longer object length is not a multiple of shorter object length
Warning – longer object length is not a multiple of shorter object length 0 I have a counts dataframe of RNA-seq dataset, and got the gene lengths using this code: exons = exonsBy(EnsDb.Hsapiens.v86, by=”gene”) exons = reduce(exons) len = sum(width(exons)) INDEX = intersect(rownames(counts),names(len)) geneLengths = len[INDEX ] counts = counts[INDEX…
A novel causative functional mutation in GATA6 gene is responsible for familial dilated cardiomyopathy as supported by in silico functional analysis
Pérez-Serra, A. et al. Genetic basis of dilated cardiomyopathy. Int. J. Cardiol. 224, 461–472 (2016). PubMed Article Google Scholar Petropoulou, E. et al. Digenic inheritance of mutations in the cardiac troponin (TNNT2) and cardiac beta myosin heavy chain (MYH7) as the cause of severe dilated cardiomyopathy. Eur. J. Med. Genet….
Punjab to procure 3.3 lakh doses of goat pox vaccine to fight Lumpy skin disease
The Punjab government announced on Friday that it will purchase 3.3 lakh additional doses of goat pox vaccine to combat the development of lumpy skin disease among livestock. The Group of Ministers (GoM) formed by Chief Minister Bhagwant Mann made the decision for better disease monitoring and prevention in…
Research Biologist Computational Bioinformatics Geneticist Research Associate Job in WORLDWIDE
Summary The Agricultural Research Service (ARS) is the United States Department of Agriculture’s chief scientific research agency and one of the world’s premiere scientific organizations. ARS Postdoctoral Research Associates are hired to supplement a lead scientist’s research on agricultural problems of high national priority affecting American agriculture. This opportunity is…
Postdoctoral Research Fellow /Associate – Epigenomics/Bioinformatics in Cincinnati, OH for Cincinnati Children’s Hospital Medical Center
Details Posted: 11-Aug-22 Location: Cincinnati, Ohio Salary: Open Categories: Academic / Research Description Computational postdoctoral positions in bioinformatics and epigenomics (computational/experimental) are available at Dr.Yaping Liu’s lab in the Division of Human Genetics. One of the research directions in Dr. Liu’s group is to study single-cell multi-omics data to understand…
SDSC’s Lead for Bioinformatics Receives Award from NIH/NICHD
Aug. 12, 2022 — Peter Rose, director of the Structural Bioinformatics Laboratory at the San Diego Supercomputer Center at UC San Diego, was recently presented with a team award from the National Institutes of Child Health and Human Development (NICHD)–noting his work in the COVID-19 Common Data Elements Working Groups….
Several genes were lost during mammoth evolution.
One way to revive extinct species is the so-called Crispr-Cas9 genetic scissors. Genome editing technology can be used to insert genetic variants from extinct species into the genome, the entire genome, of a living relative. But the results of a new study suggest that it may also be necessary to…
Pandemic-Scale Phylogenomics Reveals The SARS-CoV-2 Recombination Landscape
Accurate and timely detection of recombinant lineages is crucial for interpreting genetic variation, reconstructing epidemic spread, identifying selection and variants of interest, and accurately performing phylogenetic analyses 1–4. During the SARS-CoV-2 pandemic, genomic data generation has exceeded the capacities of existing analysis platforms, thereby crippling real-time analysis of viral evolution…
between results of RNAseq and absence/presence of Type3 Secretion System
Correlation between two different datasets: between results of RNAseq and absence/presence of Type3 Secretion System 1 Dear All, I have a “How would you solve” kind of question. I have two sets of tables : 1. Log2FoldChange table and 2. Effectors Table. Firstly, the Log2FoldChange table was obtained by performing…
In vivo transomic analyses of glucose-responsive metabolism in skeletal muscle reveal core differences between the healthy and obese states
Animals and sample preparation Animal experiments were performed as previously described12. C57BL/6J WT mice or ob/ob mice at ten weeks of age were purchased from Japan SLC Inc. (Shizuoka, Japan). The phenotypic data of the mice are summarized in Table S1. Animal experiments were approved by the animal ethics committee…
Corbevax likely to be available at vaccination centres from today, know price, features, other details
The recently approved heterologous Covid-19 vaccine, Biological E Limited (BE) Corbevax is expected to be available as a booster dose on the COWIN App in both public and private vaccination centres from today – August 12, 2022. Corbevax was approved as India’s First Heterologous Covid-19 Booster Shot for 18…
Research Bioinformatician IV – Bioinformatics (Statistics)
Responsibilities Requisition # HRC0992682 The newly formed Precision Biomarkers Laboratories (PBL) at Cedars-Sinai is seeking a highly skilled bioinformatics professional with an expertise in statistical methods and data applications. This role will be responsible for developing robust statistical measures to evaluate, analyze, and integrate proteomics data for continuous quality control…
Open main menu
Open main menu Close main menu Home Jobs Publications Dr. Peccoud Synthetic Biology Go Home About Menu Item One Menu Item Two Menu Item Three Services Menu Item One Menu Item Two Menu Item Three News Menu Item One Menu Item Two Menu Item Three Follow us on Facebook Follow…
Senior Research Fellow, Quantitative Research Scientist – CHILD job with NATIONAL UNIVERSITY OF SINGAPORE
Job Description An exciting position is available with the NUS Yong Loo Lin School of Medicine’s Centre for Holistic Initiatives for Learning and Development (CHILD) for an enthusiastic, collaborative senior research fellow (research scientist) with strong quantitative skills. The scientist will work within highly transdisciplinary teams across multiple projects aiming…
Research Shows That Mucus Is Your Body’s First Line Of Defense Against Viruses
Ill African American girl blowing a nose at home while her mother is consoling her. getty This story on CRISPR is part of an extended series on Regenerative Medicine. For other stories on this topic see williamhaseltine.com and search for Regenerative Medicine. My definition of Regenerative Medicine is any medical…
Why isn’t GWAS used in oncology?
