Getting cDNA sequence from NCBI

I am looking at NCBI’s api page and I cannot seem to find any endpoint that returns the cDNA by transcript id.

In fact NCBI nuccore has a webpage for this. and if I want to i can scrape the part coming after ORIGIN. however I guess they do not want this (which I really disagree).

Then the question is, where is their REST api that clearly states how to fetch cDNA by transcript id?

You can use Entrezdirect (sequence truncated):

$ efetch -db nuccore -id "NM_014491.4" -format fasta_cds_na
>lcl|NM_014491.4_cds_NP_055306.1_1 [gene=FOXP2] [db_xref=CCDS:CCDS5760.1] [protein=forkhead box protein P2 isoform I] [protein_id=NP_055306.1] [location=557..2704] [gbkey=CDS]
ATGATGCAGGAATCTGCGACAGAGACAATAAGCAACAGTTCAATGAATCAAAATGGAATGAGCACTCTAA
GCAGCCAATTAGATGCTGGCAGCAGAGATGGAAGATCAAGTGGTGACACCAGCTCTGAAGTAAGCACAGT
AGAACTGCTGCATCTGCAACAACAGCAGGCTCTCCAGGCAGCAAGACAACTTCTTTTACAGCAGCAAACA

I don’t think NCBI provides API to access sequence data. You could use Entrezpi (LINK) or Bio.Entrez (LINK) if you need programmatic access.