Tag: XS

KEGG T09148: BWI76_09435

Entry BWI76_09435       CDS       T09148                                  Name (GenBank) glutaredoxin, GrxA family   KO K03674   glutaredoxin 1 Organism klm  Klebsiella sp. M5al Brite KEGG Orthology (KO) [BR:klm00001] 09180 Brite Hierarchies  09182 Protein families: genetic information processing   03110 Chaperones and folding catalysts [BR:klm03110]    BWI76_09435Chaperones and folding catalysts [BR:klm03110] Protein folding catalysts  Protein disulfide isomerase   BWI76_09435 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin Glrx-like Thioredoxin_3…

Continue Reading KEGG T09148: BWI76_09435

Compute resource options for RStudio in projects

When you run RStudio in a project, you choose an environment template for the runtime environment. The environment template specifies the type, size, and power of the hardware configuration, plus the software template. Types of environments You can use this type of environment with RStudio: Default RStudio CPU environments for…

Continue Reading Compute resource options for RStudio in projects

Genji Redux by Nocluse. Overwatch , Overwatch genji, Overwatch comic, Gengi HD wallpaper

Tags: License: Wallpaper uploaded by our users, For desktop wallpaper use only, DMCA Contact Us Original wallpaper info: image size: 962x831px file size: 108.71KB select resolution & download wallpaper PC(720P, 1080P, 2K, 4K, 5K): iMac: MacBook: MacBook Air 13″, MacBook Pro 15.4″: 1440×900 MacBook Pro 13.3″ Retina, MacBook Air 13″…

Continue Reading Genji Redux by Nocluse. Overwatch , Overwatch genji, Overwatch comic, Gengi HD wallpaper

Apple’s cool new update can protect your iPhone from public attacks

When Apple released iOS 17.2 on Monday, December 11, it had a lot to recommend it. You can read the full list of new features, including the much-anticipated Journal app, here on Forbes. And check out my guide on whether you should upgrade to it here. And now, it turns…

Continue Reading Apple’s cool new update can protect your iPhone from public attacks

Diagnostic efficacy of mNGS in spinal infection patients

Introduction Spinal infection, an uncommon condition, was first recorded in 1779.1 When the intervertebral disk is infected, it is commonly referred to as spondylodiscitis,2 whereas infection of the vertebral body or endplates is more precisely termed vertebral osteomyelitis or spondylitis.3 The definitive diagnosis of spinal infection is often delayed by…

Continue Reading Diagnostic efficacy of mNGS in spinal infection patients

Cindy Crawford’s ’90s Bandage Mini and Fur-Trim Gloves

There are perfectly good celebrity style moments, and then there are the looks that really stick with you, the ones you try desperately to recreate at home. In ‘Great Outfits in Fashion History,’ Fashionista editors are revisiting their all-time favorite lewks. The ‘90s would not have been the same without…

Continue Reading Cindy Crawford’s ’90s Bandage Mini and Fur-Trim Gloves

Bam files generated with STAR cause a segmentation fault core dump error when used with another tool

I am mapping RNA-Seq data using STAR, using multi-sample two-pass mapping. I first mapped all samples with one-pass then concatenated their SJOut files and filtered junctions. I launched the second mapping by using this SJOut file. I used this command to generate genome : ` /home/STAR-2.7.10b/bin/Linux_x86_64/STAR \ –runThreadN 10 \…

Continue Reading Bam files generated with STAR cause a segmentation fault core dump error when used with another tool

LOGIC media solutions Announces New roadKIT – UK Broadcast News

In light of many broadcasters and media houses still hesitating to migrate their broadcast workflows to IP-based networks due to uncertainties and lack of experience, LOGIC media solutions has launched an innovative solution. Following their extensive roadtrIP tour across Germany in late October 2023, LOGIC now introduces the roadKIT –…

Continue Reading LOGIC media solutions Announces New roadKIT – UK Broadcast News

Oncogenic activation revealed by FGFR2 genetic alterations in intrahepatic cholangiocarcinomas | Cell & Bioscience

Everhart JE, Ruhl CE. Burden of digestive diseases in the United States Part III: Liver, biliary tract, and pancreas. Gastroenterology. 2009;136(4):1134–44. Article  PubMed  Google Scholar  Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. Lancet. 2005;366(9493):1303–14. Article  PubMed  Google Scholar  Nakanuma Y, Klimstra DS, Komuta M, Zen Y (2019) Intrahepatic…

Continue Reading Oncogenic activation revealed by FGFR2 genetic alterations in intrahepatic cholangiocarcinomas | Cell & Bioscience

Erythroderma combined with deeper dermal dermatophytosis due to Trichophyton rubrum in a patient with myasthenia gravis: first case report and literature review | BMC Infectious Diseases

de Hoog GS, Dukik K, Monod M, Packeu A, Stubbe D, Hendrickx M, et al. Toward a novel multilocus phylogenetic taxonomy for the dermatophytes. Mycopathologia. 2017;182(1–2):5–31. Article  PubMed  Google Scholar  Segal E, Elad D. Human and zoonotic dermatophytoses: epidemiological aspects. Front Microbiol. 2021;12:713532. Article  PubMed  PubMed Central  Google Scholar  Burstein…

Continue Reading Erythroderma combined with deeper dermal dermatophytosis due to Trichophyton rubrum in a patient with myasthenia gravis: first case report and literature review | BMC Infectious Diseases

