PolyAllele Detail

Polymorphism: FLAG_344G02

Name (?)    FLAG_344G02

Date last modified (?)    2006-09-11

Aliases (?)    344G02

Tair Accession    Polymorphism:1009991284

Type (?)   
insertion    Insertion Type (?)    T-DNA

Chromosome (?)   unknown

Mutagen (?)    T-DNA insertion

Mutation Site (?)    gene

Associated Polymorphisms (?)

Insertion (?)  
Species Variant (attribution) (?)   Length   Polymorphic Sequence (?)   Polymorphism Verified  

Associated Nucleotide Sequences (?) Insertion Flanking Sequence   

AGCTTCTCAGGATAAACACTGAAACCTCCAAGTTGTCTTTCCTCTTTGCAGTTTTTTTTC
ATTTGAGCTTCTCTCTGATAAGGGCACTTCCTCTGACCCTTTTATCTAAGCTCAACGCTG
CAACTCTCGCCGACGGATACTTCCCCATTTTCCTTCCTTCTTCCGATTCAAAAACTCAAT
TTTTATTCTCCGGCGTTGAGGATTCATCTCCTAAAAATCTCTGCTTTATCTTTTGATTTG
AGCTGATTCGGAGAGGAGAAGAAGATAGATAGATAGGTAATTCGGATTGAT (Length:291)

GenBank Accession    AJ552830

Map Locations
(?)  
chrom map map type (?) coordinates orientation attrib
1 AGI nuc_sequence 18416450 – 18416729 bp forward  

details

Map Links (?)  
Sequence Viewer
   
GBrowse

   
JBrowse
 

Annotations  
date by annotation
2006-05-16 G Pelletier Laboratory Flanking sequence was derived from the left border.
2006-03-09 GenBank PCR was performed on DNA from transformants of Arabidopsis thaliana plants from INRA (Versailles). The DNA fragment(s) resulting from the PCR were directly sequenced from the left or the right border to determine the genomic sequence flanking the insertion. T-DNA derived sequences were removed. Information to order the corresponding mutant line and a link to a database providing a graphical display of the insertion site are available at dbsgap.versailles.inra.fr/publiclines/. This sequence has been generated in the framework of the French plant genomics program ‘Genoplante’ (www.genoplante.com and genoplante-info.infobiogen.fr).

Community Comments (?) (shows only the most recent comments by default)



 

  
  

Attribution (?)  
type     name     date
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007
submitted_by     GenBank     10/22/2007

Read more here: Source link