Tag: XS

Entry BWI76_09435       CDS       T09148                                  Name (GenBank) glutaredoxin, GrxA family   KO K03674   glutaredoxin 1 Organism klm  Klebsiella sp. M5al Brite KEGG Orthology (KO) [BR:klm00001] 09180 Brite Hierarchies  09182 Protein families: genetic information processing   03110 Chaperones and folding catalysts [BR:klm03110]    BWI76_09435Chaperones and folding catalysts [BR:klm03110] Protein folding catalysts  Protein disulfide isomerase   BWI76_09435 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin Glrx-like Thioredoxin_3…

When you run RStudio in a project, you choose an environment template for the runtime environment. The environment template specifies the type, size, and power of the hardware configuration, plus the software template. Types of environments You can use this type of environment with RStudio: Default RStudio CPU environments for…

Tags: License: Wallpaper uploaded by our users, For desktop wallpaper use only, DMCA Contact Us Original wallpaper info: image size: 962x831px file size: 108.71KB select resolution & download wallpaper PC(720P, 1080P, 2K, 4K, 5K): iMac: MacBook: MacBook Air 13″, MacBook Pro 15.4″: 1440×900 MacBook Pro 13.3″ Retina, MacBook Air 13″…

When Apple released iOS 17.2 on Monday, December 11, it had a lot to recommend it. You can read the full list of new features, including the much-anticipated Journal app, here on Forbes. And check out my guide on whether you should upgrade to it here. And now, it turns…

Introduction Spinal infection, an uncommon condition, was first recorded in 1779.1 When the intervertebral disk is infected, it is commonly referred to as spondylodiscitis,2 whereas infection of the vertebral body or endplates is more precisely termed vertebral osteomyelitis or spondylitis.3 The definitive diagnosis of spinal infection is often delayed by…

There are perfectly good celebrity style moments, and then there are the looks that really stick with you, the ones you try desperately to recreate at home. In ‘Great Outfits in Fashion History,’ Fashionista editors are revisiting their all-time favorite lewks. The ‘90s would not have been the same without…

I am mapping RNA-Seq data using STAR, using multi-sample two-pass mapping. I first mapped all samples with one-pass then concatenated their SJOut files and filtered junctions. I launched the second mapping by using this SJOut file. I used this command to generate genome : ` /home/STAR-2.7.10b/bin/Linux_x86_64/STAR \ –runThreadN 10 \…

In light of many broadcasters and media houses still hesitating to migrate their broadcast workflows to IP-based networks due to uncertainties and lack of experience, LOGIC media solutions has launched an innovative solution. Following their extensive roadtrIP tour across Germany in late October 2023, LOGIC now introduces the roadKIT –…

Everhart JE, Ruhl CE. Burden of digestive diseases in the United States Part III: Liver, biliary tract, and pancreas. Gastroenterology. 2009;136(4):1134–44. Article  PubMed  Google Scholar  Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. Lancet. 2005;366(9493):1303–14. Article  PubMed  Google Scholar  Nakanuma Y, Klimstra DS, Komuta M, Zen Y (2019) Intrahepatic…

de Hoog GS, Dukik K, Monod M, Packeu A, Stubbe D, Hendrickx M, et al. Toward a novel multilocus phylogenetic taxonomy for the dermatophytes. Mycopathologia. 2017;182(1–2):5–31. Article  PubMed  Google Scholar  Segal E, Elad D. Human and zoonotic dermatophytoses: epidemiological aspects. Front Microbiol. 2021;12:713532. Article  PubMed  PubMed Central  Google Scholar  Burstein…

Hi, I am following the example in the following file that creates “reference quantized representations” of different corresponding floating point ops. github.com pytorch/pytorch/blob/main/torch/ao/quantization/pt2e/representation/rewrite.py import torch from torch.fx import GraphModule from ..utils import ( get_aten_graph_module, remove_tensor_overload_for_qdq_ops, _replace_literals_with_new_placeholders, _replace_literals_with_existing_placeholders, ) from torch.ao.quantization.fx._decomposed import quantized_decomposed_lib # noqa: F401 from torch.fx.subgraph_rewriter import replace_pattern from…

by Jiewen Tan, Jon Bolin, Yeounoh Chung, Liyang Lu, Siyuan Liu, Wonjoo Lee, Manfei Bai, Meghan Cowan, Jack Cao, Milad Mohammadi, Shauheen Zahirazami, Alex Spiridonov In a landscape where AI innovation is accelerating at an unprecedented pace, Meta’s Llama family of open sourced large language models (LLMs) stands out as…

Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961;25:585–621. Article  CAS  PubMed  Google Scholar  Hayflick L. THE LIMITED IN VITRO LIFETIME OF HUMAN DIPLOID CELL STRAINS. Exp Cell Res. 1965;37:614–36. Article  CAS  PubMed  Google Scholar  Schmitt CA, Tchkonia T, Niedernhofer LJ, Robbins PD,…

Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11. Article  CAS  PubMed  PubMed Central  Google Scholar  Ogawa H, Amagai Y, Koike I, Kaiser K, Benner R. Production of refractory dissolved organic matter by bacteria. Science. 2001;292:917–20. Article  CAS  PubMed  Google Scholar  Liang…

Transcribed image text: Problem 20: Which of the forteoning series of pathways could be used to carry out the conversion shown? A. 1. 2. 2. ClCl​AlCl3​ 3. Cl2​(1 eq)/AICl 3 4. 1. KMnOM4​/NaOH/H2​O (xs) 2. H3​O+ B. 1. ∣AlCl3​ 2. ClCl​ANICl3​ 3. 1. KMnOM4​/OH/H2​O (xs) 4. Cl2​(1eq)/AlCl3​ 2. H3​O+ c….

Dear all, I am trying to annotate non-coding RNA in a small RNA-seq dataset. The RNACentral gff3 file that I am using has different chromosome identifiers than the genome assembly. I have loaded the gff3 file in R where I changed the chromosome identifiers using the the assembly report and…

Introduction According to the World Health Organization report 2022, the incidence rate of tuberculosis in China is 7.4%, with a year-on-year increase of 1.6%. China ranks third globally in terms of tuberculosis cases, with the top three countries being developing nations.1 It is worth noting that the tuberculosis mortality rate…

Ashengroph M, Hosseini SR (2021) A newly isolated Bacillus amyloliquefaciens SRB04 for the synthesis of selenium nanoparticles with potential antibacterial properties. Int Microbiol 24(1):103–114. doi.org/10.1007/s10123-020-00147-9 Article  CAS  PubMed  Google Scholar  Bao T, Zhang X, Zhao X, Rao Z, Yang T, Yang S (2015) Regulation of the NADH pool and NADH/NADPH…

by Yeounoh Chung, Jon Bolin, Milad Mohammadi, Jiewen Tan, Jack Cao, Joe Spisak, Alex Spiridonov, Shauheen Zahirazami, Steven Krawczyk, Wonjoo Lee Mohit Khatwani, Wanchao Liang, Vaibhav Singh Today, we are delighted to announce PyTorch/XLA SPMD: the integration of GSPMD into PyTorch with an easy to use API. PyTorch developers seeking…

Image by Getty / Futurism The human Y chromosome, the determinant of male sex, has finally been completely sequenced. What it unveils could prove crucial to understanding the Y chromosome’s puzzling origins, and — pertinently — how it affects male fertility. You can thank two teams of researchers for the breakthrough,…

Before the problem, I give some context. I am developing a amplicon NGS bioinformatics pipeline. I keep the primers to do the alignment, then I use samtools-ampliconclip to mask the primers and finally I use Pisces to call the variants. The problem is that occasionally, reads come with a large…

When using Pisces, I get the following error. System.Exception: RACP2-6poolv4_P5-A_FINAL_SORTED.bam: Error processing chr ‘chr7’: Failed to process variants for MN01972:49:000H5KYMY:1:11102:26356:2968 … 150S —> System.Exception: Failed to process variants for MN01972:49:000H5KYMY:1:11102:26356:2968 … 150S at Pisces.Domain.Logic.CandidateVariantFinder.ProcessCigarOps(Read alignment, String refChromosome, Int32 readStartPosition, String chromosomeName) at Pisces.Logic.SomaticVariantCaller.Execute() at Pisces.Processing.Logic.BaseGenomeProcessor.ProcessByBam(BamWorkRequest workRequest, String chrName) — End…