Forum:Why isn’t GWAS used in oncology? 1 From what I can gather, GWAS is not used in oncology because ~ cancer is characterized by rare/ random mutations that amount to an overall burden on the genes that they up/down regulate. Is this assumption correct? gwas association oncology studies somatic cancer…
Why It Increased Over 20% Today
The stock price of Pasithea Therapeutics (KTTA) increased by over 20% pre-market today. This is why. The stock price of Pasithea Therapeutics (KTTA) – a biotechnology company focused on the discovery, research, and development of new and effective treatments for psychiatric and neurological disorders – increased by over 20% pre-market…
Postdoctoral researcher (24513) – Plant Biotechnology and Bioinformatics
→ Apply before 21/08/2022 (DD/MM/YYYY) 23:59 (Brussels Time) → Department: WE09 – Plantenbiotechnologie en Bio-informatica → Occupancy rate:100% → Number of positions: 1 → Type of employment: Contract of unlimited duration with clause → Term of assignment: Minimum 3 jaar – maximum 6 jaar → Wage scale: PD1 to PD4 (doctoral degree) → Required diploma: PhD ABOUT GHENT UNIVERSITY Ghent University is a world…
Healthcare Additive Manufacturing Market: Potential to Provide Low-cost Methods to Make Personalized and Complicated Medical Parts to Boost Market
Wilmington, Delaware, United States, Transparency Market Research Inc. – The global healthcare additive manufacturing market is growing due to the rising demand for personalized medical devices, such as implants, and the advent of sophisticated technology to manufacture a variety of products with complex and simple designs. Additive manufacturing is widely…
Multidrug resistance microbial therapy | VMRR
Introduction Antimicrobials are the most important and useful therapeutic discovery in the history of medicine. It allows living beings to survive the microbial disease, enhances invasive surgical procedures, ensures animal health, and protects the food chain since 1928 after the discovery of penicillin. However, the indiscriminate use of antibiotics and…
Setting up Aspera Connect (ascp) on Linux and macOS
This tiny tutorial cover setting up Aspera Connect (binary is called ascp) which might be used to download sequencing data, e.g. with download links provided by sra-explorer.info, see also sra-explorer : find SRA and FastQ download URLs in a couple of clicks Setting up Aspera Connect is simple and was…
KEGG ENZYME: 3.6.1.39
KEGG ENZYME: 3.6.1.39 ENZYME: 3.6.1.39 Help Entry EC 3.6.1.39 Enzyme Name thymidine-triphosphatase;thymidine triphosphate nucleotidohydrolase;dTTPase;deoxythymidine-5′-triphosphatase Class Hydrolases;Acting on acid anhydrides;In phosphorus-containing anhydridesBRITE hierarchy Sysname dTTP nucleotidohydrolase Reaction(IUBMB) dTTP + H2O = dTDP + phosphate [RN:R02095] Reaction(KEGG) Substrate Product Comment Also acts, more slowly, on dUTP and UTP. History EC 3.6.1.39 created 1984…
Cancer vaccines for next generation are available for personal use
Through biomarkers and, increasingly, gene sequencing, we have seen significant advances in disease diagnosis. These advances have enhanced our ability to characterize diseases at the molecular level, and they allow us to uncover ever more subtle distinctions between cancerous cells and normal cells. This addition has prompted significant improvements in…
atac seq – Can I use a tool for highly variable gene selection for selecting highly variable “bins” from an ATACSeq dataset?