Adding custom quantized C++ op – C++

Hi, I am following the example in the following file that creates “reference quantized representations” of different corresponding floating point ops. github.com pytorch/pytorch/blob/main/torch/ao/quantization/pt2e/representation/rewrite.py import torch from torch.fx import GraphModule from ..utils import ( get_aten_graph_module, remove_tensor_overload_for_qdq_ops, _replace_literals_with_new_placeholders, _replace_literals_with_existing_placeholders, ) from torch.ao.quantization.fx._decomposed import quantized_decomposed_lib # noqa: F401 from torch.fx.subgraph_rewriter import replace_pattern from…

Continue Reading Adding custom quantized C++ op – C++

High-Performance Llama 2 Training and Inference with PyTorch/XLA on Cloud TPUs

by Jiewen Tan, Jon Bolin, Yeounoh Chung, Liyang Lu, Siyuan Liu, Wonjoo Lee, Manfei Bai, Meghan Cowan, Jack Cao, Milad Mohammadi, Shauheen Zahirazami, Alex Spiridonov In a landscape where AI innovation is accelerating at an unprecedented pace, Meta’s Llama family of open sourced large language models (LLMs) stands out as…

Continue Reading High-Performance Llama 2 Training and Inference with PyTorch/XLA on Cloud TPUs

DNA damage response(DDR): a link between cellular senescence and human cytomegalovirus | Virology Journal

Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961;25:585–621. Article  CAS  PubMed  Google Scholar  Hayflick L. THE LIMITED IN VITRO LIFETIME OF HUMAN DIPLOID CELL STRAINS. Exp Cell Res. 1965;37:614–36. Article  CAS  PubMed  Google Scholar  Schmitt CA, Tchkonia T, Niedernhofer LJ, Robbins PD,…

Continue Reading DNA damage response(DDR): a link between cellular senescence and human cytomegalovirus | Virology Journal

Identification and cultivation of anaerobic bacterial scavengers of dead cells

Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11. Article  CAS  PubMed  PubMed Central  Google Scholar  Ogawa H, Amagai Y, Koike I, Kaiser K, Benner R. Production of refractory dissolved organic matter by bacteria. Science. 2001;292:917–20. Article  CAS  PubMed  Google Scholar  Liang…

Continue Reading Identification and cultivation of anaerobic bacterial scavengers of dead cells

Solved Which of the following series of pathways could be

Transcribed image text: Problem 20: Which of the forteoning series of pathways could be used to carry out the conversion shown? A. 1. 2. 2. ClCl​AlCl3​ 3. Cl2​(1 eq)/AICl 3 4. 1. KMnOM4​/NaOH/H2​O (xs) 2. H3​O+ B. 1. ∣AlCl3​ 2. ClCl​ANICl3​ 3. 1. KMnOM4​/OH/H2​O (xs) 4. Cl2​(1eq)/AlCl3​ 2. H3​O+ c….

Continue Reading Solved Which of the following series of pathways could be

How do I write a correctly formatted gff3 file in R?

Dear all, I am trying to annotate non-coding RNA in a small RNA-seq dataset. The RNACentral gff3 file that I am using has different chromosome identifiers than the genome assembly. I have loaded the gff3 file in R where I changed the chromosome identifiers using the the assembly report and…

Continue Reading How do I write a correctly formatted gff3 file in R?

Detecting drug resistance of Mycobacterium tuberculosis

Introduction According to the World Health Organization report 2022, the incidence rate of tuberculosis in China is 7.4%, with a year-on-year increase of 1.6%. China ranks third globally in terms of tuberculosis cases, with the top three countries being developing nations.1 It is worth noting that the tuberculosis mortality rate…

Continue Reading Detecting drug resistance of Mycobacterium tuberculosis

Whole genome sequencing and analysis of selenite-reducing bacteria Bacillus paralicheniformis SR14 in response to different sugar supplements

Ashengroph M, Hosseini SR (2021) A newly isolated Bacillus amyloliquefaciens SRB04 for the synthesis of selenium nanoparticles with potential antibacterial properties. Int Microbiol 24(1):103–114. doi.org/10.1007/s10123-020-00147-9 Article  CAS  PubMed  Google Scholar  Bao T, Zhang X, Zhao X, Rao Z, Yang T, Yang S (2015) Regulation of the NADH pool and NADH/NADPH…

Continue Reading Whole genome sequencing and analysis of selenite-reducing bacteria Bacillus paralicheniformis SR14 in response to different sugar supplements

PyTorch/XLA SPMD: Scale Up Model Training and Serving with Automatic Parallelization

by Yeounoh Chung, Jon Bolin, Milad Mohammadi, Jiewen Tan, Jack Cao, Joe Spisak, Alex Spiridonov, Shauheen Zahirazami, Steven Krawczyk, Wonjoo Lee Mohit Khatwani, Wanchao Liang, Vaibhav Singh Today, we are delighted to announce PyTorch/XLA SPMD: the integration of GSPMD into PyTorch with an easy to use API. PyTorch developers seeking…

Continue Reading PyTorch/XLA SPMD: Scale Up Model Training and Serving with Automatic Parallelization

The Male Y Chromosome Has Finally Been Completely Sequenced

Image by Getty / Futurism The human Y chromosome, the determinant of male sex, has finally been completely sequenced. What it unveils could prove crucial to understanding the Y chromosome’s puzzling origins, and — pertinently — how it affects male fertility. You can thank two teams of researchers for the breakthrough,…

Continue Reading The Male Y Chromosome Has Finally Been Completely Sequenced

How to mark as QC fail reads with specific CIGARs

Before the problem, I give some context. I am developing a amplicon NGS bioinformatics pipeline. I keep the primers to do the alignment, then I use samtools-ampliconclip to mask the primers and finally I use Pisces to call the variants. The problem is that occasionally, reads come with a large…

Continue Reading How to mark as QC fail reads with specific CIGARs

Pisces doesn’t like high-quality reads when there is a soft-clip affecting the full read.

