cannot seem to find information regarding these fields; “RGENISEC” ,”RGENDNS”, “LGENUPS”,”LGENISEC”. Additionally I see “RGENUPS”…

Utilizing PON-P2 for vcf annotation 0 I have done a lot of investigation into both the VEP plugin and the standalone api script provided for PON-P2, and I am beginning to suspect that the server is no longer functional. Has anybody used it recently or is able to confirm the…

Closer collaborations with EMBL-EBI data resources set to further develop and grow this unique rare disease platform DECIPHER database for rare diseases joins EMBL-EBI. Credit: Karen Arnott/EMBL-EBI The DECIPHER website and database, which are used globally by researchers and clinicians to interpret and share phenotypic and genotypic data from rare…

SnpSift empty result 0 Hello, I need some help with SnpSift and fitler option. I am trying to run different filters but in every case the output is empty. No warnings, of fail run. all the works are completed and the .log file does not show errors. However, the .vcf…

VEP: Generation of polyphen2 & SFT scores for structural variants. 0 Hello, has anybody generated polyphen 2 scores for structural variants reported by Manta using VEP. I have ran VEP but do not have any scores reported and there is no error in my out put report. Of note I…

Why does Ensembl VEP provide HGVSg for some variants and not others? 0 docker run \ -u 1000:1000 \ -v $HOME/vep_data:/data \ -v $HOME/vep_data:/.vep \ -v $PWD:/opt/foo ensemblorg/ensembl-vep \ vep \ -i /opt/foo/{input} \ -o /opt/foo/{output} \ –cache \ –force_overwrite \ –fork {threads} \ –format vcf \ –buffer_size 5000 \…

VCF file CSQ flag 0 Hello, I am new to exome sequencing. I ran GATK4 and have a g.VCF file. I used VEP to annotate the gVCF file. I have a couple of questions. I noticed not all the rows(variants) have the CSQ flag. Is that normal? Or I missed…

variant allelic fraction 0 Hello, I have a question, how can I find the variant allelic fraction from VEP file? thanks in advanced vep • 289 views • link updated 2 hours ago by Ram 39k • written 1 day ago by Jom • 0 Login before adding your answer….

VEP tab/vcf – Different output 1 Hello, I am using VEP to annotate a VCF file. I am generating tab and vcf output. However, when looking at the tab output, I find mutations, that are not present in the vcf output (and also not in the input vcf file). Those…

Study design and participants The GCKD study is an ongoing prospective observational study that enrolled 5,217 adult persons with CKD between 2010 and 2012. Patients regularly seen by nephrologists with eGFR between 30 and 60 ml min−1 per 1.73 m2 or eGFR >60 ml min−1 per 1.73 m2 with UACR > 300 mg per g (or urinary protein/creatinine ratio > 500 mg…

What does canonical transcript mean in the context of VEP 1 Just looking at this documentation: useast.ensembl.org/info/docs/tools/vep/script/vep_options.html and seeing: –canonical Adds a flag indicating if the transcript is the canonical transcript for the gene. Not used by default Does anyone know what this means? Does that mean the fully functional…

I am finding difficulty finding the exact assembly version (e.g. patch version) of GRCh38 used for major databases. For instance, gnomad says “GRCh38”. But the only information on the version, for v3.1 comes from here, which says it “uses an updated version of Variant Effect Predictor (VEP) based on the…

I am trying to run MutSIgCV and got stuck with this error: MutSigCV allsamples.md.tc.ir.br.pr.ug.dbsnp.vep.maf \ “$anno”exome_full192.coverage.txt \ “$anno”gene.covariates.txt \ my_results \ “$anno”mutation_type_dictionary_file.txt \ “$anno”chr_files_hg19 ====================================== MutSigCV v1.4 (c) Mike Lawrence and Gaddy Getz Broad Institute of MIT and Harvard ====================================== MutSigCV: PREPROCESS ——————– Loading mutation_file… Error using MutSigCV>MutSig_preprocess (line 246)…

Hi all! I annotated a VCF file using VEP and noticed that it reports several variant IDs to each input variant. For example, this is an excerpt of one of the variant lines (I removed the annotation info that is not relevant to the question): 12 25398284 . C A…

The UKB is approved by the North West Multi-centre Research Ethics Committee (www.ukbiobank.ac.uk/learn-more-about-uk-biobank/about-us/ethics). The current study was conducted under UKB application no. 26041. The data in the UKB were collected after written informed consent was obtained from all participants. The Human Research Committee of the MGB approved the Biobank research…

VCF file will be having seven fixed columns and INFO column. Chromosome, position, ID, ref, alt, qual, filter, and INFO column. This INFO column will be having the variant related information. In the INFO column CSQ field will be having multiple fields – 82 fields fixed with the delimeter “|”…