I’m working with ATACSeq data from multiple tissue/cell types. The data is binned in 1 megabase bins. I’d like to identify the bins that are “highly variable” across the different tissue types. I can’t seem to find a tool to do this, like there exists for identifying highly variables genes…
UK Biobank Copy Number-Based GWAS Discovers New Associations With Human Traits
NEW YORK – A new set of analytical tools is making it possible to systematically search for links between copy number variants and complex human traits or conditions, according to a study by a pair of investigators at the European Molecular Biology Laboratory’s European Bioinformatics Institute. “[W]e present a robust…
2022-2027 Global and Regional Multi-Channel Reagent Reservoirs Industry Status and Prospects Professional Market Research Report Standard Version
The global Multi-Channel Reagent Reservoirs market is expected to reach US$ XX Million by 2027, with a CAGR of XX% from 2022 to 2027, based on Research newly published report. The prime objective of this report is to provide the insights on the post COVID-19 impact which will help market…
Bootcamp02_04_FileFormats.pptx – Bioinformatics File Formats WV-INBRE Bioinformatics Bootcamp 2022 Marshall University Joan C. Edwards School of
Bioinformatics file formats•There are many file formats defined by bioinformaticians•fasta files: define and name sequences•can be DNA, RNA, or protein sequences•fastq files: sequences, typically generated by a sequencer, with “quality”information associated with each sequence•sam/bam files: “sequence alignment mapping” define the results of aligning aset of sequences to another set of…
How to Change Number of Axis Ticks in ggplot2 (With Examples)
You can use the following basic syntax to change the number of axis ticks on plots in ggplot2: p + scale_x_continuous(n.breaks=10) + scale_y_continuous(n.breaks=10) The following example shows how to use this syntax in practice. Example: Change Number of Axis Ticks in ggplot2 Suppose we have the following data frame in…
[SOLVED] ggplot kernal density plot lines overlapping improperly
Code answer’s for “ggplot kernal density plot lines overlapping improperly”. We have found 1 code example at EveryThingWhat under r category. data %>% ggplot(aes(x=amountremain, color=black)) + geom_density() + ylim(0, 10^-5) to_dens <- function(df) { d <- density(df) df_d <- tibble(x = d$x, y = d$y) return(df_d) } df1 <- df…
I cannot install “microbiome”
Hi there, i cannot install package “microbiome” in R (ver 4.2.1), when i input the code, it seems OK, BiocManager::install(“microbiome”, force = TRUE) ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.15 (BiocManager 1.30.18), R 4.2.1 (2022-06-23 ucrt) Installing package(s) ‘microbiome’ trying URL…
hierarchical data – Why my pymc3 model is too slow, takes over 12 hours
part of the code pm means pymc3 size of data_1 & data_2 are 135000*1, so is data_vol with pm.Model(coords=coords) as hierarchical_model: # Hyperpriors mu_a = pm.Normal(‘mu_a’, mu=0, sigma=50) sigma_a = pm.HalfNormal(‘sigma_a’, 10) mu_b = pm.Normal(‘mu_b’, mu=0, sigma=50) sigma_b = pm.HalfNormal(‘sigma_b’, 10) # Intercept a = pm.Normal(‘a’, mu=mu_a, sigma=sigma_a, dims=”data_vol”) #…
Predicine Receives CE-IVD Mark for Blood and Urine Liquid Biopsy Assay
NEW YORK – Molecular testing company Predicine said on Tuesday that its blood and urine cell-free DNA (cfDNA) assay, PredicineCare, has secured a CE-IVD mark. The targeted next-generation sequencing (NGS) assay is developed to detect single nucleotide variants (SNVs), insertions and deletions (indels), DNA rearrangements (fusions), and copy number variations…
Don’t error if there is no pdata
[PATCH] leds: max8997: Don’t error if there is no pdata * [PATCH] leds: max8997: Don’t error if there is no pdata @ 2022-08-07 10:40 Paul Cercueil 2022-08-08 13:16 ` Andy Shevchenko 0 siblings, 1 reply; 2+ messages in thread From: Paul Cercueil @ 2022-08-07 10:40 UTC (permalink / raw) To:…
Window and Pane Management Tricks for RStudio and your OS
Learning the hotkeys for the various programs I use has paid huge dividends in productivity over the years. I can knock out a task in a split second and move on while others are still moving their cursor over the right button. Learning the hotkeys for window management within my…
Bronchoalveolar Lavage Fluid for Metagenomic Sequencing
Introduction Severe pneumonia is one of the most common causes of infectious diseases among patients in the intensive care unit (ICU), and this can lead to various complications and high mortality.1–3 Timely and accurate pathogen diagnoses are crucial for appropriate antimicrobial therapy and improved clinical outcomes. However, the low detection…
Home page
Home page The store will not work correctly in the case when cookies are disabled. JavaScript seems to be disabled in your browser. For the best experience on our site, be sure to turn on Javascript in your browser. Pioneer in Engineered Nucleases technologies from ZFNs and TALENs to CRISPRs…
Celyad Oncology Reports First Half 2022 Financial Results and Recent Business Highlights
Mont-Saint-Guibert, Belgium – Celyad Oncology SA (Euronext & Nasdaq: CYAD) (the ‘Company’), a clinical-stage biotechnology company focused on the discovery and development of chimeric antigen receptor T cell (CAR T) therapies for cancer, announced an update on its financial results and recent business developments for the first half ended June…
KEGG REACTION: R00134
Entry R00134 Reaction Name formate:NADP+ oxidoreductase Definition Formate + NADP+ <=> CO2 + NADPH + H+ Equation Reaction class Enzyme Pathway rn00720 Carbon fixation pathways in prokaryotes rn01120 Microbial metabolism in diverse environments Module M00377 Reductive acetyl-CoA pathway (Wood-Ljungdahl pathway) Orthology Other DBs LinkDB All DBs Read more here: Source link
HIC2 controls developmental hemoglobin switching by repressing BCL11A transcription
Orkin, S. H. Globin gene regulation and switching: circa 1990. Cell 63, 665–672 (1990). Sankaran, V. G. & Orkin, S. H. The switch from fetal to adult hemoglobin. Cold Spring Harb. Perspect. Med. 3, a011643 (2013). PubMed PubMed Central Article CAS Google Scholar Huang, P. et al. Comparative analysis of…
DeepMind has predicted the shape of every protein known to science. How excited should we be?
