insertion | Insertion Type | T-DNA |
---|
Species Variant (attribution) | Length | Polymorphic Sequence | Polymorphism Verified |
---|
AGCTTCTCAGGATAAACACTGAAACCTCCAAGTTGTCTTTCCTCTTTGCAGTTTTTTTTC |
||
GenBank Accession | AJ552830 |
---|
chrom | map | map type | coordinates | orientation | attrib | |
---|---|---|---|---|---|---|
1 | AGI | nuc_sequence | 18416450 – 18416729 bp | forward |
Sequence Viewer GBrowse |
date | by | annotation | |
---|---|---|---|
2006-05-16 | G Pelletier Laboratory | Flanking sequence was derived from the left border. | |
2006-03-09 | GenBank | PCR was performed on DNA from transformants of Arabidopsis thaliana plants from INRA (Versailles). The DNA fragment(s) resulting from the PCR were directly sequenced from the left or the right border to determine the genomic sequence flanking the insertion. T-DNA derived sequences were removed. Information to order the corresponding mutant line and a link to a database providing a graphical display of the insertion site are available at dbsgap.versailles.inra.fr/publiclines/. This sequence has been generated in the framework of the French plant genomics program ‘Genoplante’ (www.genoplante.com and genoplante-info.infobiogen.fr). |
type | name | date | ||
---|---|---|---|---|
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 | ||
submitted_by | GenBank | 10/22/2007 |
Read more here: Source link