Mapping sequence to my genome 0 I’ve extracted the gene sequence of a particular gene from my single cell fastq data I have seven bam files (one per each fastq file) that looks as follows: A00126:151:H7JYWDSX2:4:2239:18222:26005 16 macaca-ref-custom_chr5 61645096 60 51S100M * 0 0 TACGACTACAGATTCATCCACGTGCTTGAGACTGTGGGCTTATAGTGGTGTGGCTTTGTAAACTGTTCTCTAGAAATATATTTATTCATGCAAACATGTATAAGTCACTCTGTATTTTTATACAACATAAGATTGTTTATGATCTTATGAC FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:1 MD:Z:27C72 AS:i:95 XS:i:21…

Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript August 10, 2023 Operator: Good day, ladies and gentlemen, and welcome to the Second Quarter 2023 Illumina Earnings Conference Call. At this time, all participants are in a listen-only mode. After the speakers’ presentation, there will be a question-and-answer session. Please be…

Hi! I am trying to simulate a 3-point bending test. I grouped the sample into 3 parts, unionized the left & right part, used a fix rigid on that; and applied a fix move linear on the middle part. But it doesn’t really feel right to me as the left…

Hi- I’ve noticed what i think is a bug in featureCounts with paired-end reads and –countReadPairs. When a bam is used that has been filtered post alignment so that some reads that were originally paired are no longer paired, featureCounts still treats them like a complete read pair and counts…

I have the sequence of some primers and I need to obtain the Start and End coordinates of these primers. I have been given two files p1.fa >TP53_02 TTGGAAGTGTCTCATGCTG >TP53_03 ATGGGACTGACTTTCTGCTC >TP53_04a tctgactgctcttttcaccc >TP53_04b ACCAGCAGCTCCTACACC >TP53_05 TGCCCTGACTTTCAACTCTG >TP53_06 CCCAGGCCTCTGATTCC p2.f >TP53_02 GGCCTGCCCTTCCAATG >TP53_03 CCAGCCCAACCCTTGTC >TP53_04a AGGGACAGAAGATGACAGGG >TP53_04b GGCCAGGCATTGAAGTC >TP53_05 AGCCCTGTCGTCTCTCCAG…

I am trying to recreate the results from this paper. Specifically, the nanowire I am testing is cylindrical with a cross-sectional area of 24 nm2 and a length of 10 nm. I am expecting a thermal conductivity of around 1.9 W/mK, however, I am only getting around 1.0 W/mK. The…

Rowley J, Hoorn S, Vander, Korenromp E, Low N, Unemo M, Abu-Raddad LJ, et al. Chlamydia, gonorrhoea, trichomoniasis and syphilis: global prevalence and incidence estimates, 2016. Bull World Health Organ. 2019;97(8):548–62. Article  PubMed  PubMed Central  Google Scholar  Van Gerwen OT, Muzny CA, Marrazzo JM. Sexually transmitted infections and female reproductive…

Subject: Need help with Qiime2 installation: ResolvePackageNotFound error Dear Qiime2 Community, I hope this message finds you well. I am currently facing an issue during the installation of Qiime2 and would greatly appreciate your assistance in resolving it. During the installation process, after following the Qiime2 instructions, I encountered the…

He G, Peng X, Wei S, Yang S, Li X, Huang M, et al. Exosomes in the hypoxic TME: from release, uptake and biofunctions to clinical applications. Mol Cancer. 2022;21:19. Article  PubMed  PubMed Central  Google Scholar  Downs-Canner SM, Meier J, Vincent BG, Serody JS. B cell function in the tumor…

{‘products’: [{‘name’: “Tommy Hilfiger Men’s Short Sleeve Button-Down Shirt”, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3204878580/Clothing/Tommy-Hilfiger-Men-s-Short-Sleeve-Button-Down-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$26.78’, ‘attributes’: [‘Material:Linen,Cotton’, ‘Target Group:Man’, ‘Color:Gray,Pink,White,Blue,Beige,Black,Turquoise’, ‘Size:S,XL,M,XXL’]}, {‘name’: “Van Heusen Men’s Long Sleeve Button-Down Shirt”, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3201809514/Clothing/Van-Heusen-Men-s-Long-Sleeve-Button-Down-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$18.89’, ‘attributes’: [‘Material:Cotton’, ‘Target Group:Man’, ‘Color:Red,Gray,White,Blue’, ‘Size:XL,XXL’]}, {‘name’: ‘Brixton Bowery Flannel Shirt’, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3202331096/Clothing/Brixton-Bowery-Flannel-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$34.48’, ‘attributes’: [‘Material:Cotton’, ‘Target Group:Man’,…

