How can I find reads for specific elements in a bam file?

Hi, I have a specific set of 1,009 elements in a bed file that I am interested in. I also have bam files which I would like to process to know the number of reads for these specific elements (for comparison purposes). I understand some simple uses of samtools commands,…

Continue Reading How can I find reads for specific elements in a bam file?

converting Bam to fastq while removing clipping(hard/soft clip bases)

converting Bam to fastq while removing clipping(hard/soft clip bases) 0 Hello, I want to do some analysis and my raw data is paired-end reads fastq files. So far: I used BWA mem to convert them to Sam file then used samtools to convert to BAM file. My next step is…

Continue Reading converting Bam to fastq while removing clipping(hard/soft clip bases)

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Precomputed secondary structure prediction from sequence

Precomputed secondary structure prediction from sequence 2 Hi, Most services that predict secondary structure from sequence, such as psipred, have an online webserver or a program you’d have to run locally (which would take quite a bit for a whole proteome). e.g. bioinf.cs.ucl.ac.uk/psipred/result/0fc9a438-c3d8-11e3-a745-00163e110593 I was wondering if anyone knew a…

Continue Reading Precomputed secondary structure prediction from sequence

Dataset of scraped Tinder pics poof from Kaggle after Tinder complains

Dataset of scraped Tinder pics poof from Kaggle after Tinder complains Folks of Tinder, a dataset of 40,000 scraped Tinder personal photos, caused an uproar and was taken out of Kaggle at Tinder’s demand. not earlier got installed assortment days. Tinder was actually ticked after 40,000 shape images were scraped…

Continue Reading Dataset of scraped Tinder pics poof from Kaggle after Tinder complains

Combining RNA-Seq read counts from 2 lanes of the same sample (.txt file)

Hi, I have a question on combining read counts from 2 lanes of the same sample. I have a very large RNA-Seq dataset downloaded from the NCBI GEO. The data files are in the *.txt format and each sample with 2 lanes obtained from featureCounts. I would like to perform…

Continue Reading Combining RNA-Seq read counts from 2 lanes of the same sample (.txt file)

Illumina hiring Bioinformatics Software Engineer 2 in San Diego, California, United States

Illumina’s Customer Collaboration & Innovation (CCI) team transforms the relationship between top-tier customers and our Product Development organization, and we are looking for a select individual to join the team as a Bioinformatics Software Engineer 2. The team works externally with a small number of Illumina’s top customers to design…

Continue Reading Illumina hiring Bioinformatics Software Engineer 2 in San Diego, California, United States

New PacBio Library Prep Method Helps Cover ‘Death Valley’ Between Short and Long Reads

ST. PAUL, MINNESOTA – Researchers from the University of Minnesota have developed a library preparation method for Pacific Bioscience’s Sequel platform that addresses the challenge of sequencing DNA molecules that are too long for short reads but not long enough to make long-read sequencing cost effective. Their solution: link up…

Continue Reading New PacBio Library Prep Method Helps Cover ‘Death Valley’ Between Short and Long Reads

Cathie Wood Makes Adjustments To Portfolio In August

Summary The guru boosted five existing holdings. Wood entered new positions in two SPACs. She also trimmed her CRISPR Therapeutics stake. Catherine Wood (Trades, Portfolio) disclosed last week her firm, ARK Investment PZN Management, made a number of changes to its portfolio in August. Wood, who is the founder, chief investment officer…

Continue Reading Cathie Wood Makes Adjustments To Portfolio In August

Haplotype divergence supports long-term asexuality in the oribatid mite Oppiella nova

Significance Putatively ancient asexual species pose a challenge to theory because they appear to escape the predicted negative long-term consequences of asexuality. Although long-term asexuality is difficult to demonstrate, specific signatures of haplotype divergence, called the “Meselson effect,” are regarded as strong support for long-term asexuality. Here, we provide evidence…

Continue Reading Haplotype divergence supports long-term asexuality in the oribatid mite Oppiella nova

Mystery Salmonella Oranienburg Outbreak strikes 127 in 25 states

Likely linked to restaurant exposures – Texas hardest hit. On September 2, 2021, CDC identified an outbreak of 20 Salmonella Oranienburg infections. Since then, the outbreak has grown rapidly. As of September 15, 2021, 127 people infected with the outbreak strain of Salmonella Oranienburg have been reported from 25 states….

Continue Reading Mystery Salmonella Oranienburg Outbreak strikes 127 in 25 states

BTA, BTLA – Antibody Engineering, ADC Engineering (m/f/d), Heidelberg – VERAXA Biotech GmbH – Biology & Life Sciences

Veraxa Biotech GmbH is a young spin-off of the EMBL (European Molecular Biology Laboratory) in Heidelberg and specializes in the rapid and functional screening of antibodies using droplet-based microfluidic technology as well in the engineering of antibodies to yield superior antibody-drug-conjugates (ADC). Compared to current antibody screening methods, Veraxa’ technology…

Continue Reading BTA, BTLA – Antibody Engineering, ADC Engineering (m/f/d), Heidelberg – VERAXA Biotech GmbH – Biology & Life Sciences

ASM1227490v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::02/09/2021 05:00:21 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::4,608 CDSs (total)::4,469 Genes (coding)::4,408 CDSs (with protein)::4,408 Genes (RNA)::139 rRNAs::10, 9, 9 (5S, 16S, 23S) complete rRNAs::10, 9,…

