Category: ATAC

“Genetic Goldmine” Uncovered for Plant Survival in One of the Harshest Environments on Earth

Evolutionary genomics approach identifies genes that enable plants to live in the Atacama Desert, offering clues for engineering more resilient crops to face climate change. An international team of researchers has identified genes associated with plant survival in one of the harshest environments on Earth: the Atacama Desert in Chile….

Continue Reading “Genetic Goldmine” Uncovered for Plant Survival in One of the Harshest Environments on Earth

How to interpret Nucleosome banding pattern in scATAC-Seq?

How to interpret Nucleosome banding pattern in scATAC-Seq? 0 Hello, I am following Signac vignette to perform QC on my single cell ATAC-Seq data. As per my understanding the vignette considers all cells with nucleosome signal > 4 to have a high nucleosomal signal strength and nucleosome signal is calculated…

Continue Reading How to interpret Nucleosome banding pattern in scATAC-Seq?

Bioconductor – miaSim (development version)

DOI: 10.18129/B9.bioc.miaSim     This is the development version of miaSim; to use it, please install the devel version of Bioconductor. Microbiome Data Simulation Bioconductor version: Development (3.14) Microbiome time series simulation with generalized Lotka-Volterra model, Self-Organized Instability (SOI), and other models. Hubbell’s Neutral model is used to determine the…

Continue Reading Bioconductor – miaSim (development version)

Top 8 Hackathons That Data Scientists Should Participate In

Hackathons are sprint-like events to enable participants to define problems in a limited time period. These are aimed at developers, data scientists, graphic designers and project managers, allowing them to find the best solution to a given problem. They form a test-bed for machine learning professionals and data scientists. Data…

Continue Reading Top 8 Hackathons That Data Scientists Should Participate In

About trimming adapter and primer sequences from Illumina reads

About trimming adapter and primer sequences from Illumina reads 2 Hi, I used trimmomatics to trim my Illumina Hiseq reads with a list that I downloaded from here . (omicsoft.com/downloads/ngs/contamination_list/v1.txt) But after I assembled the trimmed reads, I tried to upload the assembly to the TSA database in NCBI, they…

Continue Reading About trimming adapter and primer sequences from Illumina reads

which sequence adapter trimming tool should i use for my illumina 101pb reads ?

which sequence adapter trimming tool should i use for my illumina 101pb reads ? 2 Hello, I want to trim adaptor sequences from my raw reads, the report data of the sequencer company details that adapters were not removed from the reads but do not detail the adapter sequence used,…

Continue Reading which sequence adapter trimming tool should i use for my illumina 101pb reads ?

Trimming Illumina universal adapters using cutadapt proving insufficient

TL;DR: I have high universal Illumina adapter content in my paired-end RNA-seq reads and trimming with both the original sequence and reverse complement of the universal adapter did not completely remove the adapter content and was only effective for the R2 reads. I am trying to trim adapter sequences from…

Continue Reading Trimming Illumina universal adapters using cutadapt proving insufficient

STARaligner not recocognizing “:” Illumina Quality Score Encoding resulting in “quality string length is not equal to sequence length”error?

STARaligner not recocognizing “:” Illumina Quality Score Encoding resulting in “quality string length is not equal to sequence length”error? 0 HI recently I got this fatal error from STARaligner. EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length @A00269:556:HHTWKDRXY:1:2234:19696:18286 + FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF however…

Continue Reading STARaligner not recocognizing “:” Illumina Quality Score Encoding resulting in “quality string length is not equal to sequence length”error?

Active Motif hiring Bioinformatics Associate I/II in Carlsbad, California, United States

Position Title Bioinformatics Associate I/II Classification: Exempt Who is Active Motif? Active Motif, Inc. is a privately held global biotechnology company with the vision of bringing the field of epigenetics into personalized and precision medicine. Active Motif’s Bioinformatics group performs specialized transcriptomic- and epigenetics-based analyses for leading academic groups and…

Continue Reading Active Motif hiring Bioinformatics Associate I/II in Carlsbad, California, United States

BioSpace hiring Bioinformatics Analyst II/III in Frederick, Maryland, United States

Program DescriptionThe Frederick National Laboratory is dedicated to improving human health through the discovery and innovation in the biomedical sciences, focusing on cancer,AIDSand emerging infectious diseases. The Biomedical Informatics and Data Science (BIDS) directorate works collaboratively and helps to fulfill the mission of Frederick National Laboratory in the areas of…

Continue Reading BioSpace hiring Bioinformatics Analyst II/III in Frederick, Maryland, United States

Measure genome-wide agreement of peaks in

Measure genome-wide agreement of peaks in 0 Is there an approach to measure agreement in epigenomic signals e.g. histone marks (continuous -log10 p-vals after peak calling)? This approach should also work across assays or cell types. For example, how similar is the DNAse-seq signal across Neutrophils, Monocytes and T-cells? Are…

Continue Reading Measure genome-wide agreement of peaks in

Our Ability Jobs – Mayo Clinic Sr. Bioinformatician

Why Mayo Clinic Mayo Clinic is the nation’s best hospital (U.S. News & World Report, 2020-2021) and ranked #1 in more specialties than any other care provider. We have a vast array of opportunities ranging from Nursing, Clinical, to Finance, IT, Administrative, Research and Support Services to name a few….