It doesn’t have much photogenic appeal or the glamour of seeing back in time, but a new development in computational biochemistry has been hailed as a discovery as important as the images of distant galaxies recently seen through the James Webb Space Telescope. Researchers at DeepMind—the AI company owned by…
Nitrogen cycling and microbial cooperation in the terrestrial subsurface
Distribution of nitrogen-cycling pathways in groundwater Differences in nitrogen-cycling processes based on oxygen and nitrate concentrations Sixteen metagenomes (Table S4) were obtained from duplicate wells at four sites (A–D) from two unconfined alluvial aquifers (Canterbury, Fig. S1). These sites encompassed varied nitrate (0.45–12.6 g/m3), DO (0.37–7.5 mg/L), and dissolved organic carbon (DOC) (0–26 g/m3)…
Recent Advances in 3D-Cultured Brain Tissue Models Derived from Human iPSCs
Heffernan, A.L., Hare, D.J.: Tracing environmental exposure from neurodevelopment to neurodegeneration. Trends Neurosci. 41, 496–501 (2018) CAS PubMed Article Google Scholar Pacitti, D., Privolizzi, R., Bax, B.E.: Organs to cells and cells to organoids: the evolution of in vitro central nervous system modelling. Front Cell Neurosci. 13, 129 (2019) CAS …
Interfering B cell receptor signaling via SHP-1/p-Lyn axis shows therapeutic potential in diffuse large B-cell lymphoma | Molecular Medicine
Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403(6769):503–11. CAS PubMed Article Google Scholar Camicia R, Winkler HC, Hassa PO. Novel drug targets for personalized precision medicine in relapsed/refractory diffuse large…
Genotyping Market Analysis, Insights by Emerging Trends, Future Growth, Revenue Analysis, Demand
Genotyping is the process of studying DNA sequence to determine genetic constitution in the genotypes of living organisms, such as humans, plants, animals, and microorganisms. Human genotyping helps in determining fatherhood or motherhood. Genotyping of micro-organisms, including viruses and bacteria, helps in prevention of spreading of pathogens by tracking down…
Cornell Virtual Workshop: Execution: idev (at TACC)
TACC also offers their idev command (for interactive development) as a convenient way to initiate interactive work on their compute nodes, via Slurm. It works very much like srun and even takes many of the same options. But by making a few assumptions, idev shortens the path for you…
KEGG T01015: 107278078
Entry 4330855 CDS T01015 Name (RefSeq) auxin-responsive protein SAUR32 KO K14488 SAUR family protein Organism osa Oryza sativa japonica (Japanese rice) (RefSeq) Pathway osa04075 Plant hormone signal transduction Brite KEGG Orthology (KO) [BR:osa00001] 09130 Environmental Information Processing 09132 Signal transduction 04075 Plant hormone signal transduction 4330855 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam: Auxin_inducible Motif Other DBs…
mathematics – Why math departments buy Mathematica from Wolfram rather than use free SageMath?