I am trying to reproduce an analysis result, and there is a requirement regarding the format of the result: the ‘3’ rule ‘: all mutations should be expressed in a position close to the end of the gene transcription direction (3’ end). The result I obtained is(annotate from VEP) Chromosome…

Newest ‘vep’ Questions – Stack Overflow …

Dear Biostars, I am having a confusing issue with my CADD plugin. This is confusing because when I run VEP for my whole trio – all the plugins work fine. However when I try to run CADD for individual – pivoted files – it no longer does and I get…

You can check out these services: * myvariant.info/v1/api#/ * api.ncbi.nlm.nih.gov/variation/v0/ * rest.ensembl.org/#VEP As far as I know they all return JSON. You can check out a tool like jq or a package in your fav language to parse JSON. **Example:** curl -s ‘rest.ensembl.org/vep/human/id/rs2656176?’ -H ‘Content-type:application/json’ | jq ‘.[].colocated_variants[].frequencies’ { “A”:…

We are seeking a bioinformatician with significant oncology or immunology experience to join a multidisciplinary team developing leading-edge genomics analysis tools to understand the immune system’s response to cancer. This highly motivated, detail-oriented individual would join a clinical genomics analysis group and will be responsible for developing and applying bioinformatics…

ARG-Needle and ASMC-clust algorithms We introduce two algorithms to construct the ARG of a set of samples, called ARG-Needle and ASMC-clust. Both approaches leverage output from the ASMC algorithm11, which takes as input a pair of genotyping array or sequencing samples and outputs a posterior distribution of the TMRCA across…

I am trying to install PhyloCSF: github.com/mlin/PhyloCSF Since it is needed for new VEP99. In order to do that I needed to install ocaml, bubblewrap, opam. Second bullet point: opam install batteries ocaml+twt gsl Did not work, but I found that this one works: opam install ocaml-twt As can be…

How to install VEP plugins in conda environment 1 I installed VEP through miniconda and use VEP through my conda environment. I would like to install VEP plugins (ex, CADD), but I do not have the INSTALL.pl script VEP instructs to use to install plugins (I think this is because…

Haploview Error 0 I would like to request for help for the following. When I am giving input of ped and info file generated from plink into haploview. I am getting an error. “File does not any zero valid indiviuals” I am thankful in advance plink Haploview vep • 36…

adding transcripts ID to the REVEL score 0 I am annotating variants for clinical diagnosis. One of the data required by my team is REVEL. We work with specific transcripts so when clinicians do variant interpretation, they need to check if our preferred transcript is among the transcripts considered. REVEL…

VEP tool 0 I am using VEP tool for variant annotation, I ran the VEP command : ./vep -i sample.vcf -o out.txt –offline but it shows the following error : ——————– EXCEPTION ——————– MSG: ERROR: Cache directory /home/shweta/.vep/homo_sapiens not found STACK Bio::EnsEMBL::VEP::CacheDir::dir /home/shweta/ensembl-vep/modules/Bio/EnsEMBL/VEP/CacheDir.pm:305 STACK Bio::EnsEMBL::VEP::CacheDir::init /home/shweta/ensembl-vep/modules/Bio/EnsEMBL/VEP/CacheDir.pm:219 STACK Bio::EnsEMBL::VEP::CacheDir::new /home/shweta/ensembl-vep/modules/Bio/EnsEMBL/VEP/CacheDir.pm:111 STACK…

Mehari is a software package for annotating VCF files with variant effect/consequence. The program uses hgvs-rs for projecting genomic variants to transcripts and proteins and thus has high prediction quality. Other popular tools offering variant effect/consequence prediction include: Mehari offers predictions that aim to mirror VariantValidator, the gold standard for…

Hi, I’ve been asked to semi automate (as far as full automation of the process seems to be impossible) the ACMG annotations of WGS data for our clinicians. What are the options here? I’ve checked several: varsome (paid full access, closed code) InterVar (seems nice, but works only with annovar,…

What does the decimal ending of a transcript id mean? 1 When working with alternative transcripts, I see a decimal ending to the transcript id. What does the decimal value add to the transcript meaning? For example, a mutation, BRAF p.V600M is annotated by VEP with: csn=”ENST00000479537.1:c.82G>A_p.Val28Met” hgvsc=”ENST00000479537.1:c.82G>A” transcript_id=”ENST00000479537″ &…

VCF file generated by Gridss not recognised by VEP 0 Hello, Currently, I am engaged in analyzing genomic Next-Generation Sequencing (NGS) data as a part of my professional activities. Specifically, I am attempting to integrate the Gridss tool into my workflow for the purpose of variant calling (indels). Unfortunately, I…