Continue Reading ASM1227490v1 – Genome – Assembly

GenBank Biologist – Bethesda, MD

Job Description Interested in an exciting and rewarding alternative career in the biosciences? Tired of bench work? Enjoy puzzles and problem solving? Incredibly detail oriented? If you answered yes to these questions, consider joining our team of highly skilled and dedicated scientists working on site at the National Center for…

Continue Reading GenBank Biologist – Bethesda, MD

POSTDOCTORAL FELLOW IN TRANSCRIPTOMICS AND BIOINFORMATICS

We are looking for an enthusiastic and ambitious postdoctoral fellow to study the pathophysiological bases of vascular anomalies via an integrated analysis of “omics” data (incl. single cell and bulk transcriptome, methylome, genome). The postdoctoral fellow will participate in all the omic aspects of the studies, from data analysis and…

Continue Reading POSTDOCTORAL FELLOW IN TRANSCRIPTOMICS AND BIOINFORMATICS

deepmind alphafold github

The program handily beat all competitors, in what one . This will allow us to run alphafold only using CPU ( which is what our VM has). From the developers’ original publication: “The provided inference . The AlphaFold method. Found insideThis book constitutes the refereed proceedings of the First International…

Continue Reading deepmind alphafold github

FDA clears IND application for CRISPR-edited T-cell receptor therapy to treat AML

September 17, 2021 1 min read ADD TOPIC TO EMAIL ALERTS Receive an email when new articles are posted on Please provide your email address to receive an email when new articles are posted on . “ data-action=”subscribe”> Subscribe We were unable to process…

Continue Reading FDA clears IND application for CRISPR-edited T-cell receptor therapy to treat AML

Alternative to samtools quickcheck with bash scripting

Alternative to samtools quickcheck with bash scripting 1 Is there an alternative to samtools quickcheck? I need to perform a check some bam files in order to verify that they’re not truncated. Nevertheless, I can’t use samtools since in the linux machine where I have the data I can’t install…

Continue Reading Alternative to samtools quickcheck with bash scripting

gnomAD v3 link not working for download

gnomAD v3 link not working for download 1 your URL is wrong. $ wget -q -O – “https://storage.googleapis.com/gcp-public-data–gnomad/release/3.1.1/vcf/genomes/gnomad.genomes.v3.1.1.sites.chr1.vcf.bgz” | gunzip -c | head ##fileformat=VCFv4.2 ##hailversion=0.2.64-1ef70187dc78 ##FILTER=<ID=AC0,Description=”Allele count is zero after filtering out low-confidence genotypes (GQ < 20; DP < 10; and AB < 0.2 for het calls)”> ##FILTER=<ID=AS_VQSR,Description=”Failed VQSR filtering…

Continue Reading gnomAD v3 link not working for download

Gradle Build Error With Intellij

You can verify the problem is with Gradle scripts by running gradle help which executes configuration scripts but no Gradle tasks. If the error persists build. More examples on the classpath customization are available here. Tasks view and task execution. In the Eclipse IDE you can execute tasks from the…

Continue Reading Gradle Build Error With Intellij

difference between treat_pileup and bdgcmp fold enrichment tracks macs2

difference between treat_pileup and bdgcmp fold enrichment tracks macs2 0 Hello, I created bigwig file from a treat_pileup.bdg file generated by macs2 and also used treat_pileup.bdg and control_lambda.bdg with macs2 bdgcmp. Here is my codes; macs2 callpeak -t sample.bam -c sample_input.bam -g hs -f BAM -q 0.001 –bdg –outdir /folder…

Continue Reading difference between treat_pileup and bdgcmp fold enrichment tracks macs2

KEGG COMPOUND: C04020

KEGG COMPOUND: C04020     COMPOUND: C04020 Help Entry C04020                      Compound                                Name D-Lysopine;N2-(D-1-Carboxyethyl)-L-lysine;Lysopine Formula C9H18N2O4 Exact mass 218.1267 Mol weight 218.2502 Structure Mol fileKCF fileDB search Reaction Pathway Enzyme Other DBs KCF data Show ATOM        15            1   N1a N    25.5724  -27.5100            2   C1b C    26.7849  -28.2100            3   C1b C    27.9973  -27.5100            4   C1b C    29.2097  -28.2100            5   C1b C    30.4222  -27.5100            6   C1c C    31.6346  -28.2100            7   C6a C    32.8470  -27.5100            8   O6a O    34.0595  -28.2100            9   O6a O    32.8470  -26.1101            10  N1b N    31.6346  -30.1700            11  C1c C    30.4262  -30.8677            12  C6a C    29.2327  -30.1784            13  O6a O    28.0444  -30.8645            14  C1a C    30.4261  -32.2698            15  O6a O    29.2803  -29.0584BOND        14            1     1   2 1            2     2   3 1            3     3   4…

Continue Reading KEGG COMPOUND: C04020

gmod prop hunt console commands

Prop Hunt Extended (Hide and Seek with Props), Want to join the discussion? There are slightly different formats depending on which way the command is entered. dravenjv01’s gmod addons . Sets the hands entity of a player. console commands for Garry’s Mod – GAMERCONFIG .. distance from the player that…

Continue Reading gmod prop hunt console commands

Intellia Therapeutics Set to Enter Clinic with First Solo Ex Vivo Candidate

Courtesy Intellia Therapeutics Intellia Therapeutics is celebrating another first today as the U.S. Food and Drug Administration (FDA) has accepted the Investigational New Drug (IND) application for NTLA-5001, its first wholly-owned ex vivo CRISPR genome editing candidate. NTLA-5001 is being developed for the treatment of acute myeloid leukemia (AML). Intellia…