Continue Reading Our Ability Jobs – Mayo Clinic Sr. Bioinformatician

Trimmomatic options for Novaseq WES and samqualfilter? or filter by qualty in sam files

Hello , I am having headaches regarding this sample. I am performing WES for calling SNP and CNV. All was good until I wanted to show the coverage by gene or fragment. Comparing my results with other ones, I found no coverage by the region I wanted, compared with the…

Continue Reading Trimmomatic options for Novaseq WES and samqualfilter? or filter by qualty in sam files

Synchronous rectal tumours in a patient with Lynch syndrome

Plain Language Summary The increasingly widespread use of immunohistochemistry and next-generation sequencing in the detection of microsatellite instability (MSI) and DNA mismatch repair (MMR) status has led to the observation of various unusual tumour types that exhibit MMR protein deficiency in Lynch syndrome. Here, we report a case of two…

Continue Reading Synchronous rectal tumours in a patient with Lynch syndrome

Scientist II, Cancer Immunologic Data Commons

Scientist II, Cancer Immunologic Data Commons Dana-Farber Cancer Institute Boston, MA Full Time PTL Remote: 2-3 days remote/wk The Department of Data Science seeks a Scientist II to lead the development of the Cancer Immunologic Data Commons at Dana-Farber. The Scientist II will work closely with the laboratories of Drs.Franziska…

Continue Reading Scientist II, Cancer Immunologic Data Commons

Anyone could help me with cutadapt?

I’, trying to trim my primers off from Illumina sequences. I ‘ve amplified with: Diat_rbcL_F1 AGGTGAAGTAAAAGGTTCWTACTTAAA, Diat_rbcL_F2 AGGTGAAGTTAAAGGTTCWTAYTTAAA and Diat_rbcL_F3 AGGTGAAACTAAAGGTTCWTACTTAAA as Forward primers and Diat_rbcL_R1 5’CCTTCTAATTTACCWACWACTG 3’ (Reverse Complement: 3’CAGTWGTWGGTAAATTAGAAGG 5’) and Diat_rbcL_R2 5’CCTTCTAATTTACCWACAACAG 3’ (Reverse Complement: 3’CTGTTGTWGGTAAATTAGAAGG 5’) Reverse primers. First, I used PEAR to assembly paired reads…

Continue Reading Anyone could help me with cutadapt?

My ATAC-seq data returns a peak of 1bp for all the peak intervals when using DiffBind’s dba.count(summit=0). why is this happening?

My ATAC-seq data returns a peak of 1bp for all the peak intervals when using DiffBind’s dba.count(summit=0). why is this happening? 0 The binding matrix’s peak intervals (all of them) have a width =1 bp. I have set summit=False, summit=0, summit=True. All these parameters return 1 bp width. In fact,…

Continue Reading My ATAC-seq data returns a peak of 1bp for all the peak intervals when using DiffBind’s dba.count(summit=0). why is this happening?

Running ATAC-Seq pipeline from ENCODE

Running ATAC-Seq pipeline from ENCODE 1 SLURM is simply a scheduler on HPC systems. You can (probably) just save the script and run it as bash that_script.sh. Alternatively, consider the nf-core ATAC-seq pipeline: nf-co.re/atacseq Login before adding your answer. Traffic: 1212 users visited in the last hour Read more here:…

Continue Reading Running ATAC-Seq pipeline from ENCODE

why are all DiffBind tutorial’s ATAC-seq peak intervals 400 bp for all intervals?

why are all DiffBind tutorial’s ATAC-seq peak intervals 400 bp for all intervals? 1 I have followed DiffBind tutorial bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf I have found out that the returned count matrix’s peak intervals are always 400bp. Literally, all the peak intervals in the count matrix are 400 bp. I am wondering why…

Continue Reading why are all DiffBind tutorial’s ATAC-seq peak intervals 400 bp for all intervals?