Hi, I’m trying to detect lariat loops in RNA-seq data (circular RNAs produced during splicing). I am following the methods used in Pineda & Bradley 2018 Branchpoint detection algorithm:Our branchpoint detection algorithm was based on the split-read alignment strategy used in Mercer et al. (2015). 1- Prefilter reads:First, filter out…

1. Introduction Allogeneic blood transfusion is potentially life-saving for bleeding patients, but it is not totally risk-free [1]. Intraoperative cell salvage, also known as autotransfusion, is a strategy designed to reduce the need for allogeneic transfusions. This procedure involves the collection of patient blood from the surgical field, which is…

Dear all, Hi. I’m having trouble setting and checking the temperature using npt ensemble. This is my model. After setting the top half to “top” and the bottom half to “bottom” using region and group, I want to set the upper and lower temperatures separately and then check the each…

Rožanc J, Sakellaropoulos T, Antoranz A, Guttà C, Podder B, Vetma V, Rufo N, Agostinis P, Pliaka V, Sauter T et al. Phosphoprotein patterns predict trametinib responsiveness and optimal trametinib sensitisation strategies in melanoma. 2019; 26(8):1365–78. Schadendorf D, van Akkooi ACJ, Berking C, Griewank KG, Gutzmer R, Hauschild A, Stang…

Samtools merge bam issue with header tags 1 Hi, I have a few bam files after mapping using Bowtie2. I want to extract the multi-mapped reads from these bam files. For doing so I used the following command: samtools view -h $fq | grep -E “^\@|XS:i” | grep “NM:i:0” >…

I have an in file of lammps.My purpose is to get Tg of CC, but it throws me error: Total # of neighbors = 1676629Ave neighs/atom = 331.61175Ave special neighs/atom = 5.9367089Neighbor list builds = 623Dangerous builds = 0ERROR: Cannot reset timestep with active dump – must undump first (src/output.cpp:636)Last…

SOUTH SAN FRANCISCO, Calif.–(BUSINESS WIRE)–Jun 1, 2023– Vistagen (Nasdaq: VTGN), a late clinical-stage biopharmaceutical company aiming to transform the treatment landscape for individuals living with anxiety, depression and other central nervous system (CNS) disorders, today announced that positive safety and exploratory efficacy data from its large Phase 3 open-label study…

Source: boost1.81 Version: 1.81.0-5 Severity: normal —–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Dear maintainer, starting with CMake 3.26, a new warning is issued if cmake_minimum_required() is not called before project(), as some policy settings affect the behavior of project(). Your package is affected: autopkgtest [23:01:45]: @@@@@@@@@@@@@@@@@@@@ summary atomic FAIL stderr: CMake Warning (dev) at…

Currently, I’m working on a quantum neural network that integrates a Qnode into a PyTorch model. To accelerate the computation, I use the ‘Parameter broadcast’ feature. The device I used is default.qubit. However, it only works when the diff_method is backprop. When use parameter_shift or adjoint, it will throw error…

Background. Calcific aortic valve disease (CAVD) is the most common native valve disease. Valvular interstitial cell (VIC) osteogenic differentiation and valvular endothelial cell (VEC) dysfunction are key steps in CAVD progression. Circular RNA (circRNAs) is involved in regulating osteogenic differentiation with mesenchymal cells and is associated with multiple disease progression,…

Tried to create an environment using Conda and was not able to do so. Have copy pasted the message below. Would be grateful to know what the issue is and how to resolve the issue. (base) C:\Users\Mathangi Janakiraman>wget data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.yml–2023-05-11 12:54:47– data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.ymlResolving data.qiime2.org (data.qiime2.org)… 54.200.1.12Connecting to data.qiime2.org (data.qiime2.org)|54.200.1.12|:443… connected.ERROR: cannot verify…

Menasha J, Levy B, Hirschhorn K, Kardon NB. Incidence and spectrum of chromosome abnormalities in spontaneous abortions: new insights from a 12-year study. Genet Med. 2005;7(4):251–63. doi.org/10.1097/01.GIM.0000160075.96707.04. Article  PubMed  Google Scholar  Munné S, Chen S, Collis P, Garrisi J, Zheng X, Cekleniak N, et al. Maternal age, morphology, development and…