Continue Reading Intellia Therapeutics Set to Enter Clinic with First Solo Ex Vivo Candidate

what are some good gmod mods | Hypixel

About Us Starting out as a YouTube channel making Minecraft Adventure Maps, Hypixel is now one of the largest and highest quality Minecraft Server Networks in the world, featuring original games such as The Walls, Mega Walls, Blitz Survival Games, and many more! Hypixel Store The administration works very hard…

Continue Reading what are some good gmod mods | Hypixel

Using a CRISPR/Cas9 system in vegetatively propagated berry crops

Fruit and berry crops, as well as grapes, are important parts of the human diet and, at the same time, significant objects of genetic, breeding, biochemical and nutritional research. Traditional approaches to crop research and improvement are now complemented by effective modern genetic technologies. In this review, the research team…

Continue Reading Using a CRISPR/Cas9 system in vegetatively propagated berry crops

De-extinction Could Reverse Species Loss. But Should We Do It?

THE MOST BELOVED BIRD IN HISTORY may very well have been a 29-year-old pigeon by the name of Martha. It was the early 1900s, shortly before the United States entered the First World War, and Martha was at the height of her fame. Perched on her humble roost at the Cincinnati…

Continue Reading De-extinction Could Reverse Species Loss. But Should We Do It?

Scientist III, Bioinformatics – Services Lab job in

About Thermo Fisher Scientific Thermo Fisher Scientific Inc. (NYSE: TMO) is the world leader in serving science, with annual revenue of approximately $35 billion. Our Mission is to enable our customers to make the world healthier, cleaner and safer. Whether our customers are accelerating life sciences research, solving complex analytical…

Continue Reading Scientist III, Bioinformatics – Services Lab job in

Excision’s CRISPR gene editing therapy for HIV is heading into human testing after FDA clearance

A CRISPR-Cas9 gene editing technology that has shown promise in clearing HIV from mice is headed into human testing. Excision BioTherapeutics will usher the CRISPR-based therapy EBT-101 into clinical trials after the FDA cleared an investigational new drug application, according to the company’s press release. EBT-101 is under development as…

Continue Reading Excision’s CRISPR gene editing therapy for HIV is heading into human testing after FDA clearance

The 13 health care leaders on the list

Time this week released its “100 Most Influential People” list, which includes a number of individuals who have made major contributions to health care. The 10 ‘most influential’ health care companies, according to TIME The list This year, TIME recognized several health care providers, scientists, public health officials, and advocates for their…

Continue Reading The 13 health care leaders on the list

Convert UCSC isoform ID to Ensembl transcript ID

Convert UCSC isoform ID to Ensembl transcript ID 2 Hello everyone, I have a few UCSC isoform IDs and I would like to convert them to the corresponding Ensembl transcript IDs. I have tried to use some online conversion tools (such as DAVID), looked up the UCSC annotation files, but…

Continue Reading Convert UCSC isoform ID to Ensembl transcript ID

Computational Biology Jobs

Computational Biology Jobs Full and part time jobs with good salary Computational Biology Jobs. Start your new career with us today! Indeed may be compensated by these employers. BioInformatics Postdoctoral Associate Job Position @ Miami … (Christina Poole) We have had researchers with backgrounds in biology, physics, statistics, math, and…

Continue Reading Computational Biology Jobs

Genes in Space: Students’ experiments could help humans travel in deep space

Students Aarthi Vijayakumar, Rebecca Li, Michelle Sung and David Li won the competition in 2018, and their project became the Genes in Space-6 experiment. The student team’s investigation made history. For the first time in space, NASA astronauts successfully edited DNA using CRISPR/Cas9 technology while working on the Genes in…

Continue Reading Genes in Space: Students’ experiments could help humans travel in deep space

Associate Director, Computational Biology/Bioinformatics Job Opening in Cambridge, MA at Obsidian Therapeutics

About Us… Obsidian Therapeutics is pioneering engineered cell and gene therapies to deliver transformative outcomes for patients. Obsidian’s programs apply our CytoDriveTM technology in Cell and Gene therapy products to control expression of proteins for enhanced therapeutic efficacy and safety. We’re proud of our diverse talented team and committed to…

Continue Reading Associate Director, Computational Biology/Bioinformatics Job Opening in Cambridge, MA at Obsidian Therapeutics

New class of gene-editing enzymes discovered

One of the most revolutionary discoveries of the century, the CRISPR gene-editing system is built on a bacterial defense mechanism that allows scientists to make precise edits to DNA. Now scientists at MIT have discovered a new class of enzymes called OMEGAs that perform a similar function – and perhaps…

Continue Reading New class of gene-editing enzymes discovered

Othram Closes $18M Series B Funding

Othram, The Woodlands, TX-based developer of technology for investigators to crack unsolved law enforcement cases through advanced genomics, raised $18m in Series B funding. The round was led by Gigafund. In conjunction with the funding, Stephen Oskoui, Managing Partner of Gigafund, will…

Continue Reading Othram Closes $18M Series B Funding

Ancient DNA Analysis Highlights Three Ancestral Populations in Japan

NEW YORK – An ancient DNA analysis reaching back thousands of years has provided a more detailed view of the ancestral groups contributing to present-day populations in Japan, uncovering genetic signals from three historical populations spanning pre- and post-agricultural periods. “[O]ur study provides a detailed look into the changing genomic…

