Extra-hematopoietic immunomodulatory role of the guanine-exchange factor DOCK2

Cell isolation, reprogramming and culture

Approval was obtained for human cell and tissue sample collection and genetic reprogramming from the Institutional Review Board (protocols 19–252, 18–243, 21–060, 19–284 and 415-E/1776/4-2014, Ethics Committee of the province of Salzburg). Adult samples were collected in accordance with the Declaration of Helsinki after written informed consent from healthy volunteers. Umbilical cord blood (UCB) samples were collected after written informed consent by the mother-to-be obtained prior to delivery of full-term pregnancies. MSPCs from bone marrow (BM) and UCB were isolated and expanded under animal serum-free conditions using pooled human platelet lysate (hPL) replacing fetal bovine serum and their purity, identity, and viability was characterized by flow cytometry as previously described47,48,49,50. Clonogenicity and differentiation capacity was assessed as previously described51. Peripheral blood mononuclear cells (PBMCs) were isolated by density centrifugation from random donor buffy coats as described7.

Induced pluripotent stem cells (iPSCs) were reprogrammed from primary MSPCs (derived from BM or UCB) by non-integrative Sendai Viral vector kit (CytoTuneTM-iPS Sendai Reprogramming Kit encoding for Oct4, Sox2, KLF4 and c-Myc, Life Technologies Cat.No. A1378001) by the Harvard Stem Cell Institute (HSCI) iPS Core Facility (Cambridge, MA, USA). The reprogramming protocol was described by Fusaki and colleagues in 200952 and adapted by the HSCI. Human iPSCs were characterized by cytogenetic analysis of at least twenty G-banded metaphase cells per clone and teratoma formation. The iPSC clones were registered at hpscreg.eu/ including detailed information.

Human iPSCs were initially transferred from mouse embryonic feeder layers to feeder-free conditions and thereafter maintained on a selected batch of Matrigel® (Corning) in mTeSRTM1 (STEMCELL Technologies) medium. When reaching a cell density appropriate for splitting, iPSCs were harvested using Gentle Cell Dissociation Reagent (STEMCELL Technologies). Viable cells were counted and seeded at a density of 5 × 104 cells per cm2 on Matrigel® in mTeSRTM1 containing 10 µM Y-27632 ROCK pathway inhibitor (Selleckchem). After 24 h, the medium was changed to STEMdiff™ Mesoderm Induction Medium (STEMCELL Technologies) and the medium was replaced daily for the next consecutive four days. On day five, cells were harvested using TrypLETM (Thermo, Cat.12563-029) and the expression of early mesoderm markers brachyury and CD56 was determined by flow cytometry. Cells were seeded in EGMTM-2 containing hydrocortisone, human fibroblastic growth factor basic (hFGF-B), vascular endothelial cell growth factor (VEGF), recombinant insulin-like growth factor (R3-IGF), ascorbic acid, human epidermal growth factor (hEGF) (all Lonza, Basel, CH), preservative-free heparin 10 IU/mL (Biochrom), 5 mM N(2)-L-alanyl-L-glutamin (Dipeptiven®, Fresenius Kabi, Austria), 10% hPL and 10 µM Y-27632 at a cell density of 27,000 cells/cm2 without Matrigel® coating and cultured in humidified incubators (Binder CB210) at 37 °C and 5% CO2 in ambient air. Until passage five, iPS-MSPCs were passaged at a density of 27,000 cells/cm2 twice weekly with addition of Y-27632. For microscopical documentation EVOS XL (Thermo Fisher Scientific) was used. Differentiation assays were performed with iPSCs reprogrammed from MSPCs derived from BM (4 clones) or UCB (3 clones).

DOCK2-deficient patient cells: Biallelic mutations in DOCK2 were identified and confirmed by Sanger sequencing in both patients. Patient 1 was homozygous for DOCK2 dinucleotide insertions leading to frameshift and premature termination, Patient 2 was compound heterozygous for different missense and nonsense DOCK2 mutations. Multiple sequence alignment showed that missense mutations affect evolutionarily conserved residues28. An additional request by one reviewer was to also create additional iPSCs from the existing patient fibroblasts. We did not fulfill this request in the review process because the generation of iPSCs would require new IRB votes to be submitted in the respective centers by the responsible transplant physician or pediatrician plus consent by the parents. As we are blinded to the identity of the cell donors, we are not aware of the fate of the children since transplantation. Furthermore, it is not clear whether we get access to the patient information required to contact the parents because legal regulation in most countries prohibits disclosure of patient (and donor) identity outside transplant registries.