Wilmington, Delaware, United States, April 14, 2023 (GLOBE NEWSWIRE) — The global cell culture market stood at USD 10.5 Bn in 2020 and the global market is projected to reach USD 27.6 Bn by 2031. The global industry is anticipated to expand at a CAGR of 9.0% between 2021 and…

I am currently trying to implement Physics Informed Neural Networks (PINNs). PINNs involve computing derivatives of model outputs with respect to its inputs. These derivatives are then used to calculate PDE residuals which could be Heat, Burger, Navier-Stokes Equation etc. Therefore, one needs to compute higher order partial derivatives. I…

I have quality controlled paired end environmental transcriptomic data that I want to map against a reference database of 8 cyanobacterial genomes. I made this reference by joining together the fasta files of each genome. I performed this mapping with BWA v0.7.3a but noticed that when I tried to count…

Tags: License: Wallpaper uploaded by our users, For desktop wallpaper use only, DMCA Contact Us Original wallpaper info: image size: 1920x1080px file size: 147.16KB resolution: 1080P select resolution & download wallpaper PC(720P, 1080P, 2K, 4K, 5K): iMac: MacBook: MacBook Air 13″, MacBook Pro 15.4″: 1440×900 MacBook Pro 13.3″ Retina, MacBook…

How can I use bcftools mpileup or an alternative to find ALL variants without any probabilistic inference? 0 Hello! I have a pipeline for a maximum depth sequencing project. Briefly, this means I can ignore PCR errors because I check for consensus of UMI-tagged sequences. Therefore, once I have a…

Introduction Diffuse large B-cell lymphoma (DLBCL) is the most common lymphoma, accounting for 30% of non-Hodgkin’s lymphoma. Approximately 150,000 new cases are diagnosed annually worldwideCitation1. DLBCL is characterized by heterogeneity, aggressiveness, and frequent relapse or resistance to chemotherapyCitation2. Due to the heterogeneity of DLBCL, the immunological, pathological, molecular, and genetic…

seal29 March 20, 2023, 12:08pm 1 I have a simulation box of 128x128x128 Angstrom, I have 2 charged particles (+e and -e) inside, I want to calculate the Short Range, Long Range , and self interaction terms for this along with the moment of the cell in Joules using LAMMPS,…

Hi every one!I have problem the number of atom is increasing (diamond structure)for example i have 24 atom(0.1%) for other atom (nitrogen N) after simulation the number of atom becomes more at each step (7362)( 21.7%) be the increase =24 atom I don’t know why the number increased and where…

Hi all, I have a BAM/SAM file with molecular barcode (MBC) / unique molecular identifier (UMI) stored in the RX tag (after preprocessing with AGeNT Trimmer). Here is an example, where RX:Z: is the tag containing the UMI TCA-TTA. A00620:188:HVMYMDSX2:4:2213:4255:9392 147 chr1 10000 0 96M = 10005 -91 ATAACCCTAACCCTAACACTAACACTAACCCTAACCCTATCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC,;-<–9:=<9-8:,;9+.:86.,9;><,,@;8<A-@;7(–A<?+-9/28>–A<?6-AA<?6A8.;><@@@;=;@?@:=;?>>9=:>==:=;>9 ZA:Z:TCACT…

Bredesen DE, Rao RV, Mehlen P. Cell death in the nervous system. Nature. 2006;443:796–802. Article  CAS  PubMed  PubMed Central  Google Scholar  Fricker M, Tolkovsky AM, Borutaite V, Coleman M, Brown GC. Neuronal cell death. Physiol Rev. 2018;98:813–80. Article  CAS  PubMed  PubMed Central  Google Scholar  West MJ, Coleman PD, Flood DG,…

I am training PyTorch model for binary classification and my input vector of length 561 [341 is one hot encoding] and the others are features between 0 and 1. my output is [0,1] or [1,0] . My issue is that the training loss is always decrease i tried to try…

Bwa mem different alignment results for the same reference genome 0 I used a genome A and an A+B genome to construct two A.db and AB.db with bwa respectively. The reads can be alignment with A alone, but only the B genome is alignment in the results of AB. I…

