Solved 7. Use the dsDNA sequence below to answer the

Transcribed image text:

7. Use the dsDNA sequence below to answer the following questions. AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT 7a. During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5′ and 3′ ends of each strand. (2) 7b. This segment of DNA includes the entire coding region of a gene. Which is the template strand and which is the coding strand? (3) 7c. What is the amino acid sequence of the protein encoded by this gene? (3) 7d. If a mutation occurred in the position from the left, changing the top/ bottom base pair to an A top/ bottom base pair, what kind of mutation would it be? Why? (3)

Read more here: Source link