DOCK2 knockout

For introduction of a knockout of the DOCK2 gene (NCBI gene ID 1794), the web-based tool CRISPOR (crispor.tefor.net/) was used to identify possible guide sequences that target exon 37 of the DOCK2 gene. Two guide sequences, for which CRISPOR calculated low off-target binding sites and high cutting efficiencies were selected for experimental evaluation (see Supplementary Table 3 for sequences). Subsequently, the selected guides were tested for their cutting efficiency and indel formation frequency by transfection of the iPSCs, sequencing of the target site and analysis using the TIDE algorithm (tide.deskgen.com/). Methodical details are described below. Application of guide-2 resulted in the higher cutting and indel formation frequency (69.4%) and was therefore used for the generation of the knockout clones.

For editing, the Alt-R CRISPR-Cas9 System (Integrated DNA technologies) was used. This included the following reagents: Alt-R® S.p. Cas9 Nuclease V3 (Cat. 1081058), Alt-R® CRISPR-Cas9 tracrRNA (Cat. 1073191) and crRNA (GAAGATCGCGGAGTTTGTAC). The gRNA duplex was generated by formation of crRNA:tracrRNA duplex. Briefly, 5 µL of the specific crRNA (100 µM) and 5 µL of tracrRNA (100 µM) were mixed and incubated for 5 min at 95 °C followed by down cooling to RT for 15 min. The RNP-complex was formed by mixing 2 µL of gRNA duplex and 2 µL of Alt-R® S.p. Cas9 Nuclease V3 (61 µM) and incubation for 35 min at RT.

Transfections were carried out using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza, Cat. V4XP-3024) with program CM150 in the Lonza NucleofectorTM device (Core Unit and X Unit). Briefly, iPSCs were harvested by incubation with TrypLE (Thermo, Cat.12563-029) to yield a single cell suspension. A total cell number of 1.3 ×106 cells were resuspended in 100 µL of transfection buffer mix of the kit, 4 µL of the RNP-complex was added and transfected using program CM150 of the nucleofection device (Lonza). After transfection, cells were seeded in StemFlexTM medium (Thermo Fisher, Cat. A3349401) supplemented with 10% CloneR (Stem Cell Technologies Cat. 05888) into one well of a Geltrex (Thermo Fisher Cat. A1413202) coated 6 well plate. Culture medium was changed daily with addition of CloneR for the first three days after transfection. On day four after transfection, the medium was switched to E8 medium53. To isolate clones, cells were passaged using TrypLE and seeded as single cells in Geltrex coated 6 well at a density of 50 – 300 cells/well. Individual iPSC colonies from these cultures were picked into the wells of a Geltrex coated 24 well plate using a pipet tip. After four days of culture cells were harvested from each well by 0.5 mM EDTA treatment. Half of the individual cell suspensions were frozen using Bambanker freezing medium (Nippon Genetics Europe, Cat. BB01-NP) and stored in liquid nitrogen and the other half was used to amplify the targeted genomic region using the Phire Animal Tissue Direct PCR Kit (Thermo Fisher, Cat. F-140WH) regarding the manufacturer’s instructions (Supplementary Table 3) for primer sequences.

PCR products were analyzed using 1.5% agarose gel electrophoresis to confirm amplification and allow subsequent clean up using the NucleoSpin Gel and PCR Clean-up Kit (Macherey Nagel, Cat. 740609.250). Samples were subjected to Sanger Sequencing (Microsynth Seqlab) and results were analyzed using Snapgene software (GSL Biotech LLC). Three clones were identified to carry a frameshift mutation resulting in a premature stop codon.

DOCK2 siRNA knockdown

We tested three specific siRNAs (Thermo Fisher Cat. 4392420; s4230-32) for DOCK2 knockdown in healthy donor fibroblasts as well as iPS-MSPCs. Cells were grown in their standard growth medium described above, to 50% confluence, and transferred to Optimem medium (Thermo Fisher, Cat. Gibco™ 31985062) before adding Lipofectamine (RNAiMAX Reagent Thermo Fisher, Cat. 13778030) siRNA complexes according to manufacturer’s protocol. Transfected cells were harvested 72 h post transfection for checking knockdown efficacy by western blot, using a DOCK2-specific antibody (Thermo Fisher, Cat.MA5-26547) and for application in T cell proliferation assay.