mathematics – Why math departments buy Mathematica from Wolfram rather than use free SageMath? – Academia Stack Exchange …
IJMS | Free Full-Text | Anatomical Laser Microdissection of the Ileum Reveals mtDNA Depletion Recovery in A Mitochondrial Neuro-Gastrointestinal Encephalomyopathy (MNGIE) Patient Receiving Liver Transplant
MDPI and ACS Style Boschetti, E.; Caporali, L.; D’Angelo, R.; Malagelada, C.; Accarino, A.; Dotti, M.T.; Costa, R.; Cenacchi, G.; Pironi, L.; Rinaldi, R.; Stanghellini, V.; Ratti, S.; Manzoli, L.; Carelli, V.; De Giorgio, R. Anatomical Laser Microdissection of the Ileum Reveals mtDNA Depletion Recovery in A Mitochondrial Neuro-Gastrointestinal Encephalomyopathy…
The Pitfalls of Evolutionary Genomics
Recent research analyzes mathematical models created to deduce conclusions about how evolution works at the level of populations of organisms. A study examines the benefits and drawbacks of evolutionary genomics. Claudius Ptolemy, an astronomer and mathematician from Alexandria in the second century, had a lofty goal. He wrote the Almagest, a…
Is it possible to use umbrella sampling to simulate the complex membrane model? – User discussions
GROMACS version: 2021.2 HiI need to make some natural pore in the membrane model that contains the different types of lipids (with an asymmetric lipid distribution between the bilayer leaflets) for studying change in these pores under special conditions. I have never done umbrella sampling and I don’t know about…
Bioconductor – cqn (development version)
DOI: 10.18129/B9.bioc.cqn This is the development version of cqn; for the stable release version, see cqn. Conditional quantile normalization Bioconductor version: Development (3.16) A normalization tool for RNA-Seq data, implementing the conditional quantile normalization method. Author: Jean (Zhijin) Wu, Kasper Daniel Hansen Maintainer: Kasper Daniel Hansen <kasperdanielhansen at…
machine learning – How do I extract from Kaggle datasets
I am starting a project, which will use Convolutional Neural Networks to recognize/segment handwritten math characters, and convert it into LaTeX. I am having trouble loading my data into Google Colab. I used a helpful website, towardsdatascience.com/7-ways-to-load-external-data-into-google-colab-7ba73e7d5fc7, which helped me download a dataset from Kaggle. However, when I tried to…
Which is the best type of data for correlation or survival analysis
Hi ATpoint, thanks for your reply and show me the thread. But there are still some questions: (1) dds <- estimateSizeFactors(dds); ntd <- normTransform(dds) would be suggested instead of vst transformation because of elapsed time. May I ask whether the two method could be substituted with each other for correlation…
AlphaFold, Google’s AI that holds the key to finding a cure for cancer or Alzheimer’s
Share Google succeeds in opening the key to finding the cure for diseases such as cancer or Alzheimer̵7;s. AlphaFold, your AI system has the answer. We all know that companies like Google work with systems based on artificial intelligence that are unique in the world and can solve problems that…
U.S Electronic Measuring System Market 2022 New Data Report
Details Overview Of Electronic Measuring System Market Insights 2022 This section discusses about various aspects of Electronic Measuring System sector, including its size, trends, revenue forecasts and Latest Update: This has brought along several changes this report also covers the impact of Current COVID-19 situation. Sample Request Now The Electronic Measuring…
Bioinformatics Analyst at MedGenome Labs
Job Purpose Understand complex research problems and design and implement bioinformatics solutions working with the team members. Job Responsibilities:Understand complex research problems and design and implement bioinformatics solutions working with the team members Support impactful data analysis of high-throughput data generated for clinical diagnosis Understand industry standard pipelines, algorithms and…
1,586 Shares in CRISPR Therapeutics AG (NASDAQ:CRSP) Acquired by Prospera Financial Services Inc
Prospera Financial Services Inc acquired a new position in CRISPR Therapeutics AG (NASDAQ:CRSP – Get Rating) during the 1st quarter, according to its most recent 13F filing with the Securities & Exchange Commission. The institutional investor acquired 1,586 shares of the company’s stock, valued at approximately $100,000. Several other institutional…
Using whole exome data from different protocols
Using whole exome data from different protocols 1 We are doing whole exome sequencing for our samples to identify somatic mutation for a phenotype of our interest. We have used Agilent SureSelect Human All Exon V5+UTRs for some of our samples, and am planning to use Agilent SureSelect Human All…
The TB Vaccine Mysteriously Protects Against Many Things. Now we know why
Something remarkable happened when babies in Guinea-bissau and Uganda were given the tuberculosis vaccine. The tuberculosis vaccine provided broad protection against a variety of unrelated infections, including respiratory illnesses and serious complications such as assepsis. The biological mechanism behind the off-target effects of the tuberculosis vaccination has been pinpointed by…
Solved Which of the following are true about CRISPR