Understanding pilon correction on the reference sequence

Understanding pilon correction on the reference sequence 0 Hello, I need some clarification about specific kind fix made by pilon on the reference sequence: ref -GGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA fix CGGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA *********************************************************** ref TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC fix TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC ************************************************************ ref GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA fix GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA ************************************************************ ref CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG fix CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG ************************************************************ ref AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG fix AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG ************************************************************ ref…

Continue Reading Understanding pilon correction on the reference sequence

Bioinformatics Scientist, Discovery Biology – South San Francisco

Surrozen is a biotechnology company focused on discovering and developing novel regenerative medicines that unlock the powerful self-renewal properties of the body through specific control of the Wnt signaling pathway.Surrozen was founded by five leading-edge scientists: K. Christopher Garcia, Ph.D., Roel Nusse, Ph.D. and Calvin Kuo, M.D., Ph.D. from Stanford…

Continue Reading Bioinformatics Scientist, Discovery Biology – South San Francisco

Staff Bioinformatics Research Engineer and Senior Manager – South San Francisco

As a Staff Bioinformatic Research Engineer and Senior Manager at Freenome, you will lead a team responsible for developing and deploying bioinformatics research on Freenome’s ML research platform. You will lead and manage a team of Research Engineers working large multi-omic datasets, including whole-genome sequencing of cell-free DNA, extracellular small…

Continue Reading Staff Bioinformatics Research Engineer and Senior Manager – South San Francisco

How to import a BED file to ChIPseeker in order to visualize genome coverage plot?

How to import a BED file to ChIPseeker in order to visualize genome coverage plot? 1 Could you please explain how to connect the ATAC-Seq peak results discovered by DiffBind to be imported to ChIPseeker to get CHIP peaks coverage plot? For example, I have the following bed file. chr14…

Continue Reading How to import a BED file to ChIPseeker in order to visualize genome coverage plot?

BIOINFORMATICS POSTDOC IN EVOLUTIONARY GENOMICS

A postdoctoral position (3 years with possible extensions) is available immediately in the evolutionary genomics group of Henrik Kaessmann. We are seeking highly qualified and enthusiastic applicants with strong skills in computational biology/bioinformatics, ideally also with experience in data mining and comparative or evolutionary genome analyses. We have been interested…

Continue Reading BIOINFORMATICS POSTDOC IN EVOLUTIONARY GENOMICS

Confused by MACS2 –scale-to option

Confused by MACS2 –scale-to option 1 Hi all, Quick Q regarding MACS2. The manual states that the –scale-to option serves to “scale the larger sample up to the smaller sample” or vice-versa. What exactly does it mean by this? Is this scaling only applied when multiple samples/reps are given? Or…

Continue Reading Confused by MACS2 –scale-to option

Bioinformatics Analyst – New York

POSITION RESPONSIBILITIES: The person will:Utilize existing pipelines to process and analyze high-throughput sequencing data, including bisulfite sequencing data.Manage, organize all bioinformatics sequencing data in the lab. Including papillomavirus sequence, microbiome data, both 16S and other, and human genomic dataConstruct phylogenic treesThe individual will be responsible for downloading large Fastq, BAM…

Continue Reading Bioinformatics Analyst – New York

Bioconductor – esATAC

DOI: 10.18129/B9.bioc.esATAC     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see esATAC. An Easy-to-use Systematic pipeline for ATACseq data analysis Bioconductor version: 3.12 This package provides a framework and complete preset pipeline for quantification and analysis of ATAC-seq Reads. It covers raw…

Continue Reading Bioconductor – esATAC

BioSpace hiring Bioinformatics Scientist, Discovery Biology in South San Francisco, California, United States

DescriptionSurrozen is a biotechnology company focused on discovering and developing novel regenerative medicines that unlock the powerful self-renewal properties of the body through specific control of the Wnt signaling pathway. Surrozen was founded by five leading-edge scientists: K. Christopher Garcia, Ph.D., Roel Nusse, Ph.D. and Calvin Kuo, M.D., Ph.D. from…

Continue Reading BioSpace hiring Bioinformatics Scientist, Discovery Biology in South San Francisco, California, United States

How to merge exons based on gene ids?

Since this is still unanswered, I’ll post an R solution until someone is kind enough to answer with the requested biopython solution. Read the fasta file in. library(“Biostrings”) library(“tidyverse”) fasta <- readDNAStringSet(“test.fasta”) You’ll end up with a Biostrings object of the fasta file. > fasta DNAStringSet object of length 7:…

Continue Reading How to merge exons based on gene ids?

samtools to count the number of reads mapped to each spike-in for each sample

samtools to count the number of reads mapped to each spike-in for each sample 0 My goal is to use STAR to create a new genome with the spike-ins listed below by combining both hg38.fa and spike-in. Once I have the genomes created, I’ll align FASTQs to this newly created…

Continue Reading samtools to count the number of reads mapped to each spike-in for each sample

Medical College of Wisconsin hiring Bioinformatics Analyst I in Milwaukee, Wisconsin, United States

Position Description: Every great life-changing discovery begins the same way—with new knowledge. It can change everything, from a single life to the future of entire communities. That’s why academic medicine, and the continuous pursuit of knowledge, is at the center of everything we do at the Medical College of Wisconsin….