Continue Reading Ancient DNA Analysis Highlights Three Ancestral Populations in Japan

How to Create Loop for all fastq file

How to Create Loop for all fastq file 0 Dear All, hope you are doing well. I am trying to write a loop for my all fastq and doing preprocessing using bash. I am taking an error, Can you help me to write bash loops? for file in *.fastq; do…

Continue Reading How to Create Loop for all fastq file

Climate Change Threatens Base of Polar Oceans’ Bountiful Food Webs

Newswise — The cold polar oceans give rise to some of the largest food webs on Earth. And at their base are microscopic, photosynthetic algae. But human-induced climate change, a new study suggests, is displacing these important cold-water communities of algae with warm-adapted ones, a trend that threatens to destabilize…

Continue Reading Climate Change Threatens Base of Polar Oceans’ Bountiful Food Webs

How Data Technology Aims to Improve Space Travel

The problem with exploring space is that it takes too long to travel and send information to Earth. Data technology is the solution as it develops hardware, software, and strategies to make transmissions faster, easier, and more robust. Here’s what experts have accomplished so far in connecting data technology with…

Continue Reading How Data Technology Aims to Improve Space Travel

How Industry Leaders Turn Raw Data Into A Finished Product

As Vice President of Product Management at Qumulo, Ben oversees innovation and builds products that radically simplify file data management. getty When we think of a factory, we imagine smokestacks and machinery. But some of the most innovative production today isn’t happening in a factory warehouse: It’s happening digitally. The “digital…

Continue Reading How Industry Leaders Turn Raw Data Into A Finished Product

New study adds to Caucasus’ brag sheet: Cradle of lettuce

Small countries often like to boast of having been the first to do something special, and the three Caucasus nations are no exception: For Georgia, it’s viniculture; Armenia – adopting Christianity; Azerbaijan was the first secular Muslim republic. So here’s something new for them to claim collectively: Scientists now say…

Continue Reading New study adds to Caucasus’ brag sheet: Cradle of lettuce

Genomic features of a carbapenem-resistant K. oxytoca strain

Introduction Antimicrobial resistance is a global issue associated with an increased and often unrestricted antibiotic use in clinical settings, which leads to the dissemination of carbapenem-resistant Enterobacterales (CRE) in healthcare facilities (World Health Organization, 2017).1 CRE constitutes a large group of bacteria with different mechanisms for drug resistance. Among them,…

Continue Reading Genomic features of a carbapenem-resistant K. oxytoca strain

Is a variant worse than Delta on the way? Viral evolution offers clues.

Somewhere in India last October, a person—likely immunocompromised, perhaps taking drugs for rheumatoid arthritis or with an advanced case of HIV/AIDS—developed COVID-19. Their case might have been mild, but because of their body’s inability to clear the coronavirus it lingered and multiplied. As the virus replicated and moved from one…

Continue Reading Is a variant worse than Delta on the way? Viral evolution offers clues.

Motif FoodWorks to launch myoglobin, a yeast-derived heme-binding protein delivering the ‘flavor and aroma of real meat’

According to the GRAS determination​​ (submitted in April and currently pending with the FDA), the myoglobin preparation – supplied as a frozen liquid – is intended for use at inclusion rates of ≤2%, to “mimic flavors associated with cooked ground meat​” in fresh or frozen plant-based burgers, patties, sausages, and other…

Continue Reading Motif FoodWorks to launch myoglobin, a yeast-derived heme-binding protein delivering the ‘flavor and aroma of real meat’

Researchers identify 28 new foods associated with disease outbreaks

September 17, 2021 2 min read Source/Disclosures Published by: Disclosures: The authors report no relevant financial disclosures. ADD TOPIC TO EMAIL ALERTS Receive an email when new articles are posted on Please provide your email address to receive an email…

Continue Reading Researchers identify 28 new foods associated with disease outbreaks

Extract root(start) and leaf(end) states programmatically in monocle2

Extract root(start) and leaf(end) states programmatically in monocle2 0 Dear bioinformaticians, do you know how to extract starting state and end states from the CDS in monocle2 ? I know I can detect them visually inspecting the States plot after I compute the pseudotime. I am asking if there is…

Continue Reading Extract root(start) and leaf(end) states programmatically in monocle2

Ancient DNA Rewrites Japanese History

An interdisciplinary team of researchers from Japan and Ireland have discovered that modern day populations in Japan have a tripartite genetic origin, rather dual genomic ancestry as previously thought. The study is published in Science Advances. The history of Japan Archaeological data suggests that humans have occupied the Japanese archipelago…

Continue Reading Ancient DNA Rewrites Japanese History

Can someone please explain to me the differences between train, dev and test datasets?

Hey guys, The topic is Hate Speech Detection and I’m using this Kaggle competition: kaggle.com/c/detecting-insults-in-social-commentary I’m also trying to solve this task in a python notebook (.ipynb) using the FARM framework farm.deepset.ai/ and BERT model of huggingface huggingface.co/bert-base-uncased From what I’m understanding is that there are 3 relevant datasets for…

Continue Reading Can someone please explain to me the differences between train, dev and test datasets?

Our immune system is as unique as a fingerprint or our DNA

Double-stranded DNA fragment. Credits: Vcpmartin / Wikimedia / CC BY-SA 4.0 Everyone seems to have a completely unique immune system. Researchers at Utrecht University discovered this immune diversity after mapping antibodies from healthy and sick people. This finding may help explain, for example, why the corona vaccine appears to be…

Continue Reading Our immune system is as unique as a fingerprint or our DNA

Toxic Algae Blooms Are on the Rise. Sequencing Can Help Manage Them.