When using Pisces, I get the following error. System.Exception: RACP2-6poolv4_P5-A_FINAL_SORTED.bam: Error processing chr ‘chr7’: Failed to process variants for MN01972:49:000H5KYMY:1:11102:26356:2968 … 150S —> System.Exception: Failed to process variants for MN01972:49:000H5KYMY:1:11102:26356:2968 … 150S at Pisces.Domain.Logic.CandidateVariantFinder.ProcessCigarOps(Read alignment, String refChromosome, Int32 readStartPosition, String chromosomeName) at Pisces.Logic.SomaticVariantCaller.Execute() at Pisces.Processing.Logic.BaseGenomeProcessor.ProcessByBam(BamWorkRequest workRequest, String chrName) — End…

Continue Reading Pisces doesn’t like high-quality reads when there is a soft-clip affecting the full read.

Mapping sequence to my genome

Mapping sequence to my genome 0 I’ve extracted the gene sequence of a particular gene from my single cell fastq data I have seven bam files (one per each fastq file) that looks as follows: A00126:151:H7JYWDSX2:4:2239:18222:26005 16 macaca-ref-custom_chr5 61645096 60 51S100M * 0 0 TACGACTACAGATTCATCCACGTGCTTGAGACTGTGGGCTTATAGTGGTGTGGCTTTGTAAACTGTTCTCTAGAAATATATTTATTCATGCAAACATGTATAAGTCACTCTGTATTTTTATACAACATAAGATTGTTTATGATCTTATGAC FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:1 MD:Z:27C72 AS:i:95 XS:i:21…

Continue Reading Mapping sequence to my genome

Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript

Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript August 10, 2023 Operator: Good day, ladies and gentlemen, and welcome to the Second Quarter 2023 Illumina Earnings Conference Call. At this time, all participants are in a listen-only mode. After the speakers’ presentation, there will be a question-and-answer session. Please be…

Continue Reading Illumina, Inc. (NASDAQ:ILMN) Q2 2023 Earnings Call Transcript

Bending – LAMMPS General Discussion

Hi! I am trying to simulate a 3-point bending test. I grouped the sample into 3 parts, unionized the left & right part, used a fix rigid on that; and applied a fix move linear on the middle part. But it doesn’t really feel right to me as the left…

Continue Reading Bending – LAMMPS General Discussion

featureCounts bug with unpaired reads

Hi- I’ve noticed what i think is a bug in featureCounts with paired-end reads and –countReadPairs. When a bam is used that has been filtered post alignment so that some reads that were originally paired are no longer paired, featureCounts still treats them like a complete read pair and counts…

Continue Reading featureCounts bug with unpaired reads

From primers sequence to Bed file

I have the sequence of some primers and I need to obtain the Start and End coordinates of these primers. I have been given two files p1.fa >TP53_02 TTGGAAGTGTCTCATGCTG >TP53_03 ATGGGACTGACTTTCTGCTC >TP53_04a tctgactgctcttttcaccc >TP53_04b ACCAGCAGCTCCTACACC >TP53_05 TGCCCTGACTTTCAACTCTG >TP53_06 CCCAGGCCTCTGATTCC p2.f >TP53_02 GGCCTGCCCTTCCAATG >TP53_03 CCAGCCCAACCCTTGTC >TP53_04a AGGGACAGAAGATGACAGGG >TP53_04b GGCCAGGCATTGAAGTC >TP53_05 AGCCCTGTCGTCTCTCCAG…

Continue Reading From primers sequence to Bed file

lammps – Thermal conductivity of cylindrical Si nanowire is lower than expected

I am trying to recreate the results from this paper. Specifically, the nanowire I am testing is cylindrical with a cross-sectional area of 24 nm2 and a length of 10 nm. I am expecting a thermal conductivity of around 1.9 W/mK, however, I am only getting around 1.0 W/mK. The…

Continue Reading lammps – Thermal conductivity of cylindrical Si nanowire is lower than expected

Prevalence of five treatable sexually transmitted infections among women in Lower River region of The Gambia | BMC Infectious Diseases

Rowley J, Hoorn S, Vander, Korenromp E, Low N, Unemo M, Abu-Raddad LJ, et al. Chlamydia, gonorrhoea, trichomoniasis and syphilis: global prevalence and incidence estimates, 2016. Bull World Health Organ. 2019;97(8):548–62. Article  PubMed  PubMed Central  Google Scholar  Van Gerwen OT, Muzny CA, Marrazzo JM. Sexually transmitted infections and female reproductive…

Continue Reading Prevalence of five treatable sexually transmitted infections among women in Lower River region of The Gambia | BMC Infectious Diseases

Subject:[QIIME2.2023.5] Need help with Qiime2 installation: ResolvePackageNotFound error – Technical Support

Subject: Need help with Qiime2 installation: ResolvePackageNotFound error Dear Qiime2 Community, I hope this message finds you well. I am currently facing an issue during the installation of Qiime2 and would greatly appreciate your assistance in resolving it. During the installation process, after following the Qiime2 instructions, I encountered the…