Transcribed image text: Which of the following are true about CRISPR delivery? Non-viral methods result in long term expression of Cas 9 which increases the likelihood of off-target editing. Viruses have naturally evolved tropisms to infect certain cell types, therefore we can harness these viral vectors to deliver Cas 9…
Clinical Scientist (State Registered in Bioinformatics) in Manchester
Main duties of the job To employ all the competences required of a State Registered Clinical Scientist to provide bioinformatics support to diagnose genetic disease. To provide clinical liaison and a high level of scientific knowledge, skill and expertise. To collaborate with other members of the department to achieve an…
CRISPR Therapeutics AG (NASDAQ:CRSP) Receives Consensus Rating of “Moderate Buy” from Brokerages
Shares of CRISPR Therapeutics AG (NASDAQ:CRSP – Get Rating) have been assigned an average recommendation of “Moderate Buy” from the twenty ratings firms that are currently covering the stock, MarketBeat reports. One equities research analyst has rated the stock with a sell rating, five have assigned a hold rating and…
merging data; remove extra rows
merging data; remove extra rows 2 Hi all I have 450 files to merge, but each of them has 6 rows that I don’t need and should be removed from the files. Is there any code to remove the 6 rows and merge them Or merge them first and remove…
Centre to Delhi and 6 states amid rise in Covid cases
As Covid cases are rising in some parts of the country, the Centre has asked Delhi and six states to ensure adequate testing, promote Covid-appropriate behaviour and increase the pace of vaccination to contain the surge. Union Health Secretary Rajesh Bhushan has written a letter to Delhi, Kerala, Karnataka,…
New dual-plasmid editing system for DNA-based information rewriting in vivo
DNA-based information is a new interdisciplinary field linking information technology and biotechnology. The field hopes to meet the enormous need for long-term data storage by using DNA as an information storage medium. Despite DNA’s promise of strong stability, high storage density and low maintenance cost, however, researchers face problems accurately…
Reconstructing How the Spine Takes its Shape
Marina Sanaki-Matsumiya, PhDPostdoctoral FellowLaboratory of Synthetic Developmental BiologyEuropean Molecular Biology Laboratory (EMBL), Barcelona For as long as she can remember, Marina Sanaki-Matsumiya wanted to understand the mechanisms shaping the bones that form our skeletons. Born with a genetic skeletal disease, the developmental biologist first established an in vitro model to…
Feature selection for a binary classifier using mixed cancer type samples
Feature selection for a binary classifier using mixed cancer type samples 0 Hi all, I am not an expert in machine learning (ML) and have a few specific questions regarding the design of a binary classifier. I have bulk RNA-seq data for the samples from 6 different cancer types. These…
Dietary selection of metabolically distinct microorganisms drives hydrogen metabolism in ruminants
Volatile fatty acid production and absorption is modulated by diet Animals were adapted to a starch-rich diet by gradually increasing dietary concentrate content from 50 to 90% over the three 100-d experimental periods (Fig. 1A). With both diets, rumen structure and epithelial morphology were robust and rumen pH remained above 6.0…
The TB Vaccine Mysteriously Protects Against Lots of Things. Now We Know Why –
When babies in the African countries of Guinea Bissau and Uganda were given the tuberculosis vaccine, something remarkable happened. Instead of the vaccine only protecting against the target bacteria – Myocbacterium tuberculosis – the tuberculosis vaccine offered broad protection against a range of unrelated infections, including respiratory infections and serious complications such…
Director, Translational Bioinformatics Job in New Jersey (NJ), Career, Full Time Jobs in Daiichi Sankyo, Inc.
Job Description Join a Legacy of Innovation 110 Years and Counting! Daiichi Sankyo Group is dedicated to the creation and supply of innovative pharmaceutical therapies to improve standards of care and address diversified, unmet medical needs of people globally by leveraging our world-class science and technology. With more than…
Postdoctoral fellow in Bioinformatics with focus on antibiotic resistance
Göteborgs universitet möter samhällets utmaningar med mångsidig kunskap. 56 000 studenter och 6 600 medarbetare gör universitetet till en stor och inspirerande arbetsplats. Stark forskning och attraktiva utbildningar lockar forskare och studenter från hela världen. Med ny kunskap och nya perspektiv bidrar Göteborgs universitet till en bättre framtid. We seek…
Senior Lecturer in Cyber Security and Networks job with UNIVERSITY OF EAST LONDON
Location: Docklands Campus Salary: Starting from £47,183 per annum inclusive of London Weighting Post Type: Full Time Post Type: Permanent Closing Date: Thursday 01 September 2022 Reference: 123A2022 The UEL student body is rich in its diversity; students are drawn from a wide range of backgrounds and age groups, with…
A brain mechanism underlying the evolution of anxiety — ScienceDaily
New research using genome editing technology has allowed scientists to create a model and assess a gene mutation associated with neuropsychiatric disorders in humans. The study has revealed how the mutation functions in the brain and affects anxiety and sociality. Monoamine neurotransmitters such as serotonin and dopamine play important roles…