This was a summer of unprecedented heat and runaway algae. At hundreds of beaches, lakes, and rivers across the US, the public was greeted by signs like this one at Hensley Lake in northern California: “Harmful algae may be present in this water.” Although blue-green algae, known as cyanobacteria, occur…

Continue Reading Toxic Algae Blooms Are on the Rise. Sequencing Can Help Manage Them.

plotting roh from bcftools

plotting roh from bcftools 0 Heys, I am following this small tutorial on how to calculate ROHs from a vcf file using bcftools (samtools.github.io/bcftools/howtos/roh-calling.html) and I am getting this txt file: # This file was produced by: bcftools roh(1.10.2+htslib-1.10.2-3) # The command line was: bcftools roh -G30 –AF-dflt 0.4 my_file.vcf…

Continue Reading plotting roh from bcftools

Creating Heatmaps Of Diffrentially Expressed Genes In Angilent Single-Color Array Analysis

Creating Heatmaps Of Diffrentially Expressed Genes In Angilent Single-Color Array Analysis 0 I am using limma to analyze Agilent’s single color arrays to find differentially expressed genes, using the following procedure. targets <- limma::readTargets(“targets.txt”) project <- limma::read.maimages(targets,source=”agilent”, green.only=TRUE) project.bgc <- backgroundCorrect(project, method=”normexp”, offset=50) project.NormData <-normalizeBetweenArrays(project.bgc,method=”quantile”) design <- paste(targets$Target, sep=””) design…

Continue Reading Creating Heatmaps Of Diffrentially Expressed Genes In Angilent Single-Color Array Analysis

Question about ROH analysis by Plink 1.9

Hi all, I have recently tried to estimate runs of homozygosity (ROH) from my vcf file by using plink 1.9. I ran following code to generate binary files that plink required: plink –vcf myfile.vcf –make-bed –out out_name –no-sex –no-parents –no-fid –no-pheno –allow-extra-chr This vcf file only contains one individual and…

Continue Reading Question about ROH analysis by Plink 1.9

Quast Ouput

Quast Ouput 0 Hi, I have done a assembly statistics of a transcriptome assembly. I have found 102072 headers (“>”) and for that simply i thought that my assmbly has 102072 transcripts and i also considered one transcript as one contig. But when i run the quast i found in…

Continue Reading Quast Ouput

A new compression tool for FASTQ, BAM, VCF and more

Tool:Genozip: A new compression tool for FASTQ, BAM, VCF and more 0 Genozip is a new(ish) compression software for compressing genomic files. It usually compresses x2-x5 times better than standard compression (eg .gz), and it works on all common genomic file formats. I am its developer. It is a lot…

Continue Reading A new compression tool for FASTQ, BAM, VCF and more

How to add metadata to dendrogram of hierarchical clustering in R

How to add metadata to dendrogram of hierarchical clustering in R 0 I have a RNAseq dataset with genes as rows and samples as columns. I have managed to do hierarchical clustering of the samples, and I want to look for subgroups in the disease. I additionally have metadata with…

Continue Reading How to add metadata to dendrogram of hierarchical clustering in R

bowtie2-align died with signal 24 (XCPU) (core dumped)

(ERR): bowtie2-align died with signal 24 (XCPU) (core dumped) 0 Hi all, it is my first time using bowtie2, and I have a problem. I conducted the following command for reads mapping: bowtie2 -q –local -x mm10 -U SRR5839956_trimmed.fq -S SRR5839956.sam It created a 600MB sam file then come with…

Continue Reading bowtie2-align died with signal 24 (XCPU) (core dumped)

Interpreting output of BCFtools RoH

Interpreting output of BCFtools RoH 0 Hello! I am using BCFtools RoH for the first time, and I am having some trouble understanding its output file. The input is a gvcf file with genotype calls for one sample only, and I want to infer where there might be autozygous tracts….

Continue Reading Interpreting output of BCFtools RoH

get read length from sra

get read length from sra 0 hi everyone ! i need a method “api” to retrive reads length form sra thanks in advance rna api seq • 44 views • link updated 38 minutes ago by Renesh &starf; 2.0k • written 2 hours ago by Sar • 0 Login before…

Continue Reading get read length from sra

Database for Enhancers with Coordinates

Database for Enhancers with Coordinates 4 Can anyone recommend some good databases for extracting bed files with enhancer coordinates. I have used UCSC in the past, I was hoping to find some alternatives ChIP-Seq genome • 163 views • link updated 11 minutes ago by Papyrus &starf; 1.3k • written…

Continue Reading Database for Enhancers with Coordinates

ABOUT affymetrix genotyping console (GTC) software and TCGA CNV workflow

ABOUT affymetrix genotyping console (GTC) software and TCGA CNV workflow 0 The TCGA CNV workflow uses Birdsuite to estimate raw copy number (CN). The affymetrix genotyping console (GTC) use similar algorithm developed by broad. Is GTC used to estimate raw CN, too? Otherwise, could GTC output files that could be…

Continue Reading ABOUT affymetrix genotyping console (GTC) software and TCGA CNV workflow

Filtration of paired reads with both length higher than 50 from bam file

Filtration of paired reads with both length higher than 50 from bam file 1 I understand that for filtering reads based on length i can simply use: samtools view -h file.bam | awk ‘length($10) > 50 || $1 ~ /^@/’ | samtools view -bS – > output.bam But how can…