Continue Reading Medical College of Wisconsin hiring Bioinformatics Analyst I in Milwaukee, Wisconsin, United States

Job vacancy in Global Worldwide: Bioinformatics Scientist – Senior Scientist at Arcus Biosciences

Job details Job type full-time Full job description Bioinformatics scientist – senior bioinformatics scientist Arcus is seeking a scientist-srScientist that will work in a highly embedded, collaborative model with colleagues across the organizationCandidate will work closely with translational and biology research scientists in the development of novel therapeutics and biomarkers…

Continue Reading Job vacancy in Global Worldwide: Bioinformatics Scientist – Senior Scientist at Arcus Biosciences

Dice hiring Scientist, Bioinformatics in Cambridge, Massachusetts, United States

Dice is the leading career destination for tech experts at every stage of their careers. Our client, Apex Systems, is seeking the following. Apply via Dice today! Scientist, Bioinformatics 1175064 Job Scope Purpose Our client is a leading organization within the gene editing space and are looking for an emerging…

Continue Reading Dice hiring Scientist, Bioinformatics in Cambridge, Massachusetts, United States

Maximizing GROMACS Throughput with Multiple Simulations per GPU Using MPS and MIG

GROMACS, a simulation package for biomolecular systems, is one of the most highly used scientific software applications worldwide, and a key tool in understanding important biological processes including those underlying the current COVID-19 pandemic. In a previous post, we showcased recent optimizations, performed in collaboration with the core development team,…

Continue Reading Maximizing GROMACS Throughput with Multiple Simulations per GPU Using MPS and MIG

using DESeq2 for ATAC analyses

using DESeq2 for ATAC analyses 1 @changxufan-24128 Last seen 23 hours ago United States I love DESeq2! However, when using DESeq2 for ATAC analysis, I realized one potential issue. In the figure below: Left is a scatter plot between 2 samples (biological replicates). Each point represents the read count at…

Continue Reading using DESeq2 for ATAC analyses

How can I export raw count profile from DiffBind to be analyzed on DESeq2 separately?

How can I export raw count profile from DiffBind to be analyzed on DESeq2 separately? 0 I am performing some ATAC-seq analysis. I would like to export the output files as a raw abundance profile so that I can analyze them on DESeq2 separately. I am aware that DiffBind contains…

Continue Reading How can I export raw count profile from DiffBind to be analyzed on DESeq2 separately?

Our Ability Jobs – HERC: Metro New York & Southern Connecticut Bioinformatics Analyst in Einstein/Resnick

Employer Name: Albert Einstein College of Medicine Specific Responsibilities: Processing and mapping raw NGS RNA-seq, ChIP-seq, ATAC-seq, WGBS and other omics datasets. Analyzing RNA-seq, ChIP-seq, ATAC-seq, WGBS and other omics data sets generated in the lab for investigation of gene and chromatin regulatory networks in stem cells and cancer. Downloading…

Continue Reading Our Ability Jobs – HERC: Metro New York & Southern Connecticut Bioinformatics Analyst in Einstein/Resnick

Intercellular transfer of mitochondrial DNA carrying metastasis-enhancing pathogenic mutations from high- to low-metastatic tumor cells and stromal cells via extracellular vesicles | BMC Molecular and Cell Biology

Reagents GW4869, a neutral sphingomyelinase inhibitor, and tipifarnib, a farnesyl transferase inhibitor, were obtained from Cayman Chemical (Ann Arbor, MI, USA) and ChemScene LLC (Monmouth, NJ, USA), respectively. MitoTracker Red CMXRos, MitoTracker Deep Red FM (MTDR) and CellLight mitochondria-GFP (mtGFP) were supplied by Thermo Fisher Scientific (Waltham, MA, USA). MitoBright…

Continue Reading Intercellular transfer of mitochondrial DNA carrying metastasis-enhancing pathogenic mutations from high- to low-metastatic tumor cells and stromal cells via extracellular vesicles | BMC Molecular and Cell Biology

How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)?

How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)? 0 I have a set of metatranscriptomics sequence samples. Let’s say the following sample fastq file is what I have. I would like to map these reads to a bacterial…

Continue Reading How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)?

Help generating a correct linear model (DESeq2) for use in DiffBind3

Hello, I am trying to do a differential ATACseq analysis with DiffBind3, and need to build a design that DESeq2 will accept. I have tried several relevant models, but I have been unsuccessful in achieving the contrasts I desire, without DESeq2 throwing a “Model matrix not full rank” error. Any…

Continue Reading Help generating a correct linear model (DESeq2) for use in DiffBind3

How to select a few TF binding site using JASPAR on UCSC

How to select a few TF binding site using JASPAR on UCSC 1 I’m trying to find Transcription factor binding sites using JASPAR on UCSC. The area of thee genome I am interested in ends up having a lot of TF binding site, is there a way to customize JASPAR…

Continue Reading How to select a few TF binding site using JASPAR on UCSC

How To Extract A Sequence From A Big (6Gb) Multifasta File ?

How To Extract A Sequence From A Big (6Gb) Multifasta File ? 11 I want to extract some sequences using ID from a multifasta file. Using perl is not possible because it gave an error when indexing the database. Maybe because of it’s size? Is there any way to this…

Continue Reading How To Extract A Sequence From A Big (6Gb) Multifasta File ?

