How to pass custom software specific variables to nf-core/sarek nextflow pipeline?

How to pass custom software specific variables to nf-core/sarek nextflow pipeline?

0

I’m attempting to call whole genome variants using nf-core/sarek nextflow pipeline. In QC step there is an option that invokes trim_galore quality trimming, but i don’t know how to pass my custom adapters to be cut as well.

Here is an example of trim_galore line i want to adapt to sarek pipeline:

 trim_galore 
--adapter AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA 
--adapter2 AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG 
--quality 20 
--paired 
--no_report_file 
reads1.fq.gz 
reads2.fq.gz

And here is an example of sarek comman line i would like to pass these trim_galore parameters to:

    nextflow run nf-core/sarek 
--input samples.tsv 
--split_fastq 2000000 
--tools 'HaploTypeCaller' 
--genome GRCh38 
--save_reference 
--species 'homo_sapiens' 
-profile singularity 
--trim_fastq 


wgs

• 424 views

Read more here: Source link