Continue Reading Filtration of paired reads with both length higher than 50 from bam file

How to remove Illumina TruSeq Index adapters reverse (R2 reads )

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Continue Reading How to remove Illumina TruSeq Index adapters reverse (R2 reads )

Gene coordinates for hg19

Gene coordinates for hg19 0 Hi, is there a list which gives for each gene its starting coordinate (chr:pos) and its ending one with respect to the hg19 reference genome? I have a list of positions on hg19 expressed as chr:pos and I have to assign each one to the…

Continue Reading Gene coordinates for hg19

Obtaining The Snp Rs Number With The Chromosomal Position

Obtaining The Snp Rs Number With The Chromosomal Position 3 This question is similar to this one (Get rs number based on position). I have a text file with SNPs in the chr:position format 10:71086 10:72876 10:75794 I was wondering if there is an R package (or perhaps one in…

Continue Reading Obtaining The Snp Rs Number With The Chromosomal Position

GitHub – sdellicour/sars-cov-2_liege

This repo gathers all the input files and scripts related to our study entitled “Exploiting genomic surveillance to map the spatio-temporal dispersal of SARS-CoV-2 spike mutations in Belgium across 2020” (Bollen et al. submitted): R scripts to prepare, analyse, and visualise the phylogeographic analyses performed in this study, Geographic Information…

Continue Reading GitHub – sdellicour/sars-cov-2_liege

How to merge many huge gVCFs with high speed.

How to merge many huge gVCFs with high speed. 3 Hello, In order to perform population gnomic analysis, I am trying to merge many and huge variants data (gVCF), such as several dozens Gb, over 20 files. Bcftools merge and vcf-merge were used so far but very slow to merge…

Continue Reading How to merge many huge gVCFs with high speed.

The humble peanut reveals how seed sharing makes crops more resilient in a warming world

The global distribution of genes from a single peanut variety has had a profound legacy on our food systems—providing immeasurable food security, and spreading its pest- and disease-resistant traits around the world. These are the findings of a recent study, which traced the genetic contributions made by the species in…

Continue Reading The humble peanut reveals how seed sharing makes crops more resilient in a warming world

Tenure track position in Bioinformatics Jobs in Utrecht at Universiteit Utrecht –

Life is the most complex system known to humankind. Bioinformatics driven data analyses is a unique approach to study life in all its complexity, ranging from molecules to ecosystems. At Utrecht Life Sciences, internationally leading bioinformatic educators and researchers connect to address the complexity of life in different biological and…

Continue Reading Tenure track position in Bioinformatics Jobs in Utrecht at Universiteit Utrecht –

Omics data collection and merging of datasets from different studies

Omics data collection and merging of datasets from different studies 0 Hi! I’m going to do omics analysis on skin basal cell carcinoma. I’m currently trying to find publicly available data to use to make a data collection. I have looked after RNA-seq(high throughput) in GEO and found some studies…

Continue Reading Omics data collection and merging of datasets from different studies

snpEff: annottation problem

snpEff: annottation problem 0 Hi everyone. I am using snpEff on my personal computer, and when I try to annotate a VCF file I get this error: [[0Kjava.lang.OutOfMemoryError: Java heap space[[0KM at java.util.Arrays.copyOfRange(Unknown Source)[[0KM at java.lang.String.<init>(Unknown Source)[[0KM at java.lang.StringBuilder.toString(Unknown Source)[[0KM at java.io.BufferedReader.readLine(Unknown Source)[[0KM at java.io.BufferedReader.readLine(Unknown Source)[[0KM at org.snpeff.fileIterator.LineFileIterator.readNext(LineFileIterator.java:46)[[0KM [[0K at…

Continue Reading snpEff: annottation problem

How to gain bioinformatics experience coming from a wet lab/ biology background? : bioinformatics

I am a recent graduate of a neuroscience master’s degree looking to branch out into a more bioinformatics based future career. My main problem is that most jobs/PhDs with a bioinformatics focus will already expect experience in bioinformatics as a prerequisite, whilst I do have some experience of analyzing RNA-seq…

Continue Reading How to gain bioinformatics experience coming from a wet lab/ biology background? : bioinformatics

Director (Translational Bioinformatics) Job Opening in Cambridge, MA at HiFiBiO Therapeutics

EMAIL* UPLOAD YOUR RESUME By clicking Agree, I consent to our data usage policies as stated here By agreeing to submit your resume, you consent (in accordance with our Terms of Use and Privacy Policy) to: A) Salary.com storing your resume for purposes of providing you with the job posting…

Continue Reading Director (Translational Bioinformatics) Job Opening in Cambridge, MA at HiFiBiO Therapeutics

The Problem With the Idea To Bring Back Woolly Mammoths

An illustrated recreation of a woolly mammoth, on display at the Royal Victoria Museum, British Columbia. Credit: Thomas Quine/Flickr, CC BY 2.0 Like Sergey Zimov’s ‘Pleistocene Park’, George Church’s company Colossal plans to repopulate the Arctic tundra with woolly mammoths. Church, a genetic engineering expert, plans to splice mammoth genes…

Continue Reading The Problem With the Idea To Bring Back Woolly Mammoths

Bioconductor – ecolitk

    This package is for version 2.9 of Bioconductor; for the stable, up-to-date release version, see ecolitk. Meta-data and tools for E. coli Bioconductor version: 2.9 Meta-data and tools to work with E. coli. The tools are mostly plotting functions to work with circular genomes. They can used with…