Continue Reading Subject:[QIIME2.2023.5] Need help with Qiime2 installation: ResolvePackageNotFound error – Technical Support

Exosomal circRNA: emerging insights into cancer progression and clinical application potential | Journal of Hematology & Oncology

He G, Peng X, Wei S, Yang S, Li X, Huang M, et al. Exosomes in the hypoxic TME: from release, uptake and biofunctions to clinical applications. Mol Cancer. 2022;21:19. Article  PubMed  PubMed Central  Google Scholar  Downs-Canner SM, Meier J, Vincent BG, Serody JS. B cell function in the tumor…

Continue Reading Exosomal circRNA: emerging insights into cancer progression and clinical application potential | Journal of Hematology & Oncology

OpenAPI calls with OpenAI functions

{‘products’: [{‘name’: “Tommy Hilfiger Men’s Short Sleeve Button-Down Shirt”, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3204878580/Clothing/Tommy-Hilfiger-Men-s-Short-Sleeve-Button-Down-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$26.78’, ‘attributes’: [‘Material:Linen,Cotton’, ‘Target Group:Man’, ‘Color:Gray,Pink,White,Blue,Beige,Black,Turquoise’, ‘Size:S,XL,M,XXL’]}, {‘name’: “Van Heusen Men’s Long Sleeve Button-Down Shirt”, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3201809514/Clothing/Van-Heusen-Men-s-Long-Sleeve-Button-Down-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$18.89’, ‘attributes’: [‘Material:Cotton’, ‘Target Group:Man’, ‘Color:Red,Gray,White,Blue’, ‘Size:XL,XXL’]}, {‘name’: ‘Brixton Bowery Flannel Shirt’, ‘url’: ‘https://www.klarna.com/us/shopping/pl/cl10001/3202331096/Clothing/Brixton-Bowery-Flannel-Shirt/?utm_source=openai&ref-site=openai_plugin’, ‘price’: ‘$34.48’, ‘attributes’: [‘Material:Cotton’, ‘Target Group:Man’,…

Continue Reading OpenAPI calls with OpenAI functions

Help manually processing strand in paired-end reads when fishing for lariats in bulk RNA-seq

Hi, I’m trying to detect lariat loops in RNA-seq data (circular RNAs produced during splicing). I am following the methods used in Pineda & Bradley 2018 Branchpoint detection algorithm:Our branchpoint detection algorithm was based on the split-read alignment strategy used in Mercer et al. (2015). 1- Prefilter reads:First, filter out…

Continue Reading Help manually processing strand in paired-end reads when fishing for lariats in bulk RNA-seq

JCM | Free Full-Text | Reduction of EpCAM-Positive Cells from a Cell Salvage Product Is Achieved by Leucocyte Depletion Filters Alone

1. Introduction Allogeneic blood transfusion is potentially life-saving for bleeding patients, but it is not totally risk-free [1]. Intraoperative cell salvage, also known as autotransfusion, is a strategy designed to reduce the need for allogeneic transfusions. This procedure involves the collection of patient blood from the surgical field, which is…

Continue Reading JCM | Free Full-Text | Reduction of EpCAM-Positive Cells from a Cell Salvage Product Is Achieved by Leucocyte Depletion Filters Alone

Temperature keeps coming up to 0K – LAMMPS General Discussion

Dear all, Hi. I’m having trouble setting and checking the temperature using npt ensemble. This is my model. After setting the top half to “top” and the bottom half to “bottom” using region and group, I want to set the upper and lower temperatures separately and then check the each…

Continue Reading Temperature keeps coming up to 0K – LAMMPS General Discussion

LSM2 is associated with a poor prognosis and promotes cell proliferation, migration, and invasion in skin cutaneous melanoma | BMC Medical Genomics

Rožanc J, Sakellaropoulos T, Antoranz A, Guttà C, Podder B, Vetma V, Rufo N, Agostinis P, Pliaka V, Sauter T et al. Phosphoprotein patterns predict trametinib responsiveness and optimal trametinib sensitisation strategies in melanoma. 2019; 26(8):1365–78. Schadendorf D, van Akkooi ACJ, Berking C, Griewank KG, Gutzmer R, Hauschild A, Stang…

Continue Reading LSM2 is associated with a poor prognosis and promotes cell proliferation, migration, and invasion in skin cutaneous melanoma | BMC Medical Genomics

Samtools merge bam issue with header tags

Samtools merge bam issue with header tags 1 Hi, I have a few bam files after mapping using Bowtie2. I want to extract the multi-mapped reads from these bam files. For doing so I used the following command: samtools view -h $fq | grep -E “^\@|XS:i” | grep “NM:i:0” >…

Continue Reading Samtools merge bam issue with header tags

Question about lammps input file – LAMMPS Beginners

I have an in file of lammps.My purpose is to get Tg of CC, but it throws me error: Total # of neighbors = 1676629Ave neighs/atom = 331.61175Ave special neighs/atom = 5.9367089Neighbor list builds = 623Dangerous builds = 0ERROR: Cannot reset timestep with active dump – must undump first (src/output.cpp:636)Last…

Continue Reading Question about lammps input file – LAMMPS Beginners

Vistagen Presents Fasedienol (PH94B) Safety and Exploratory Efficacy Data from Phase 3 Open-Label Social Anxiety Disorder Study at American Society for Clinical Psychopharmacology Annual Meeting | Business