Flow cytometry immune phenotyping and T cell proliferation assay

Immune phenotyping of MSPCs, iPSCs and iPS-MSPCs was performed using a BD LSRFortessa™ (Becton Dickinson) and the following antibodies with their corresponding isotype controls: CD19-BUV395, CD29-APC, CD44-PE, CD45-APC, CD73-PE, CD90-BUV395, CD140a-BV421, CD140b-BV421, SSEA-4-PE, Tra-1-81-Alexa Fluor 647, HLA-ABC-BUV395 (BD), CD14-PE, CD31-eF450, CD34-PE-Cy7, CD56-PE, CD105-eF450, HLA-DR-eF450 (eBioscience), CD141-APC, CD146-PE-Vio770 (Milteny), brachyury-APC (R&D Systems) and Oct4-PE (Biolegend).

Dead cells were excluded based on FVD-eFluorTM520 (eBioscienceTM) staining. For intracellular staining Fix & Perm solution (eBioscienceTM) was used according to the manufacturer´s protocol. Repetitive analysis was performed (Oct4, n = 34; SSEA4, n = 32; Tra181, n = 67; brachyury, n = 29; CD140a, n = 14; CD140b, n = 26; MHC1, n = 11; CD90, n = 74; CD105, n = 78; CD29, n = 25; CD142, n = 25; CD56, n = 51; CD44, n = 29; CD146, n = 25; CD73, n = 73). Results were analyzed using Kaluza Analysis Software (Beckman Coulter).

Immunomodulatory potency of MSPCs, iPSCs and iPS-MSPCs was determined as described7. Briefly, peripheral blood mononuclear cells (PBMCs) from ten random donors were pooled, stained with carboxyfluorescein succinimidyl ester (CFSE, 2 μM, 15 min, 37 °C; Sigma) and cryopreserved in liquid nitrogen in order to have reference responders in multiple subsequent experiments. For immune modulation assays; 3 ×105 CFSE pre-labeled PBMCs resuspended in RPMI-1640 supplemented with 10% hPL (for all assays performed with iPS-MSPCs) or AB serum (for all assays performed with DOCK2 knockout cells), 2 IU/mL preservative-free heparin (Biochrom), 2 mM L-glutamine (Gibco), 10 mM HEPES (Gibco), 100 IU/mL penicillin and 100 μg/mL streptomycin (Sigma) were plated per well in triplicate in 96-well flat-bottomed plates (Corning). T cell proliferation in four-day mitogenesis assays was induced by 5 μg/mL phytohemagglutinin (PHA; Sigma). Allogeneic mixed leukocyte reactions due to the pooling of 10 independent PBMC donor-derived cells were measured at day seven. PBMC were cultured with or without graded numbers of MSPCs (250 μL total volume per well) in threefold serial dilution as indicated in the results section. All cultures were performed in humidified ambient air incubators (Binder CB210) at 37 °C and 5% CO2 in ambient air. Proliferation of viable CD3+ cells was analyzed using a Gallios 10-color flow cytometer and the Kaluza G1.0 software (both Coulter). Viable 7-aminoactinomycin-D-excluding (7-AAD; BD Pharmingen) CD3-APC+ (eBioscience) T cells were analyzed.

RNASeq

RNA was isolated using the Macherey-Nagel RNA isolation kit according to the manufacturer’s protocol. The quality of total RNA isolates was analyzed using the Agilent RNA 6000 Nano Kit.

Poly-(A)-selection was performed utilizing the NEBNext Poly(A)mRNA Magnetic Isolation Module (NEB) according to the manufacturer’s requirements. mRNA libraries were prepared with the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB). All libraries were analyzed with the Agilent DNA 1000 Kit and quantified using the Qubit® dsDNA BR Assay Kit (Thermo Fisher). After equimolar pooling all samples were sequenced on an Illumina HiSeq 1500 system with High Output chemistry v4 (50 cycles, single-read). Quality control was conducted using FASTQC (version 0.11.7—Bioinformatics Group at the Babraham Institute). Trimming and removal of residual adapters was done with AdapterRemoval54. Reads were then mapped to the Ensembl GRCh38 human genome using Tophat2 and Bowtie2. The number of mapped reads/gene (counts) was then calculated using HTseq. Genes were annotated using the Ensembl version 97. Expression values of protein coding genes were normalized using Deseq2 package in R (3.6.3). In order to see, how samples cluster together, a PC analysis of the total normalized dataset and hierarchical clustering using Euclidean distance were conducted. Differential expression analysis between the different groups was conducted using Deseq2. Genes with an adjusted p-value < 0.05 using Benjamini and Hochberg multiple testing correction55 were considered significantly differentially transcribed. Enrichment analysis (Go term enrichment, Gene set enrichment analysis, Kegg pathways and Panther pathways) were conducted using ‘clusterProfiler’ package in R. Benjamini and Hochberg multiple testing correction was used to adjust raw p-values for multiple testing (adj.p-value < 0.05 were considered significant).

