About trimming adapter and primer sequences from Illumina reads
Hi,
I used trimmomatics to trim my Illumina Hiseq reads with a list that I downloaded from here . (omicsoft.com/downloads/ngs/contamination_list/v1.txt)
But after I assembled the trimmed reads, I tried to upload the assembly to the TSA database in NCBI, they gave me the error saying that my sequence is contaminated by primer sequences. I found one of the contamination sources using vector screen, which is ‘CCCTACACGACGCTCTTCCGATCT‘. But this sequence is actually contained in one of the adapter sequences in the list:
>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
So my question is why the sequence is not trimmed off by trimmomatics?
Is there anyway to remove the contamination from the assembly. So I don’t have to go back to reassemble the sequences?
• 5.2k views
Trimming accuracy varies in different trimmers. I’d recommend atria to determine and trim the adapter sequences. It is a newly-published cutting-edge trimmer with exceptional precision and speed.
To find a concise trimming benchmarks, you can click here.
You can also find more comprehensive trimming benchmark at Atria’s paper.
Traffic: 1416 users visited in the last hour
Read more here: Source link