SOUTH SAN FRANCISCO, Calif.–(BUSINESS WIRE)–Jun 1, 2023– Vistagen (Nasdaq: VTGN), a late clinical-stage biopharmaceutical company aiming to transform the treatment landscape for individuals living with anxiety, depression and other central nervous system (CNS) disorders, today announced that positive safety and exploratory efficacy data from its large Phase 3 open-label study…

Continue Reading Vistagen Presents Fasedienol (PH94B) Safety and Exploratory Efficacy Data from Phase 3 Open-Label Social Anxiety Disorder Study at American Society for Clinical Psychopharmacology Annual Meeting | Business

autopkgtest regression due to new CMake warning

Source: boost1.81 Version: 1.81.0-5 Severity: normal —–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Dear maintainer, starting with CMake 3.26, a new warning is issued if cmake_minimum_required() is not called before project(), as some policy settings affect the behavior of project(). Your package is affected: autopkgtest [23:01:45]: @@@@@@@@@@@@@@@@@@@@ summary atomic FAIL stderr: CMake Warning (dev) at…

Continue Reading autopkgtest regression due to new CMake warning

Integrate a qnode supporting parameter broadcast into a pytorch model – PennyLane Help

Currently, I’m working on a quantum neural network that integrates a Qnode into a PyTorch model. To accelerate the computation, I use the ‘Parameter broadcast’ feature. The device I used is default.qubit. However, it only works when the diff_method is backprop. When use parameter_shift or adjoint, it will throw error…

Continue Reading Integrate a qnode supporting parameter broadcast into a pytorch model – PennyLane Help

Bioinformatics-Based Identification of CircRNA-MicroRNA-mRNA Network for Calcific Aortic Valve Disease

Background. Calcific aortic valve disease (CAVD) is the most common native valve disease. Valvular interstitial cell (VIC) osteogenic differentiation and valvular endothelial cell (VEC) dysfunction are key steps in CAVD progression. Circular RNA (circRNAs) is involved in regulating osteogenic differentiation with mesenchymal cells and is associated with multiple disease progression,…

Continue Reading Bioinformatics-Based Identification of CircRNA-MicroRNA-mRNA Network for Calcific Aortic Valve Disease

Unable to create environment – Technical Support

Tried to create an environment using Conda and was not able to do so. Have copy pasted the message below. Would be grateful to know what the issue is and how to resolve the issue. (base) C:\Users\Mathangi Janakiraman>wget data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.yml–2023-05-11 12:54:47– data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.ymlResolving data.qiime2.org (data.qiime2.org)… 54.200.1.12Connecting to data.qiime2.org (data.qiime2.org)|54.200.1.12|:443… connected.ERROR: cannot verify…

Continue Reading Unable to create environment – Technical Support

The origin and possible mechanism of embryonic cell-free DNA release in spent embryo culture media: a review

Menasha J, Levy B, Hirschhorn K, Kardon NB. Incidence and spectrum of chromosome abnormalities in spontaneous abortions: new insights from a 12-year study. Genet Med. 2005;7(4):251–63. doi.org/10.1097/01.GIM.0000160075.96707.04. Article  PubMed  Google Scholar  Munné S, Chen S, Collis P, Garrisi J, Zheng X, Cekleniak N, et al. Maternal age, morphology, development and…

Continue Reading The origin and possible mechanism of embryonic cell-free DNA release in spent embryo culture media: a review

Cell Culture Market to Hit USD 27.6 Bn by 2031 |

Wilmington, Delaware, United States, April 14, 2023 (GLOBE NEWSWIRE) — The global cell culture market stood at USD 10.5 Bn in 2020 and the global market is projected to reach USD 27.6 Bn by 2031. The global industry is anticipated to expand at a CAGR of 9.0% between 2021 and…

Continue Reading Cell Culture Market to Hit USD 27.6 Bn by 2031 |

python – Efficient Calculation of Derivatives for PINN Solvers in PyTorch

I am currently trying to implement Physics Informed Neural Networks (PINNs). PINNs involve computing derivatives of model outputs with respect to its inputs. These derivatives are then used to calculate PDE residuals which could be Heat, Burger, Navier-Stokes Equation etc. Therefore, one needs to compute higher order partial derivatives. I…

Continue Reading python – Efficient Calculation of Derivatives for PINN Solvers in PyTorch

Error using BWA to map environmental transcriptome against a genomic reference

I have quality controlled paired end environmental transcriptomic data that I want to map against a reference database of 8 cyanobacterial genomes. I made this reference by joining together the fasta files of each genome. I performed this mapping with BWA v0.7.3a but noticed that when I tried to count…

Continue Reading Error using BWA to map environmental transcriptome against a genomic reference

Red Genji Minions. Overwatch genji, Genji , Overwatch, Gengi HD wallpaper

Tags: License: Wallpaper uploaded by our users, For desktop wallpaper use only, DMCA Contact Us Original wallpaper info: image size: 1920x1080px file size: 147.16KB resolution: 1080P select resolution & download wallpaper PC(720P, 1080P, 2K, 4K, 5K): iMac: MacBook: MacBook Air 13″, MacBook Pro 15.4″: 1440×900 MacBook Pro 13.3″ Retina, MacBook…

Continue Reading Red Genji Minions. Overwatch genji, Genji , Overwatch, Gengi HD wallpaper

How can I use bcftools mpileup or an alternative to find ALL variants without any probabilistic inference?