Cis-acting mutation affecting GJA5 transcription is underlying the Melanotic within-feather pigmentation pattern in chickens

Significance The molecular mechanisms underlying pigmentation patterns in animals is to a large extent an unresolved mystery in biology. For example, compared with mammals, birds show a stunning diversity in pigmentation patterns. This study advances the knowledge concerning the mechanisms creating periodic pigmentation patterns in individual feathers. We show that…

Continue Reading Cis-acting mutation affecting GJA5 transcription is underlying the Melanotic within-feather pigmentation pattern in chickens

Dana-Farber Cancer Institute hiring Bioinformatics Engineer in Boston, Massachusetts, United States

Job ID:24410 Location:450 Brookline Ave, Boston, MA 02215 Category:IT/Informatics Employment Type:Full time Work Location:Full Remote: 4-5 days remote/wk Overview The Knowledge Systems Group (KSG) operates at the crossroads of cancer genomics, software, and medicine. Our platforms are focused on mining cancer genomic data sets, matching patients to clinical trials, and…

Continue Reading Dana-Farber Cancer Institute hiring Bioinformatics Engineer in Boston, Massachusetts, United States

Protein sequence to Nucleotide sequence

Protein sequence to Nucleotide sequence 2 Hello All, I have file1 with protein sequence and another file with its respective decoded nucl codon sequence, is there any one liner which looks for aa single letter in file2 – change the protein sequence to the nucleotide sequence and save it as…

Continue Reading Protein sequence to Nucleotide sequence

biopython write fasta

Step 1 − Create a file named blast_example.fasta in the Biopython directory and give the below sequence information as input. 3. “””Bio.SeqIO support for the “fasta” (aka FastA or Pearson) file format. Then we save this line of text to the output file: Now we have finished all the genes,…

Continue Reading biopython write fasta

Bioinformatics Scientist in Diagenode – GrabJobs

Job Description Diagenode (a Hologic company) is an international biotech company that develops and commercializes innovative instruments and reagents systems for the life science research and molecular diagnostics. Founded in 2003, the Group is headquartered in Liège (Belgium), with subsidiaries in Denville (NJ, USA), in Toyama (Japan) and in Santiago…

Continue Reading Bioinformatics Scientist in Diagenode – GrabJobs

Bioinformatics Research Scientist

Bioinformatics Research Scientist – 93904 Organization: JG-Joint Genome Institute Lawrence Berkeley National Lab’s (LBNL, www.lbl.gov/) Joint Genome Institute Division (jgi.doe.gov/) has an opening for a Bioinformatics Research Scientist to join the team. In this exciting role, you will develop new computational methods to investigate gene regulation and regulatory sequence properties…

Continue Reading Bioinformatics Research Scientist

grep command for fasta header

grep command for fasta header 0 I used this command:– grep -Fw -A 1 -f header.txt test.fa >test_result.fa But it extracts only 1 header, not the whole which are present in my header.txt file. my header.txt file looks like:— hsa_circ_0000006 hsa_circ_0000014 hsa_circ_0000015 hsa_circ_0000042 hsa_circ_0000070 hsa_circ_0000072 hsa_circ_0000131 hsa_circ_0000133 hsa_circ_0000160 hsa_circ_0000175 hsa_circ_0000211…

Continue Reading grep command for fasta header

Uni Roles Australia: Grant-Funded Researcher, Bioinformatics

(Level A) $89,610 to $96,007 per annum and (Level B) $100,933 to $119,391 per annum plus an employer contribution of up to 17% superannuation may apply Two fixed-term, full-time positions available for three years Two exciting Bioinformatic opportunities in the newly established Adelaide Centre for Epigenetics (ACE) These two positions…

Continue Reading Uni Roles Australia: Grant-Funded Researcher, Bioinformatics

Lab Officer

The Dorrity group at EMBL Heidelberg is seeking a highly motivated computational biologist to act as a Laboratory Officer, helping to set up a new lab that promotes a welcoming and positive atmosphere. Our group uses single-cell genomics as a whole-organism phenotyping tool in zebrafish to (1) understand how different…

Continue Reading Lab Officer

A whale detector design for the Kaggle whale-detector challenge

So, this repository is my PyTorch solution for the Kaggle whale-detection challenge. The objective of this challenge was to basically do a binary classification, (hence really a detection), on the existance of whale signals in the water. It’s a pretty cool problem that resonates with prior work I have done…

Continue Reading A whale detector design for the Kaggle whale-detector challenge

bioinformatics salary in uk

Included is a benchmarking guide to the salaries offered in vacancies that have cited Bioinformatics over the 6 months to 25 September 2021 with a comparison to the same period in the previous 2 years. Low £40,247. Found inside – Page 392in the biomedical department receive 80 % of their…

Continue Reading bioinformatics salary in uk

Low mapping rate of 10X scATAC-seq reads

Low mapping rate of 10X scATAC-seq reads 0 Hey Guys, I’m working on a scATAC-seq project using 10X technologies. My samples including several different species. the problem is that for one species (2 sample in total), both of the mapping rate of reads from these 2 samples are very low…

Continue Reading Low mapping rate of 10X scATAC-seq reads

rs2507799 was found to be linked with increased risk for IS

Introduction Ischemic stroke (IS) is caused by the sudden loss of blood circulation to an area of the brain that causes injury to neurological function and represents a major cause of global disability and mortality.1 IS is known to be a heterogeneous and multifactorial disease. Genetic factors, particularly those involving…

Continue Reading rs2507799 was found to be linked with increased risk for IS

How to use MACS2 output for DESEQ2 differential analysis during ATAC-seq? How to get the intersect?