New Atlas Maps the Continuum of Embryo Development in Fruit Flies
Scientists have constructed the most complete and detailed single-cell map of embryo development in any animal to date, using the fruit fly as a model organism. Published in Science, this study, co-led by Eileen Furlong at EMBL and Jay Shendure at the University of Washington, harnesses data from over one million…
ViReMa not working after adapter trimming
ViReMa not working after adapter trimming 0 Hi, I have a viral RNA-seq dataset that I am trying to run through ViReMa to look for deletion junctions. When I input my fastq files directly into ViReMa without trimming adapters first, my results look about how I would expect (multiple junctions…
The TB Vaccine Mysteriously Protects Against Lots of Things. Now We Know Why
When babies in the African countries of Guinea Bissau and Uganda were given the tuberculosis vaccine, something remarkable happened. Instead of the vaccine only protecting against the target bacteria – Myocbacterium tuberculosis – the tuberculosis vaccine offered broad protection against a range of unrelated infections, including respiratory infections and serious complications such…
Ablation Technologies Market Top Companies, Business Growth & Investment Opportunities
Rising incidences of symptoms such as cancer and cardiac ailments is expected to foster the demand for ablation procedures. Technological advancements to design high-end products and growing demand for treatment procedures, which are minimally invasive are expected to boost the ablation technologies market. Furthermore, rising count of aging population having…
CytoReason hiring Bioinformatics Scientist- Image Analysis in Tel Aviv-Yafo, Tel Aviv, Israel
You will be joining a multi-disciplinary team of bioinformaticians and biologists to tackle the most burning questions of the pharmaceutical industry using cutting-edge data. You will run the pipelines that generate and integrate machine-learning models of the immune system. Disease models are dynamic and constantly improve as data accumulates. These…
Bioinformatics Scientist Job In Dovel Technologies, LLC At
Overview: We are currently searching for a Bioinformatics Scientist to provide support to the National Institutes of Health (NIH). This opportunity is a full-time position with MSC, and it is on-site in Gaithersburg, MD. Duties & Responsibilities: Work independently and collaboratively to develop or optimize procedures that improve the throughput…
Drosophila embryonic development at single-cell resolution
A new atlas that maps the continuum of embryo development in fruit flies has gone beyond, thanks to machine learning. Credit: Isabel Romero Calvo/EMBL Scientists have constructed the most complete and detailed single-cell map of embryo development in any animal to date, using the fruit fly as a model organism….
blast ring image generator PROBLEM
blast ring image generator PROBLEM 0 Good day or evening, in search of a working program for visualizing the complete genome, tried to use BRIG, but instead of the result we got (see fig1) nothing, some one now what the hell ?. I tried to compare 4 genomes of chlamydia…
A jab at the vaccine story
India’s Vaccine Growth Story: From Cowpox to Vaccine Maitri is divided into nine chapters with an epilogue Topics BOOK REVIEW | Literature | Vaccine India’s Vaccine Growth Story: From Cowpox to Vaccine Maitri TO READ THE FULL STORY, SUBSCRIBE NOW NOW AT JUST RS 249 A MONTH. Key…
r – ggtree setting height scale
I’m doing microssatellite analysis to understand genetic relationship between fungal isolates. For that I first calculated the Jaccard’s coefficient and then want to generate a dendrogram using UPGMA cluster analysis. I did the following: jacc_coef <- vegdist(HC_df, method = “jaccard”) *100 (HC_df is my data frame) afu_clin.hc <- hclust(d =…
ggplot2 – Subsetting plots in R with pairs function
I have a simple question however I can’t find the answer. I have a dataset in R with 1000 rows and 5 columns as follows: data <- matrix(rnorm(1000 * 5, mean = 0, sd = 1), 1000, 5) colnames(data) <- c(“A”, “B”, “C”, “D”, “E”) I want to visually examine…
How to avoid “object not found” error with geom_abline?
I am trying to plot lines from a data frame with columns indicating the slope and intercept, but keep on getting an “object not found” error. Here is a reproducible example: library(tidyverse) df <- tibble(intercept = 1, slope = 0.5) df %>% ggplot() + geom_abline(slope = slope, intercept = intercept)…
JetBrains’ Big Data Tools 1.6 keeps track of Flink jobs
Big Data tools 1.6, a plug-in for accessing Zeppelin notebooks, can now also monitor Apache flink and integrate the Hive Metastore. jetbrains has updated the Big Data Tools. In version 1.6, the plug-in for the IDEs IntelliJ IDEA Ultimate, DataGrip, DataSpell and PyCharm Professional offers bug fixes and general improvements…
`r-mixedcca` recipe should not be `noarch`
The mixedCCA R package uses Rcpp and requires compilation. The recently merged recipe, however, is configured for noarch build, which is incorrect. Attempting to use on osx-64 platform results in a dynamic library issue: $ mamba create -yn foo r-base=4.1 r-mixedcca $ mamba activate foo (foo) $ R > library(mixedCCA)…
OpenAPI: combine JAXB and JSON (WRAPPER_OBJECT) correctly?