Easy way to split VCF file by chromosome 2 Hi, Im trying to submit a job on the TOPMED/Michigan imputation server, but it returns an error saying that I need to split my VCF by chromosome Is there an easy way to do this? Will bcftools help? sequence TOPMED chromosome…

I have a vcf files like below: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT treatmentSample chr1 857100 . C T 1756.06 PASS AC=2;AF=1;AN=2;DP=60;ExcessHet=3.0103;FS=0;MLEAC=2;MLEAF=1;MQ=60;QD=29.27;SOR=1.812;CSQ=chr1:857100|T|SNV|ENSG00000228794|ENST00000445118|LINC01128||1|MODIFIER|non_coding_transcript_exon_variant||||5/5|||||||||||||||||| GT:AD:DP:GQ:PL 1/1:0,60:60:99:1770,180,0 Does anyone know how to seperate INFO columns into different columns? And also how to separate treatmentSample column following the FORMAT ORDER? I…

Fasta file and GTF file for STAR alignment 3 Hello there, The top-level fasta file will include chromsomes, regions not assembled into chromosomes and N padded haplotype/patch regions. See more here: ftp.ensembl.org/pub/release-92/fasta/mus_musculus/dna/README. If you are only looking for reference genome assembly chromosome level sequences then use the primary_assembly.fa file. The…

Variant effect predictor in ictalurus punctatus 0 Hello everyone I performed a VEP analysis today using a catfish reference genome and my VCFs are from the species Pimmelodus Yuma. The problem is that the predictors did not give me any results in the missense variants. Is this normal? Here are…

Ensembl Variant Effect Predictor (VEP) VEP determines the effect of your variants (SNPs, insertions, deletions, CNVs or structural variants) on genes, transcripts, and protein sequence, as well as …… Read more > The GA4GH Variation Representation Specification (4) Context precision: VRS does not lump together or link variation contexts; a variation…

Availability of information on genes in Gnomad VCF data 1 Hi , Im new to gnomad and genetics in general and i was wondering does the gnomad genome data that is downlaoded in the vcf format on variants contains information of what is the nearest gene and is the genomic…

BioPerl 1.7.2-GCCcore-8.2.0-Perl-5.28.1 There is a newer version of BioPerl Bioperl is the product of a community effort to produce Perl code which is useful in biology. Examples include Sequence objects, Alignment objects and database searching objects. Accessing BioPerl 1.7.2-GCCcore-8.2.0-Perl-5.28.1 To load the module for BioPerl 1.7.2-GCCcore-8.2.0-Perl-5.28.1 please use this command…

Installing ensembl-vep 1 Hello all , I tried installing ensembl-Vep on mu ubuntu using following commands git clone github.com/Ensembl/ensembl-vep cd ensembl-vep perl INSTALL.pl I got the error as :- ERROR: DBI module not found. VEP requires the DBI perl module to function I tried installing DBI etc but the error…

hgmd variants from Ensembl 0 I know that Ensembl has hgmd variants amongst other annotations as given here: hgmd variants How can I download these variants from Ensembl? I downloaded VEP because it uses multiple tracks including HGMD: VEP Is it possible to use VEP to extract just the HGMD…

Unexprected Ensembl-vep results 0 Hi.I got a VCF from an individual that shows symptoms of a known disease with known mutations. I run it with Ensembl-vep, expecting to find some of those mutations in the results, yet, all the consequences in the results are “intergenic-variant”.The command I used was: –cache…

annotation_file ##INFO=<ID=ClinVar_CLNSIG,Number=.,xxx ##INFO=<ID=ClinVar_CLNREVSTAT,Number=.,yyy ##INFO=<ID=ClinVar_CLNDN,Number=.zzz #CHROM POS ID REF ALT QUAL FILTER INFO chr1 10145 . AAC A 101.83 . AC=2;AF=0.067;AN=30;aaa chr1 10146 . AC A 98.25 . AC=2;AF=0.083;AN=24;bbb chr1 10146 . AC * 79.25 . AC=2;AF=0.083;AN=24;ccc chr1 10439 . AC A 81.33 . AC=1;AF=0.008333;AN=120;ddd chr1 10450 . T G 53.09…

stay In the first two sections , We compared the differences vcf Use of annotation software , And convert the demerit recorded after the annotation into maf File format , because snpeff The comment result cannot be converted to maf, So we will compare later ANNOVAR、VEP、GATK Funcatator The results of…

dint May 9, 2022, 1:33pm #1 i’m just wondering if you can specify cadd, gnomad, clinvar and dbNSFP options when annotating with hail on dxjupyterlab_spark_cluster o the UKB RAP? From the hail website, the following command can be used on your matrix file to annotate with these features: db =…

Details Posted: 22-Apr-22 Location: Danville, Pennsylvania Type: Full Time Salary: Open Categories: Operations Job Summary Primary accountability is to leverage the organization’s data assets exome sequencing data (>180,000 individuals) from MyCode Community Health Initiative to improve quality, efficiency and generate knowledge specifically in the field of bioinformatics within health research….