How to use MACS2 output for DESEQ2 differential analysis during ATAC-seq? How to get the intersect? 0 I have processed my ATAC-seq reads and finally obtained MACs2 output bed files. I am at a loss to proceed from here to DESeq2 analysis. I will be thankful to you if could…

Continue Reading How to use MACS2 output for DESEQ2 differential analysis during ATAC-seq? How to get the intersect?

3 Egyptian mummy faces revealed in stunning reconstruction

The faces of three men who lived in ancient Egypt over 2,000 years ago have been revived. Digital reconstruction depicts a 25-year-old man based on DNA data extracted from a mummified corpse. The mummy came from the ancient Egyptian city of Absir Hermerek in the floodplain of southern Cairo and…

Continue Reading 3 Egyptian mummy faces revealed in stunning reconstruction

Postdoctoral Position in Immunotherapy, Virology, RNA Biology, Epigenetics, and Drug Design

– Advertisement – Postdoctoral Position in Immunotherapy, Virology, RNA Biology, Epigenetics, and Drug Design is available immediately for highly motivated recent Ph. Ds and/or MDs with strong training in any of the following disciplines: biochemistry, bioinformatics, immunology, molecular and cell biology, virology, medicinal chemistry or chemical biology to participate in the following projects…

Continue Reading Postdoctoral Position in Immunotherapy, Virology, RNA Biology, Epigenetics, and Drug Design

BioSpace hiring Bioinformatics Scientist in Hayward, California, United States

Locations: Hayward, California | Remote, United States Summary Scientists at Arcus work in a highly embedded and highly collaborative model with colleagues across the organization. We seek a highly motivated Bioinformatics Scientist to work closely with translational and biology research scientists in the development of novel therapeutics and biomarkers in…

Continue Reading BioSpace hiring Bioinformatics Scientist in Hayward, California, United States

Cutadapt de-multiplexing does not recognize some barcodes

Hey all, So I currently dealing with deep-sequencing data of 16S amplicons from multiple variable regions on the 16S gene. I used different sets of primers to amplify different regions and then sequenced them all together, I am trying to de-multiplex based on those primers using cutadapt and the following…

Continue Reading Cutadapt de-multiplexing does not recognize some barcodes

Bioinformatics Scientist – Pittsburgh, PA

Job Description Bioinformatics Scientist Med-Immunology – Pennsylvania-Pittsburgh – (21005833) Computational Immunogenomics Core is seeking a full-time data Bioinformatics Scientist. The candidate will be responsible for developing and deploying analytical workflows for multi-omics data from single-cell and ensemble genomics studies. The candidate will report to the core director and work with…

Continue Reading Bioinformatics Scientist – Pittsburgh, PA

Baylor College of Medicine hiring Bioinformatics Analyst I in Houston, Texas, United States

SummaryAn open position for a Bioninformatic Analyst I is available in the Department of Ophthalmology, Baylor College of Medicine, Houston, TX. Will work alongside research scientists and clinicians with diverse backgrounds, including other bioinformaticians and computational biologists, molecular biologists, geneticist and immunologists. The work will focus on harnessing the power…

Continue Reading Baylor College of Medicine hiring Bioinformatics Analyst I in Houston, Texas, United States

NYU Langone Health hiring Bioinformatics Programmer in New York, New York, United States

Job ID: 1080691_RR00048323 NYU Grossman School of Medicine is one of the nation’s top-ranked medical schools. For 175 years, NYU Grossman School of Medicine has trained thousands of physicians and scientists who have helped to shape the course of medical history and enrich the lives of countless people. An integral…

Continue Reading NYU Langone Health hiring Bioinformatics Programmer in New York, New York, United States

Misuse of RPKM or TPM normalization when comparing across samples and sequencing protocols

Forum:Misuse of RPKM or TPM normalization when comparing across samples and sequencing protocols 2 Published in the RNA Journal in 2020 – this paper argues that if the original RNA amount in the different samples is different, TPM should not be used to find differentially expressed genes. www.ncbi.nlm.nih.gov/pmc/articles/PMC7373998/ Seems like…

Continue Reading Misuse of RPKM or TPM normalization when comparing across samples and sequencing protocols