Is there a way to use two containers in the same snakemake rule? 0 Is there a way to use two containers in the same snakemake rule? I am trying to write a rule for the GATK 3D. Pipe SamToFastq, BWA-MEM and MergeBamAlignment to generate a clean BAM It pipes…

Beginner in Data Science? Focus on Basics with Kaggle Titanic Dataset Start with The Tip of the Iceberg — Titanic Machine Learning Dataset on Kaggle For a beginner, starting a career in data science can be overwhelming. Whether it is showcasing your business acumen, programming skills, exploratory data analysis skills,…

Wang Y, Zhang Z, Luo J, Han X, Wei Y, Wei X. mRNA vaccine: a potential therapeutic strategy. Mol Cancer. 2021;20(1):33–56. Article  CAS  PubMed  PubMed Central  Google Scholar  Kulkarni JA, Witzigmann D, Chen S, Cullis PR, van der Meel R. Lipid nanoparticle technology for clinical translation of siRNA therapeutics. Acc…

I am trying to write a rule that has a different wildcard in the input to the output like so: rule MarkDuplicates: input: L01=”result/gatk4/{fc}_L01_{index}_piped.bam”, L02=”result/gatk4/{fc}_L02_{index}_piped.bam”, L03=”result/gatk4/{fc}_L03_{index}_piped.bam”, L04=”result/gatk4/{fc}_L04_{index}_piped.bam” output: bam=”result/gatk4/samplename_index{index}_markedduplicates.bam”, txt=”result/gatk4/samplename_index{index}_markedduplicates_metrics.txt” log: “result/logs/markduplicates/samplename_index{index}.out” benchmark: “result/benchmarks/samplename_index{index}.md.out” container: config[“containers”][“gatk4”] threads: 8 shell: “”” gatk –java-options ‘-Xmx30G’ MarkDuplicates I={params.L01} I={params.L02} I={params.L03} I={params.L04} O={output.bam} M={output.txt}…

I’m using SCRMshaw to predict CRMs and I’m trying to use the enrichment bash script that comes with it. At first it had the problem of Can’t locate Bio/SeqIO.pm in @INC but this was fixed by exporting the path to a BioPerl installation in an Anaconda environment I made for…

Good evening, I’d like to compare the alignment quality of hisat2, bowtie2 and bwa for my files. The first 2 packages output the percentage of reads aligned concordantly exactly 1 time, bwa does not, because does not output alignment summary. The samtools flagstat report is not enough, because it outputs…

Reese D, Drapeau P. Neurite growth patterns leading to functional synapses in an identified embryonic neuron. J Neurosci: Off J Soc Neurosci. 1998;18:5652–62. Article  CAS  Google Scholar  Yi G, Wang J, Wei X, Deng B. Dendritic properties control energy efficiency of action potentials in cortical pyramidal cells. Front Cell Neurosci….

Sia D, Tovar V, Moeini A, Llovet JM. Intrahepatic cholangiocarcinoma: pathogenesis and rationale for molecular therapies. Oncogene. 2013;32(41):4861–70. CAS  Article  Google Scholar  Sungwan P, Lert-Itthiporn W, Silsirivanit A, Klinhom-On N, Okada S, Wongkham S, Seubwai W. Bioinformatics analysis identified CDC20 as a potential drug target for cholangiocarcinoma. PeerJ. 2021;9:e11067. Article …

Aran D, Hu Z, Butte AJ (2017) xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol 18(1):220. doi.org/10.1186/s13059-017-1349-1 CAS  Article  PubMed  PubMed Central  Google Scholar  Bajor DL, Mick R, Riese MJ, Huang AC, Sullivan B, Richman LP, Torigian DA, George SM, Stelekati E, Chen F, Melenhorst JJ, Lacey SF,…

Since MBEDTLS 2.27.0 is merged, a call to mbedtls_x509_crt_verify() fails: E/TC:? 0 E/TC:? 0 User mode data-abort at address 0x10ff3c (write permission fault) E/TC:? 0 fsr 0x0000080f ttbr0 0x24067859 ttbr1 0x24060059 cidr 0x2 E/TC:? 0 cpu #0 cpsr 0x60000130 E/TC:? 0 r0 0x0010ff38 r4 0x0010fb38 r8 0x00110380 r12 0xfffd34b4 E/TC:?…

