Hello Biostar community,
I have several .fa sequences I and I want to check if they have some homology, e.g. if they align within each other. To do so, I concatenate all sequences in a single .fa file, create a database on it, and run blast of the interested .fasta file versus created database, excluding this sequence from db by its Sequence ID. However, blastn returns me an error:
Error: NCBI C++ Exception:
T0 "/build/ncbi-blast+-S1iyIZ/ncbi-blast+-2.9.0/c++/src/corelib/ncbifile.cpp", line 5625: Error: ncbi::CMemoryFileMap::CMemoryFileMap() - To be memory mapped the file must exist:
My pipeline looks as following:
cat * > fragments_db.fa
makeblastdb -in fragments_db.fa -input_type fasta -dbtype nucl -parse_seqids -out fragments_db
blastn -query PlasmidA.fa -db fragments_db -negative_seqidlist PlasmidA
When exclude parameter -negative_seqidlist from a command above, blastn works as expected, except it do align sequence to itself
My initial .fasta file looks as following and all SeqIDs are unique:
>PlasmidA
atatatgtcaaagaatttagtaaactgtaagacaaaatttaaatgcaagctgttgactat
Could you give me a hint where my problem may come from?
Thank you
Read more here: Source link