Normalization methods fro ATAC-seq data : bioinformatics

Hi people, Currently, I’m working on analyzing ATACseq data with the following pipeline: fastQC, adapter trimming, etc. BWA mem Remove duplicates, filter MAPQ Call peaks with Genrich for all samples Merge all sample peaks into reference peak set Count Tn5 cut sites with featureCounts At this point I have a…

Continue Reading Normalization methods fro ATAC-seq data : bioinformatics

Lab Officer job with EMBL

The Dorrity group at EMBL Heidelberg is seeking a highly motivated computational biologist to act as a Laboratory Officer, helping to set up a new lab that promotes a welcoming and positive atmosphere. Our group uses single-cell genomics as a whole-organism phenotyping tool in zebrafish to (1) understand how different…

Continue Reading Lab Officer job with EMBL

AI Rx | Computer Graphics World

Today, we can produce more biomedical data in about three months than we did in the past, with petabytes from just a single hospital. There is a deluge from various sources, such as patients’ medical records, medical instruments, lab work, and more. Likewise, in the research and development space, similar…

Continue Reading AI Rx | Computer Graphics World

Bioinformaticians (m/f/d) in Bioinformatics Core Unit

We are extending our bioinformatics team and are seeking for two enthusiastic bioinformaticians who would like to build and advance their career in translational cancer genomics and/or spearhead the implementation of next generation sequencing methodologies in routine cancer diagnostics and precision medicine. As a bioinformatician, you will conduct analyses of…

Continue Reading Bioinformaticians (m/f/d) in Bioinformatics Core Unit

Recruitment Of Postdoctoral Scholar in Cancer Biology/Cancer Genomics University of Chicago

EMPLOYER Northwestern University LOCATION Chicago, Illinois SALARY Commensurate with experience POSTED September 21, 2021 DISCIPLINE Life Sciences, Computational Biology, Genomics, Immunology Position Type Full Time ORGANIZATION TYPE Academia Job Type Postdoc Postdoctoral recruiting (experiential or computational) is available in murine and human innate immune interactions or precision medicine approach during the development of rheumatoid…

Continue Reading Recruitment Of Postdoctoral Scholar in Cancer Biology/Cancer Genomics University of Chicago

Characterization and expression of DNA sequences encoding the growth hormone gene in African Pygmy Mouse (Mus minutoides)

Abstract We determined the nucleotide sequence of the growth hormone (Gh) gene in Mus minutoides, one of the smallest mammals, where was predicted to be distinct in the functional regions between M. minutoides and Mus musculus. To investigate the evolutionary characteristics of Gh in M. minutoides, we constructed a phylogenetic…

Continue Reading Characterization and expression of DNA sequences encoding the growth hormone gene in African Pygmy Mouse (Mus minutoides)

PolyAllele Detail

Polymorphism: FLAG_344G02 Name    FLAG_344G02 Date last modified    2006-09-11 Aliases    344G02 Tair Accession    Polymorphism:1009991284 Type    insertion    Insertion Type    T-DNA Chromosome   unknown Mutagen    T-DNA insertion Mutation Site    gene Associated Polymorphisms Insertion   Species Variant (attribution)   Length   Polymorphic Sequence   Polymorphism…

Continue Reading PolyAllele Detail

How to remove Illumina TruSeq Index adapters reverse (R2 reads )

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Continue Reading How to remove Illumina TruSeq Index adapters reverse (R2 reads )

Is there any software that can use ATAC-seq to identify super enhancer

Is there any software that can use ATAC-seq to identify super enhancer 1 Hello Everyone! Has anyone tried to identify super-enhancers by using ATAC-seq? I am wondering whether some one can recommend some software 🙂 Thanks a lot in advance for your comments and ideas! Best wishes Guandong Shang ATAC-seq…

Continue Reading Is there any software that can use ATAC-seq to identify super enhancer

Bioinformatics Scientist – verwaltungs-jobs.ch

EPFL, the Swiss Federal Institute of Technology in Lausanne, is one of the most dynamic university campuses in Europe and ranks among the top 20 universities worldwide. The EPFL employs more than 6,000 people supporting the three main missions of the institutions: education, research and innovation. The EPFL campus offers…

Continue Reading Bioinformatics Scientist – verwaltungs-jobs.ch

Bioinformatics Training Developer job with The Francis Crick Institute

Bioinformatics and Biostatistics Core Facility   Reports to: Head of Bioinformatics Core Facility   This is a full-time, permanent position on Crick Terms and Conditions of Employment.                                              …

Continue Reading Bioinformatics Training Developer job with The Francis Crick Institute

Bioinformatics Training Developer at The Francis Crick Institute

Short summary The position of Bioinformatics Training Developer will provide support to the bioinformatics training and development needs of research scientists primarily RNA-Seq, ATAC-Seq, ChiP-Seq and single-cell RNA-Seq. There are 2000 research scientists at the Francis Crick Institute. The role-holder will be located within the Bioinformatics and Biostatistics Core in…

Continue Reading Bioinformatics Training Developer at The Francis Crick Institute

How to extract unique mapped results from Bowtie2 bam results?