Error occurence after merging files with bcftools: wrong number of fields ? 1 I have multiple vcf of CASES and CONTROLS variations annotated by VEP, SNPEff, SnpSift. first pair vcf -> only variations| CASES and CONTROLS second pair vcf -> variations + SnpEff | CASES and CONTROLS third pair vcf->…

Hello, I used and edited the command line to use –vcf to import vcf file. I used these commands: for chr in $(seq 1 22); do      plink –vcf /dbGAP/GTEx_Analysis_2017-06-05_v8_WholeExomeSeq_979Indiv_VEP_annot.vcf.gz            –chr $chr            –recode            –out…

Here we demostrate several in vivo tests (flash visual evoked potential, pattern electroretinogram and optic coherence tomography) in goat and rhesus macaque to understand the structure and function of the optic nerve and its neurons. Hi, everyone. This is Yikui Zhang from Wenzhou Eye Hospital. The upper nerve lacks Exxons…

I’ve annotated some variants using VEP, and was looking at the minor allele frequencies. Some of the variants had very different MAFs in the annotation than I expected (I expected MAF < 1%, whereas some annotated MAFs were >50%). I looked up the same variants on the gnomAD v3 browser,…

I’ve installed vep in conda like so: conda install ensembl-vep=105.0-0 And then I installed the human cache like so: vep_install -a cf -s homo_sapiens -y GRCh38 -c /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/refs/vep –CONVERT But when I try and run vep I get an error: vep –dir_cache /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/refs/vep -i /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/data/test/manual/results/variants/cohort.norm_recalibrated.vcf -o /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/data/test/manual/results/variants/cohort.norm_recalibrated_vep.vcf Am I doing…

vep -i examples/homo_sapiens_GRCh38.vcf –database Can’t locate Bio/PrimarySeqI.pm in @INC (you may need to install the Bio::PrimarySeqI module) (@INC contains: /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0/modules /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0 /home/youssef/anaconda3/envs/ngs1/lib/site_perl/5.26.2/x86_64-linux-thread-multi /home/youssef/anaconda3/envs/ngs1/lib/site_perl/5.26.2 /home/youssef/anaconda3/envs/ngs1/lib/5.26.2/x86_64-linux-thread-multi /home/youssef/anaconda3/envs/ngs1/lib/5.26.2 .) at /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0/Bio/EnsEMBL/Slice.pm line 75. BEGIN failed–compilation aborted at /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0/Bio/EnsEMBL/Slice.pm line 75. Compilation failed in require at /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0/Bio/EnsEMBL/Feature.pm line 84. BEGIN failed–compilation aborted at /home/youssef/anaconda3/envs/ngs1/share/ensembl-vep-88.9-0/Bio/EnsEMBL/Feature.pm…

Fail to install Ensembl VEP 2 Hello I have been encounter some issues on installing the Ensembl VEP. I am using Ubuntu 20.04 system, with the newest perl v5.34. perl -MBio::Root::Version -e ‘print $Bio::Root::Version::VERSION,”n”‘ 1.006924 However, when I install the VEP, it failed. Hello! This installer is configured to install…

Describe the issue VEP give errors even my query and reference has same assembly version Command :$: ./vep -i examples/homo_sapiens_GRCh37.vcf –cache –refseq cache reference details while running install.pl ? 458 NB: Remember to use –refseq when running the VEP with this cache! downloading ftp.ensembl.org/pub/release-104/variation/indexed_vep_cache/homo_sapiens_refseq_vep_104_GRCh37.tar.gz unpacking homo_sapiens_refseq_vep_104_GRCh37.tar.gz converting cache, this may…

Installing Bio::DB::Big::File on Ubuntu (Building and testing…) 0 Hi everyone, I’m trying to install VEP, I already downloaded all the recommended PERL libraries/dependencies/modules But I still have a problem with Bio::DB::Big::File and Bio::DB::Big::AutoSQL They asked for lib big wig. I’ve found three ways to install this (in my understanding): sudo…

Failed to instantiate plugin dbNSFP in VEP 0 Hi Team, My VEP (version 105, installed by perl INSTALL.pl) works well. But I face some problems to use dbNSFP plugin (also installed by perl INSTALL.pl) with VEP tool. My dbNSFP version 4.2a was installed by the following code without any warning…