Continue Reading Bioconductor – ecolitk

Bioinformatics Scientist – reed.co.uk

We are currently looking for a Bioinformatics Scientist to join a leading biotech company based in the Cambridge area. As the Bioinformatics Scientist you will drive the development of computational tools and perform omics data analysis to support target identification and therapeutics development platforms KEY DUTIES AND RESPONSIBILITIES: Your duties…

Continue Reading Bioinformatics Scientist – reed.co.uk

CigarOperator – htsjdk 2.2.4 javadoc

Latest version of com.github.samtools:htsjdk javadoc.io/doc/com.github.samtools/htsjdk Current version 2.2.4 javadoc.io/doc/com.github.samtools/htsjdk/2.2.4 package-list path (used for javadoc generation -link option) javadoc.io/doc/com.github.samtools/htsjdk/2.2.4/package-list Read more here: Source link

Continue Reading CigarOperator – htsjdk 2.2.4 javadoc

Is there any software that can use ATAC-seq to identify super enhancer

Is there any software that can use ATAC-seq to identify super enhancer 1 Hello Everyone! Has anyone tried to identify super-enhancers by using ATAC-seq? I am wondering whether some one can recommend some software 🙂 Thanks a lot in advance for your comments and ideas! Best wishes Guandong Shang ATAC-seq…

Continue Reading Is there any software that can use ATAC-seq to identify super enhancer

Genetic trigger for type 1 diabetes may be in the lungs

Researchers at The University of Auckland have stated that a major genetic trigger for type 1 diabetes — which leaves a person unable to produce enough insulin to keep their blood sugar in a normal range — may act in the lung, suggesting that lung infections could trigger the onset…

Continue Reading Genetic trigger for type 1 diabetes may be in the lungs

Phylogeographic reconstruction of the marbled crayfish origin

Procambarus fallax collections and PCR genotyping Animals were collected from various wild populations (Table S1) in compliance with state and local regulations (Georgia department of natural resources scientific collection permit 115621108, state of Florida collection permits S-19-10 and S-20-04). DNA was isolated from abdominal muscle tissue using SDS-based extraction and precipitation…

Continue Reading Phylogeographic reconstruction of the marbled crayfish origin

Exploiting genomic surveillance to map the spatio-temporal dispersal of SARS-CoV-2 spike mutations in Belgium across 2020

1. Dudas, G. et al. Virus genomes reveal factors that spread and sustained the Ebola epidemic. Nature 544, 309–315 (2017). ADS  CAS  Article  Google Scholar  2. Kafetzopoulou, L. E. et al. Metagenomic sequencing at the epicenter of the Nigeria 2018 Lassa fever outbreak. Science 363, 74–77 (2019). ADS  CAS  Article …

Continue Reading Exploiting genomic surveillance to map the spatio-temporal dispersal of SARS-CoV-2 spike mutations in Belgium across 2020

gmod advanced duplicator 2

Advanced Duplicator 2 is a Garry’s Mod addon which implements a tool similar to the Duplicator, but with many added features. Yeah no problem mate, thanks for the response. I’m done with gmod and I don’t take requests, so please stop spamming the comment section. “Originally published in single magazine…

Continue Reading gmod advanced duplicator 2

Online Medical Coding Jobs For freshers- Plant Biotechnology grad in I skills Medical Coding Solutions at Chennai (Tamil Nadu) – Job Description

IskillsSolutions HR Nandhini 7358407557(whatsapp) info@iskillssolutions.com Job Description: Position: Medical Coder. Medical Coding is the process of converting Verbal Descriptions into numeric or alpha numeric by using ICD 10-CM, CPT && HCPCS . Eligibility: All (UG/PG) Life Science& Paramedical Graduates Bsc Msc Dip Medical Lab Tech Nursing GNM/DGNM Biomedical Biochemistry Biotechnology…

Continue Reading Online Medical Coding Jobs For freshers- Plant Biotechnology grad in I skills Medical Coding Solutions at Chennai (Tamil Nadu) – Job Description

Flat Volcano plot

Flat Volcano plot 0 Hello everyone I have performed differential expression analysis on human dataset (GPL14550 Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version)). I have 12 samples of Th1 and Th2 sample type. At the end I visualized the top genes using volcano plot and it came…

Continue Reading Flat Volcano plot

Shen Bin/Lou Xin team achieves efficient and accurate editing of zebrafish mitochondrial DNA

Mitochondrial diseases are a major genetic disease. The prevalence rate among newborns in the United States is about 1 in 5000. China currently lacks complete epidemiological data on mitochondrial diseases. At present, nearly 300 genes that cause mitochondrial diseases are known, including both mitochondrial DNA (mtDNA) coding and nuclear DNA…

Continue Reading Shen Bin/Lou Xin team achieves efficient and accurate editing of zebrafish mitochondrial DNA

Bioinformatics Engineer job with Paramount Recruitment

Bioinformatics Engineer – London Paramount is working closely with a client who is now moving towards a future of enabling faster, deeper genomic research, bringing genomic healthcare to all who need it. They are now urgently looking for a Bioinformatics Engineer to join their team in London. As a Bioinformatics…

Continue Reading Bioinformatics Engineer job with Paramount Recruitment

Bioconductor – FunciSNP

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

Continue Reading Bioconductor – FunciSNP

Install alphafold on the local machine, get out of docker.

AlphaFold This package provides an implementation of the inference pipeline of AlphaFold v2.0. This is a completely new model that was entered in CASP14 and published in Nature. For simplicity, we refer to this model as AlphaFold throughout the rest of this document. Any publication that discloses findings arising from…

Continue Reading Install alphafold on the local machine, get out of docker.