How can I use bcftools mpileup or an alternative to find ALL variants without any probabilistic inference? 0 Hello! I have a pipeline for a maximum depth sequencing project. Briefly, this means I can ignore PCR errors because I check for consensus of UMI-tagged sequences. Therefore, once I have a…

Continue Reading How can I use bcftools mpileup or an alternative to find ALL variants without any probabilistic inference?

Ras interacting protein 1 facilitated proliferation and invasion of diffuse large B-cell lymphoma cells

Introduction Diffuse large B-cell lymphoma (DLBCL) is the most common lymphoma, accounting for 30% of non-Hodgkin’s lymphoma. Approximately 150,000 new cases are diagnosed annually worldwideCitation1. DLBCL is characterized by heterogeneity, aggressiveness, and frequent relapse or resistance to chemotherapyCitation2. Due to the heterogeneity of DLBCL, the immunological, pathological, molecular, and genetic…

Continue Reading Ras interacting protein 1 facilitated proliferation and invasion of diffuse large B-cell lymphoma cells

Interaction Energy between particles – LAMMPS General Discussion

seal29 March 20, 2023, 12:08pm 1 I have a simulation box of 128x128x128 Angstrom, I have 2 charged particles (+e and -e) inside, I want to calculate the Short Range, Long Range , and self interaction terms for this along with the moment of the cell in Joules using LAMMPS,…

Continue Reading Interaction Energy between particles – LAMMPS General Discussion

Identify the exact number atoms simulation – LAMMPS General Discussion

Hi every one!I have problem the number of atom is increasing (diamond structure)for example i have 24 atom(0.1%) for other atom (nitrogen N) after simulation the number of atom becomes more at each step (7362)( 21.7%) be the increase =24 atom I don’t know why the number increased and where…

Continue Reading Identify the exact number atoms simulation – LAMMPS General Discussion

Adding MBC/UMI RX tag to read name

Hi all, I have a BAM/SAM file with molecular barcode (MBC) / unique molecular identifier (UMI) stored in the RX tag (after preprocessing with AGeNT Trimmer). Here is an example, where RX:Z: is the tag containing the UMI TCA-TTA. A00620:188:HVMYMDSX2:4:2213:4255:9392 147 chr1 10000 0 96M = 10005 -91 ATAACCCTAACCCTAACACTAACACTAACCCTAACCCTATCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC,;-<–9:=<9-8:,;9+.:86.,9;><,,@;8<A-@;7(–A<?+-9/28>–A<?6-AA<?6A8.;><@@@;=;@?@:=;?>>9=:>==:=;>9 ZA:Z:TCACT…

Continue Reading Adding MBC/UMI RX tag to read name

Friend or foe: role of pathological tau in neuronal death

Bredesen DE, Rao RV, Mehlen P. Cell death in the nervous system. Nature. 2006;443:796–802. Article  CAS  PubMed  PubMed Central  Google Scholar  Fricker M, Tolkovsky AM, Borutaite V, Coleman M, Brown GC. Neuronal cell death. Physiol Rev. 2018;98:813–80. Article  CAS  PubMed  PubMed Central  Google Scholar  West MJ, Coleman PD, Flood DG,…

Continue Reading Friend or foe: role of pathological tau in neuronal death

Training loss did not increase

I am training PyTorch model for binary classification and my input vector of length 561 [341 is one hot encoding] and the others are features between 0 and 1. my output is [0,1] or [1,0] . My issue is that the training loss is always decrease i tried to try…

Continue Reading Training loss did not increase

Bwa mem different alignment results for the same reference genome

Bwa mem different alignment results for the same reference genome 0 I used a genome A and an A+B genome to construct two A.db and AB.db with bwa respectively. The reads can be alignment with A alone, but only the B genome is alignment in the results of AB. I…

Continue Reading Bwa mem different alignment results for the same reference genome

Is there a way to use two containers in the same snakemake rule?

Is there a way to use two containers in the same snakemake rule? 0 Is there a way to use two containers in the same snakemake rule? I am trying to write a rule for the GATK 3D. Pipe SamToFastq, BWA-MEM and MergeBamAlignment to generate a clean BAM It pipes…

Continue Reading Is there a way to use two containers in the same snakemake rule?

Beginner in Data Science? Focus on Basics with Kaggle Titanic Dataset | by Neet Madan | Feb, 2023

Beginner in Data Science? Focus on Basics with Kaggle Titanic Dataset Start with The Tip of the Iceberg — Titanic Machine Learning Dataset on Kaggle For a beginner, starting a career in data science can be overwhelming. Whether it is showcasing your business acumen, programming skills, exploratory data analysis skills,…

Continue Reading Beginner in Data Science? Focus on Basics with Kaggle Titanic Dataset | by Neet Madan | Feb, 2023

Ionizable drug delivery systems for efficient and selective gene therapy | Military Medical Research

Wang Y, Zhang Z, Luo J, Han X, Wei Y, Wei X. mRNA vaccine: a potential therapeutic strategy. Mol Cancer. 2021;20(1):33–56. Article  CAS  PubMed  PubMed Central  Google Scholar  Kulkarni JA, Witzigmann D, Chen S, Cullis PR, van der Meel R. Lipid nanoparticle technology for clinical translation of siRNA therapeutics. Acc…