OpenAPI: combine JAXB and JSON (WRAPPER_OBJECT) correctly? Dear community, I’m a beginner with swagger/openapi. I want write Java classes with annotations and generate documentation by OpenAPI library. In my gradle project I use: implementation “io.swagger.core.v3:swagger-core:2.2.2” implementation ‘io.swagger.core.v3:swagger-annotations:2.2.2’ implementation “io.swagger.core.v3:swagger-jaxrs2:2.2.2” implementation ‘com.fasterxml.jackson.dataformat:jackson-dataformat-yaml:2.13.2’ implementation ‘com.fasterxml.jackson.datatype:jackson-datatype-jdk8:2.13.2’ implementation ‘com.fasterxml.jackson.datatype:jackson-datatype-jsr310:2.13.2’ My demo class is: @XmlRootElement(name…
How to Find Standard Deviation in R?
Being a statistical language, R offers standard function sd(’ ‘) to find the standard deviation of the values. So what is the standard deviation? ‘Standard deviation is the measure of the dispersion of the values’. The higher the standard deviation, the wider the spread of values. The lower the standard…
NATA 2022 Phase 3 admit cards to be out soon at @ nata.in
The NATA 2022 phase 3 exam is scheduled to be conducted on August 7, 2022. Check important details to download NATA 2022 admit card here. NATA 2022 Phase 3 admit cards to be out soon at @ nata.in NATA 2022 admit card: The Council of Architecture is soon going to…
Metagenomics Kits Market Size, Share 2022 By Development, Trend, Key Manufacturers
Metagenomics Kits Market research is an intelligence report with meticulous efforts undertaken to study the right and valuable information. The data which has been looked upon is done considering both, the existing top players and the upcoming competitors. Business strategies of the key players…
Characterizing Salmonella Typhimurium-induced Septic Peritonitis in Mice
This protocol describes the induction of Gram-negative monobacterial sepsis in a mouse model system. The model is useful in investigating the inflammatory and lethal host responses during sepsis. Sepsis is a dysregulated host immune response to microbial invasion or tissue damage, leading to organ injury at a site distant from…
Solved 7. Use the dsDNA sequence below to answer the
Transcribed image text: 7. Use the dsDNA sequence below to answer the following questions. AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT 7a. During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5′ and 3′ ends of each strand….
Targeted inhibition of ubiquitin signaling reverses metabolic reprogramming and suppresses glioblastoma growth
Cell culture Human glioblastoma cells (U87MG and U87MG-Luc) and human embryonic kidney cells (HEK293) were obtained from the American Type Culture Collection (Manassas, Va.). Cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (Gibco™ Fetal Bovine Serum South America, Thermo Scientific Fisher-US), 2 mM l-glutamine, 50 U/ml…
UMaine, UNH researchers to study how foraging adaptations affect Arctic charr resilience or vulnerability to climate change – UMaine News
Photo of former University of Maine graduate student Mitch Paisker releasing a female Arctic charr that was captured, tagged and measured back into Floods Pond in 2018.Photo by Bradley Erdman. University of Maine and University of New Hampshire researchers will investigate how the diversity and evolution of feeding habits among…
Genomic architecture of adaptive radiation and hybridization in Alpine whitefish
Sampling the radiation To understand the phylogenetic relationships between Alpine whitefish, we carried out whole-genome resequencing on 96 previously collected whitefish (with associated phenotypic measurements including standard length and gill-raker counts; collected in accordance with permits issued by the cantons of Zurich (ZH128/15), Bern (BE68/15), and Lucerne (LU04/14); these fish…
Gene Amplification Technologies Market Analysis Report 2022 –
Acumen Research and Consulting has announced the addition of the “Gene Amplification Technologies Market” report to their offering. The Gene Amplification Technologies Market Report 2030 is an in depth study analyzing the current state of the Gene Amplification Technologies Market. It provides brief overview of the market focusing on definitions,…
Pre-existing anti-SARS-CoV-2 immunity decreases viral spread but increase SARS-CoV-2 Omicron competitiveness in hamsters
In a recent study posted to the bioRxiv* preprint server, researchers assessed the impact of pre-existing immunity against severe acute respiratory coronavirus 2 (SARS-CoV-2) acquired by previous infections (PI) or coronavirus disease 2019 (COVID-19) vaccination on the transmission of SARS-CoV-2 variants of concern (VOCs) such as Delta and Omicron. Study:…
Bug#1016498: rope: autopkgtest regression: No module named ‘pkg_resources’
Source: rope Version: 1.2.0-1 Severity: serious User: debian…@lists.debian.org Usertags: regression Dear maintainer(s), With a recent upload of rope the autopkgtest of rope fails in testing when that autopkgtest is run with the binary packages of rope from unstable. It passes when run with only packages from testing. In tabular form:…
Cell-Free DNA NGS Yields Low Detection in Metastatic ccRCC
Cell-free DNA-based next-general sequencing (NGS) yielded low detection rates in patients with metastatic clear cell renal cell carcinoma (ccRCC), according to an analysis published in JCO Precision Oncology. Researchers performed NGS of tumor DNA and plasma DNA using the MSK-IMPACT platform in 110 patients with metastatic ccRCC. They explored detection…