Bioinformatics Analyst – Job at NYU Grossman School of Medicine in New York, NY

is one of the nation’s top-ranked medical schools. For 175 years, NYU Grossman School of Medicine has trained thousands of physicians and scientists who have helped to shape the course of medical history and enrich the lives of countless people. An integral part of , the Grossman School of Medicine…

Continue Reading Bioinformatics Analyst – Job at NYU Grossman School of Medicine in New York, NY

GitHub – MD-Anderson-Bioinformatics/EGFR-Structure-Function-Nature-Manuscript

These files contain the source data and code used for the analyses included in the publication Robichaux et al 2021, “Structure-based classification predicts drug response in EGFR mutant NSCLC” These files will be made public at the time of acceptance.The files include but are not limited to: Summary of EGFR…

Continue Reading GitHub – MD-Anderson-Bioinformatics/EGFR-Structure-Function-Nature-Manuscript

python – snakemake multiple parameters for multiple input and single output in snakemake. ConbineGVCFs gatk problem

I have written a rule for CombineGVCFs in gatk4. The rule is as follow all_gvcf = get_all_gvcf_list() rule cohort: input: all_gvcf_list = all_gvcf, ref=”/data/refgenome/hg38.fa”, interval_list = prefix+”/bedfiles/hg38.interval_list”, params: extra = “–variant”, output: prefix+”/vcf/cohort.g.vcf”, shell: “gatk CombineGVCFs -R {input.ref} {params.extra} {input.all_gvcf_list} -O {output} –tmp-dir=/data/tmp -L {input.interval_list}” all_gvcf is the dataset for…

Continue Reading python – snakemake multiple parameters for multiple input and single output in snakemake. ConbineGVCFs gatk problem

gene comparative

gene comparative 0 Hi,Everyone.I am a new guy in bioimformatics.My supervisor gave me a topic “Comparative analysis of functional gene alleles”. But I don’t know what specific work should do. Please give me some advice .Thanks! alleles gene comparative • 10 views • link 2 hours ago by Xh •…

Continue Reading gene comparative

Standard Bioinformatics Analysis of RNAseq data (DGE, Pathway Enrichment, Network analysis) – Freelance Job in Quantitative Analysis – Less than 30 hrs/week – Less than 1 month

We are looking for bioinformatics help to analyze specific data sets available from GEO / NCBI using standard bioinformatics analysis pipeline We will provide the study, design and data We will ask you to create a standard bioanalytical report that will include :– Differential gene expression, clustering – Pathway enrichment/analysis–…

Continue Reading Standard Bioinformatics Analysis of RNAseq data (DGE, Pathway Enrichment, Network analysis) – Freelance Job in Quantitative Analysis – Less than 30 hrs/week – Less than 1 month

Bioinformatics Specialist Job Opening in Baltimore, MD at Personal Genome Diagnostics, Inc.

EMAIL* UPLOAD YOUR RESUME By clicking Agree, I consent to our data usage policies as stated here By agreeing to submit your resume, you consent (in accordance with our Terms of Use and Privacy Policy) to: A) Salary.com storing your resume for purposes of providing you with the job posting…

Continue Reading Bioinformatics Specialist Job Opening in Baltimore, MD at Personal Genome Diagnostics, Inc.

Bioinformatics Scientist – verwaltungs-jobs.ch

EPFL, the Swiss Federal Institute of Technology in Lausanne, is one of the most dynamic university campuses in Europe and ranks among the top 20 universities worldwide. The EPFL employs more than 6,000 people supporting the three main missions of the institutions: education, research and innovation. The EPFL campus offers…

Continue Reading Bioinformatics Scientist – verwaltungs-jobs.ch

Bioconductor – odseq

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see odseq. Outlier detection in multiple sequence alignments Bioconductor version: 3.4 Performs outlier detection of sequences in a multiple sequence alignment using bootstrap of predefined distance metrics. Outlier sequences can make downstream analyses unreliable…

Continue Reading Bioconductor – odseq

Bioinformatics Software Engineer 2 in San Diego, California

Illumina’s Customer Collaboration & Innovation (CCI) team transforms the relationship between top-tier customers and our Product Development organization, and we are looking for a select individual to join the team as a Bioinformatics Software Engineer 2.  The team works externally with a small number of Illumina’s top customers to design…

Continue Reading Bioinformatics Software Engineer 2 in San Diego, California

Electroporation-mediated transcatheter arterial chemoembolization in the rabbit VX2 liver tumor model

Electroporation-mediated transcatheter arterial chemoembolization in the rabbit VX2 liver tumor model – Fingerprint — University of Texas Southwestern Medical Center Sort by Weight Alphabetically Medicine & Life Sciences Electroporation 100% Rabbits 59% Liver 43% Neoplasms 26% Cisplatin 20% Magnetic Resonance Imaging 15% Mass Spectrometry 13% Catheters 11% Cell Membrane Permeability…

Continue Reading Electroporation-mediated transcatheter arterial chemoembolization in the rabbit VX2 liver tumor model

ASM298219v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::01/12/2021 08:24:12 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,192 CDSs (total)::5,077 Genes (coding)::4,870 CDSs (with protein)::4,870 Genes (RNA)::115 rRNAs::9, 8, 8 (5S, 16S, 23S) complete rRNAs::9, 8,…

Continue Reading ASM298219v1 – Genome – Assembly