GPP Web Portal – Clone Details


GPP Web Portal – Clone Details



Construct: shRNA TRCN0000299419

Construct Description:

Construct Type:
shRNA
Other Identifiers:
NM_003069.3-3157s21c1
DNA Barcode:
GCTGTAACACTCTGATTTCAT


Original Target:

Taxon:
Homo sapiens (human)
Gene:
SMARCA1 (6594)
Gene Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1
Transcript:
RefSeq NM_003069.3 (NON-CURRENT)
Match location:
Position 3157 (CDS)

Vector Information:

Vector Backbone:
pLKO_005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000299419)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this shRNA:

Sequence Information

Target Sequence:
GCTGTAACACTCTGATTTCAT
Hairpin Sequence:
5′-CCGG-GCTGTAACACTCTGATTTCAT-CTCGAG-ATGAAATCAGAGTGTTACAGC-TTTTTG-3′

Oligo design for arrayed cloning:

Forward sequence:
5′-CCGGGCTGTAACACTCTGATTTCATCTCGAGATGAAATCAGAGTGTTACAGCTTTTTG-3′
Reverse sequence:
5′-AATTCAAAAAGCTGTAACACTCTGATTTCATCTCGAGATGAAATCAGAGTGTTACAGC-3′

Other clones with same target sequence:


  1. TRCN0000050627

Read more here: Source link