Continue Reading Ionizable drug delivery systems for efficient and selective gene therapy | Military Medical Research

how to get around snakemake with different wildcards input to output rule

I am trying to write a rule that has a different wildcard in the input to the output like so: rule MarkDuplicates: input: L01=”result/gatk4/{fc}_L01_{index}_piped.bam”, L02=”result/gatk4/{fc}_L02_{index}_piped.bam”, L03=”result/gatk4/{fc}_L03_{index}_piped.bam”, L04=”result/gatk4/{fc}_L04_{index}_piped.bam” output: bam=”result/gatk4/samplename_index{index}_markedduplicates.bam”, txt=”result/gatk4/samplename_index{index}_markedduplicates_metrics.txt” log: “result/logs/markduplicates/samplename_index{index}.out” benchmark: “result/benchmarks/samplename_index{index}.md.out” container: config[“containers”][“gatk4”] threads: 8 shell: “”” gatk –java-options ‘-Xmx30G’ MarkDuplicates I={params.L01} I={params.L02} I={params.L03} I={params.L04} O={output.bam} M={output.txt}…

Continue Reading how to get around snakemake with different wildcards input to output rule

SCRMshaw Enrich: Undefined symbol: Perl_xs_boot_epilog

I’m using SCRMshaw to predict CRMs and I’m trying to use the enrichment bash script that comes with it. At first it had the problem of Can’t locate Bio/SeqIO.pm in @INC but this was fixed by exporting the path to a BioPerl installation in an Anaconda environment I made for…

Continue Reading SCRMshaw Enrich: Undefined symbol: Perl_xs_boot_epilog

reads aligned concordantly exactly 1 time

Good evening, I’d like to compare the alignment quality of hisat2, bowtie2 and bwa for my files. The first 2 packages output the percentage of reads aligned concordantly exactly 1 time, bwa does not, because does not output alignment summary. The samtools flagstat report is not enough, because it outputs…

Continue Reading reads aligned concordantly exactly 1 time

The cytoplasmic localization of ADNP through 14-3-3 promotes sex-dependent neuronal morphogenesis, cortical connectivity, and calcium signaling

Reese D, Drapeau P. Neurite growth patterns leading to functional synapses in an identified embryonic neuron. J Neurosci: Off J Soc Neurosci. 1998;18:5652–62. Article  CAS  Google Scholar  Yi G, Wang J, Wei X, Deng B. Dendritic properties control energy efficiency of action potentials in cortical pyramidal cells. Front Cell Neurosci….

Continue Reading The cytoplasmic localization of ADNP through 14-3-3 promotes sex-dependent neuronal morphogenesis, cortical connectivity, and calcium signaling

Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

Sia D, Tovar V, Moeini A, Llovet JM. Intrahepatic cholangiocarcinoma: pathogenesis and rationale for molecular therapies. Oncogene. 2013;32(41):4861–70. CAS  Article  Google Scholar  Sungwan P, Lert-Itthiporn W, Silsirivanit A, Klinhom-On N, Okada S, Wongkham S, Seubwai W. Bioinformatics analysis identified CDC20 as a potential drug target for cholangiocarcinoma. PeerJ. 2021;9:e11067. Article …

Continue Reading Differential enrichment of H3K9me3 in intrahepatic cholangiocarcinoma | BMC Medical Genomics

AURKA is a prognostic potential therapeutic target in skin cutaneous melanoma modulating the tumor microenvironment, apoptosis, and hypoxia

Aran D, Hu Z, Butte AJ (2017) xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol 18(1):220. doi.org/10.1186/s13059-017-1349-1 CAS  Article  PubMed  PubMed Central  Google Scholar  Bajor DL, Mick R, Riese MJ, Huang AC, Sullivan B, Richman LP, Torigian DA, George SM, Stelekati E, Chen F, Melenhorst JJ, Lacey SF,…

Continue Reading AURKA is a prognostic potential therapeutic target in skin cutaneous melanoma modulating the tumor microenvironment, apoptosis, and hypoxia

MBEDTLS 2.27.0 and stack – githubhot

Since MBEDTLS 2.27.0 is merged, a call to mbedtls_x509_crt_verify() fails: E/TC:? 0 E/TC:? 0 User mode data-abort at address 0x10ff3c (write permission fault) E/TC:? 0 fsr 0x0000080f ttbr0 0x24067859 ttbr1 0x24060059 cidr 0x2 E/TC:? 0 cpu #0 cpsr 0x60000130 E/TC:? 0 r0 0x0010ff38 r4 0x0010fb38 r8 0x00110380 r12 0xfffd34b4 E/TC:?…

Continue Reading MBEDTLS 2.27.0 and stack – githubhot

r – ggplot2 and grid.arrange, place legend below arranged plots

I am facing a problem when I arrange 2 ggplots next to each other using grid.arrange(). I want to place a legend evenly below both plots. So I have (pseudocode): p1 <- ggplot(data = df, aes(group = name, color=as.factor(fac), y = ys, x= (xs))) + geom_point() + geom_line() + theme(legend.position=”bottom”)…

Continue Reading r – ggplot2 and grid.arrange, place legend below arranged plots

Frontiers | Association of Maternal Dietary Habits and MTHFD1 Gene Polymorphisms With Ventricular Septal Defects in Offspring: A Case-Control Study

Introduction Congenital heart disease (CHD) refers to a group of anatomic heart and great vessel malformations that arise during the embryologic development of the fetus. CHD is one of the most prevalent birth defects, affecting around 2.50 out of every 1,000 births in China (1), and it imposes a substantial…