I am facing a problem when I arrange 2 ggplots next to each other using grid.arrange(). I want to place a legend evenly below both plots. So I have (pseudocode): p1 <- ggplot(data = df, aes(group = name, color=as.factor(fac), y = ys, x= (xs))) + geom_point() + geom_line() + theme(legend.position=”bottom”)…

Introduction Congenital heart disease (CHD) refers to a group of anatomic heart and great vessel malformations that arise during the embryologic development of the fetus. CHD is one of the most prevalent birth defects, affecting around 2.50 out of every 1,000 births in China (1), and it imposes a substantial…

bwa , 2 files fastq to 1 sam 1 i have this problem, please, help me, I’m trying it too from Mac OS Catalina I am creating a sam file, with 2 fastq files, using bwa I apply the following command bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz V350019555_L03_B5GHUMqcnrRAABA-556_2.fq.gz > V350019555_L03_B5GHUMqcnrRAABA-556.sam…

All autopkgtests for the newly accepted glibc (2.31-0ubuntu9.4) for focal have finished running. The following regressions have been reported in tests triggered by the package: snapd-glib/1.58-0ubuntu0.20.04.0 (armhf) apt/2.0.6 (armhf) libmath-mpfr-perl/4.13-1 (armhf) art-nextgen-simulation-tools/20160605+dfsg-4 (armhf) ruby-nokogiri/1.10.7+dfsg1-2build1 (armhf) r-cran-rgdal/1.4-8-1build2 (armhf) arrayfire/3.3.2+dfsg1-4ubuntu4 (armhf) libpango-perl/1.227-3build1 (armhf) libimage-sane-perl/5-1 (s390x) ruby-bootsnap/1.4.6-1 (arm64) mle/1.4.3-1 (ppc64el, arm64) libsyntax-keyword-try-perl/0.11-1build1 (armhf)…

Hi everyone, I am fitting a geometric distribution to the following data: [40000, 600, 1500, 30000, 12000, 25000, 65000, 1500, 40000, 10000000, 25000, 2000, 2000, 500, 800, 1500, 30000, 850, 25000, 1000, 15000, 40000, 9000, 3000, 12000, 1000, 1000, 1500, 10000, 25000, 7000, 35000, 30000, 25000, 750, 20000, 7000, 1500,…

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Exec format error in unmapped bam file 0 Hello I created unmapped bam file from fastq file (sample 1). When I tried to search the bam file using query name, I got the ‘Exec format error’ #1_ucheck.bam: unmapped bam file from Sample 1 fastq file code: samtools view 1_ucheck.bam |…

Hello, I got a very weird output from BWA-mem2 – most of the reads have mapping quality of 0, even though there is no secondary alignment or anything else suspicious. I got sequencing data that was aligned with Novoalign to hg18, the data was bam files. I needed to realign…

Does Hisat2 automatically align strandedness 0 I’ve been using Hisat2 to align some RNA. RNA was prepped using NEB Directional library kit. When I originally aligned, I did not use the –rna-strandedness option. I then realised I do want stranded, as part of my reference (which is human genome plus…

Hi Everyone, I am currently looking at Acute Myeloid Leukemia (AML) paired-end WGS samples from the TARGET data ocg.cancer.gov/programs/target/target-methods#3241. A bioinformatician in our group remapped the samples from hg19 to hg38. Unfortunately, we do not have any copies of the hg19 version anymore. However, when I try to run anything…

Bwa sampe error 999 25-08-2021 I’m getting the following error message when I try to import into 1aa.vremenagoda54.ru file (using samtools import). [samopen] SAM header I’m using bwa aln to find coordinates and bwa sampe to…

No cell barcode information in BAM files. 0 My BAM file seems to be missing information on cell barcodes. I find that each BAM file represents the sequencing result of a cell. Here’s what I found when I combined dozens of BAM files. Can someone tell me how to find…

Mapping quality and XS score 0 Hi, I am currently looking through bam files using igv to manually check if the mutations not called by Mutect2 are really an error or not. Until now, to filter reads with low quality, I have used only MAPQ > 30 and didn’t consider…

How to convert mapping bam file to fastq without loseing the mapping information 0 Hi all, I want to create my RNA mapping data into a library for further analysis. Now I have bowtie2 mapping data, which is in bam files, I now use bedtools to extract fastq mapping reads…