STARaligner not recocognizing “:” Illumina Quality Score Encoding resulting in “quality string length is not equal to sequence length”error?
HI recently I got this fatal error from STARaligner.
EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length
@A00269:556:HHTWKDRXY:1:2234:19696:18286
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
however grepping the fastq I realized that the reason is because there were a few position that had “:”, according to illiumina that is, is a quality score of 25
**CCCGGATACAGGTTTCGCCAGTAGAGAAATCACAGTATACTTTGATAGCATCCATAGTGCATCCTTGGTTAGGGTCAATCCAGTAGTAACCACTGCTCCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
does anyone know how to resolve this?
• 46 views
Read more here: Source link