Continue Reading Frontiers | Association of Maternal Dietary Habits and MTHFD1 Gene Polymorphisms With Ventricular Septal Defects in Offspring: A Case-Control Study

bwa , 2 files fastq to 1 sam

bwa , 2 files fastq to 1 sam 1 i have this problem, please, help me, I’m trying it too from Mac OS Catalina I am creating a sam file, with 2 fastq files, using bwa I apply the following command bwa mem -t 2 GRCh38.primary_assembly.genome.fa.gz V350019555_L03_B5GHUMqcnrRAABA-556_1.fq.gz V350019555_L03_B5GHUMqcnrRAABA-556_2.fq.gz > V350019555_L03_B5GHUMqcnrRAABA-556.sam…

Continue Reading bwa , 2 files fastq to 1 sam

[Bug 1951032] Autopkgtest regression report (glibc/2.31-0ubuntu9.4)

All autopkgtests for the newly accepted glibc (2.31-0ubuntu9.4) for focal have finished running. The following regressions have been reported in tests triggered by the package: snapd-glib/1.58-0ubuntu0.20.04.0 (armhf) apt/2.0.6 (armhf) libmath-mpfr-perl/4.13-1 (armhf) art-nextgen-simulation-tools/20160605+dfsg-4 (armhf) ruby-nokogiri/1.10.7+dfsg1-2build1 (armhf) r-cran-rgdal/1.4-8-1build2 (armhf) arrayfire/3.3.2+dfsg1-4ubuntu4 (armhf) libpango-perl/1.227-3build1 (armhf) libimage-sane-perl/5-1 (s390x) ruby-bootsnap/1.4.6-1 (arm64) mle/1.4.3-1 (ppc64el, arm64) libsyntax-keyword-try-perl/0.11-1build1 (armhf)…

Continue Reading [Bug 1951032] Autopkgtest regression report (glibc/2.31-0ubuntu9.4)

Sp.stats and PyMC3 logps different – Questions

Hi everyone, I am fitting a geometric distribution to the following data: [40000, 600, 1500, 30000, 12000, 25000, 65000, 1500, 40000, 10000000, 25000, 2000, 2000, 500, 800, 1500, 30000, 850, 25000, 1000, 15000, 40000, 9000, 3000, 12000, 1000, 1000, 1500, 10000, 25000, 7000, 35000, 30000, 25000, 750, 20000, 7000, 1500,…

Continue Reading Sp.stats and PyMC3 logps different – Questions

Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Continue Reading Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Exec format error in unmapped bam file

Exec format error in unmapped bam file 0 Hello I created unmapped bam file from fastq file (sample 1). When I tried to search the bam file using query name, I got the ‘Exec format error’ #1_ucheck.bam: unmapped bam file from Sample 1 fastq file code: samtools view 1_ucheck.bam |…

Continue Reading Exec format error in unmapped bam file

MAPQ (Mapping quality) of 0 for most reads from BWA-MEM2 (with no secondary alignment or other apparent reason)

Hello, I got a very weird output from BWA-mem2 – most of the reads have mapping quality of 0, even though there is no secondary alignment or anything else suspicious. I got sequencing data that was aligned with Novoalign to hg18, the data was bam files. I needed to realign…

Continue Reading MAPQ (Mapping quality) of 0 for most reads from BWA-MEM2 (with no secondary alignment or other apparent reason)

Does Hisat2 automatically align strandedness

Does Hisat2 automatically align strandedness 0 I’ve been using Hisat2 to align some RNA. RNA was prepped using NEB Directional library kit. When I originally aligned, I did not use the –rna-strandedness option. I then realised I do want stranded, as part of my reference (which is human genome plus…

Continue Reading Does Hisat2 automatically align strandedness

Paired-end reads reported without mates: how to play matchmaker?

Hi Everyone, I am currently looking at Acute Myeloid Leukemia (AML) paired-end WGS samples from the TARGET data ocg.cancer.gov/programs/target/target-methods#3241. A bioinformatician in our group remapped the samples from hg19 to hg38. Unfortunately, we do not have any copies of the hg19 version anymore. However, when I try to run anything…

Continue Reading Paired-end reads reported without mates: how to play matchmaker?

Bwa sampe error 999

Bwa sampe error 999 25-08-2021 I’m getting the following error message when I try to import into 1aa.vremenagoda54.ru file (using samtools import). [samopen] SAM header I’m using bwa aln to find coordinates and bwa sampe to…

Continue Reading Bwa sampe error 999

No cell barcode information in BAM files.

No cell barcode information in BAM files. 0 My BAM file seems to be missing information on cell barcodes. I find that each BAM file represents the sequencing result of a cell. Here’s what I found when I combined dozens of BAM files. Can someone tell me how to find…

Continue Reading No cell barcode information in BAM files.

Mapping quality and XS score

Mapping quality and XS score 0 Hi, I am currently looking through bam files using igv to manually check if the mutations not called by Mutect2 are really an error or not. Until now, to filter reads with low quality, I have used only MAPQ > 30 and didn’t consider…

Continue Reading Mapping quality and XS score

How to convert mapping bam file to fastq without loseing the mapping information

How to convert mapping bam file to fastq without loseing the mapping information 0 Hi all, I want to create my RNA mapping data into a library for further analysis. Now I have bowtie2 mapping data, which is in bam files, I now use bedtools to extract fastq mapping reads…

Continue Reading How to convert mapping bam file to fastq without loseing the mapping information