Methyl-Cap sequencing

For methylation pattern analysis, isolated DNA was sheared using a Bioruptor device (Diagenode). Subsequently, methylated DNA was isolated and eluted in high salt elution buffer using the MethylCap kit (Diagenode) according to the manufacturer´s instructions. Methylated DNA samples were prepared for next generation sequencing using the NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina according to the manufacturer´s instructions. Amplified libraries were analyzed using the Bioanalyzer 2100 device and DNA 1000 Kit (Agilent) and concentrations were determined by means of Qubit 3.0 fluorometer device and the dsDNA BR assay (Thermo Fisher). Samples were sequenced using the Illumina HiSeq 1500 system (50 bp single reads) in three independent rounds. Sequence images were transformed to BCL files with the Illumina BaseCaller software and samples were demultiplexed to FASTQ files with bcl2fastq v2.17.1.14. Same procedures as above were conducted for quality control, read trimming and adaptor removal. Reads were then mapped to GRCh38 human genome using Bowtie2. Differentially methylated regions were identified using QSEA R package56.

Scratch assay

For wound repair studies, fibroblasts were seeded at cell density of 20,000 cells per well in 24 well plates and cultured until confluence (around 24 h). Cells were serum starved overnight in 0.2% hPL. After standardized scratch of the confluent layer with a 200 µL pipette tip, medium was refreshed and cultures were introduced into a Okolab incubator system surrounding a Nicon Eclipse Ti. Cell movement was monitored by acquiring video sequences using NIS-Elements software covering a time period of 12 h. The area of wound repair was determined using TScratch software57 (Supplementary Fig. 13).

Immunofluorescence, Rac inhibition, CDC42-GTP pulldown

We seeded cells on collagen-coated glass coverslips. Adhered cells were fixed with 4% PFA for 15 min at room temperature, then washed in PBS and permeabilized for 10 min in 0.1% TritonX100/PBS. After 30 min blocking in 10% FBS/Dako wash buffer, anti-CDC42 antibody (Abcam, ab187643), anti-CDC42-GTP antibody (active CDC42, NewEastBioscience 26905) or the corresponding isotype control (Abcam ab172730) were applied 1:500 and incubated overnight at 4 °C. After washing in Dako wash buffer, the phalloidin Alexa Flour 568 (1:40, Invitrogen) and the goat-anti-rabbit-Alexa Fluor 488 secondary antibody (1:500, Invitrogen) were applied in 10% FBS/Dako wash buffer for 1 h at RT. Finally, we washed the coverslips in Dako buffer and mounted them on glass slides, in RotiMount FluorCare (Roth) including DAPI. Confocal pictures were taken using a Zeiss LSM 710 and ZEN software. Rac inhibition was performed for 1 h at 37 °C for both inhibitors (EHT1864 and NSC23766). TGFbeta1 treatment was performed for 1 h at 37 °C. For immunofluorescence quantification pictures were taken under standardized conditions (light intensity, exposure, diaphragm) as described previously30. We determined total CDC42 and active CDC42-GTP content by assessing total pixels number per cell using ImageJ software (v1.52). For assessing stress fibers, each microscopic field was counted for a) the total number of cells; b) the number of cells that display long stress fibers; c) the number of cells that mainly showed short or irregular fiber formation (intermediate) or no formation of stress fibers. Active CDC42-GTP pulldown Western blots were done using a detection kit following manufacturer’s instruction (#16119; Thermo Fisher).

Statistics and reproducibility

Statistical analysis of the results was performed using One-Way ANOVA analysis of variance with a confidence interval of 95% and corrected for multiple comparisons using the Holm Sidak algorithm in GraphPad Prism version 7.03. A p-value of < 0.05 was defined as significant. For the DOCK2-mutant patient fibroblasts, we got cell lines from two patients. We used a minimum of three biological replicates for all experiments in combination with technical replication.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Read more here: Source link