adapter trimming using trimmomatic
Hi All,
I ran fastqc on my chipseq dataset and a redflag is raised for overrepresented sequences.
29% of this sequence- GATCGGAAGAGCACACGTCTGAACTCCAGTCACACA (possible source- Trueseq adapter)
I ran trimmomatic for both Trueseq2 and Trueseq3 but both don’t seem to trim anything. Any suggestions?
Thanks,
Ritu
• 456 views
Maybe my answer is not actual now, but: you can use a custom adapter sequence in trimmomatic.
Here are instructions from the trimmomatic manual:
ILLUMINACLIP:<fastaWithAdaptersEtc>:<seed mismatches>:<palindrome clip threshold>:<simple clip threshold>
fastaWithAdaptersEtc: specifies the path to a fasta file containing all the adapters, PCR sequences, etc. The naming of the various sequences within this file determines how they are used. See the section below or use one of the provided adapter files
Just create fasta file with an adapter or other overrepresented sequence and feed it to trimmomatic.
Read more here: Source link