How to extract unique mapped results from Bowtie2 bam results? I used samtools view -bq 1 WG.bam > unique.bam However, my results contain 54792 lines, why it is not 42097?   After I have the subset of those reads, how can I extract them from sam or bam file to create a…

Continue Reading How to extract unique mapped results from Bowtie2 bam results?

dba.count reduces binding matrix, why?

dba.count reduces binding matrix, why? 0 db <- dba(samplesheet) This gives me: db 9 Samples, 138044 sites in matrix (193226 total) then I do db.cnt <- dba.count(db) db.cnt 9 Samples, 55893 sites in matrix I wonder why dba.count is removing more than half of the intervals? diffbind atacseq chipseq diffbind3…

Continue Reading dba.count reduces binding matrix, why?

Remove text and add a string in odd rows in a fasta file using awk

Remove text and add a string in odd rows in a fasta file using awk 2 I have a file organized as such: >Prevalence_Sequence_ID:13|ARO_Name:AxyX|ARO:3004143|Detection_Model:Protein Homolog Model ATGAAGCAAAGAGTCCCTCTACGCACGTTCGTCCTATCTGCCGTATTAATTCTTATTACTGGTTGCTCGAAACCGGAAACCCAACCAGCCG >Prevalence_Sequence_ID:14|ARO_Name:adeF|ARO:3004143|Detection_Model:Protein Homolog Model ATGAATATCTCGAAATTCTTCATCGACCGGCCGATCTTCGCCGGCGTGCTTTCGATCCTGGTGTTGCTGGCGGGCATACTGGCCATGTTCC For every odd row, i need to keep only the first and third column and add the text “|kraken:taxid|32630”…

Continue Reading Remove text and add a string in odd rows in a fasta file using awk

low FRiP(Fraction of Reads in Peaks) score in ATAC-seq

Hi. I’m doing ATAC-seq analysis of colon tissue. I analyzed 1)QC -> 2)Mapping -> 3)Post alignment processing(remove mt reads, duplicated reads, multi-mapped reads) -> 4)Peak calling order. However, as a result of calculating FRiP after peak calling using MACS2, the FRiP score was too low. No major problems were found…

Continue Reading low FRiP(Fraction of Reads in Peaks) score in ATAC-seq

R Bioconductor Courses

Listing Results R bioconductor courses Bioconductor Introduction To R / Bioconductor Harvard Bioconductor.org All Courses 016-05-16 Just NowIntroduction to R / Bioconductor. Buffalo, NY. 2016-05-16 ~ 2016-05-17. Instructors. Martin Morgan; Lori Shepherd; Description. This is a two-day course introducing R and Bioconductor for the analysis and comprehension of high-throughput genomic…

Continue Reading R Bioconductor Courses

Disabling de novo DNA methylation in embryonic stem cells allows an illegitimate fate trajectory

The mammalian genome is characterized by widespread methylation of cytosine residues. After fertilization, however, both maternal and paternal genomes undergo extensive demethylation, reaching a low point in the blastocyst (1⇓⇓–4). The embryo genome is then remethylated by the activity of de novo DNA methylation enzymes (5). Mouse embryonic stem (ES)…

Continue Reading Disabling de novo DNA methylation in embryonic stem cells allows an illegitimate fate trajectory

Exec format error in unmapped bam file

Exec format error in unmapped bam file 0 Hello I created unmapped bam file from fastq file (sample 1). When I tried to search the bam file using query name, I got the ‘Exec format error’ #1_ucheck.bam: unmapped bam file from Sample 1 fastq file code: samtools view 1_ucheck.bam |…

Continue Reading Exec format error in unmapped bam file

BIOINFORMATICS SCIENTIST job in in Dubai United Arab Emirates

Description Overview We are looking for a highly motivated and creative bioinformatics research scientist to develop and apply innovative analytical approaches to understand the genetic modifications that drive the development and response to therapy of blood tissues. The scientist will contribute ideas to implement automate and improve existing analysis methods,…

Continue Reading BIOINFORMATICS SCIENTIST job in in Dubai United Arab Emirates

Calling differential peaks on ATAC-seq data

Calling differential peaks on ATAC-seq data 0 My lab has recently run an ATAC-seq analysis on 3 biological conditions (Day 0, day 1 and day 7) with two replicates assigned to each. Once the data is finally generated, I will need to use some differential peak calling software to identify…

Continue Reading Calling differential peaks on ATAC-seq data

Manager, Bioinformatics – Brain Science job in Seattle, WA | Allen Institute for Brain Science

Manager, Bioinformatics Brain Science The mission of the Allen Institute is to unlock the complexities of bioscience and advance our knowledge to improve human health. Using an open science, multi-scale, team-oriented approach, the Allen Institute focuses on accelerating foundational research, developing standards and models, and cultivating new ideas to make…

Continue Reading Manager, Bioinformatics – Brain Science job in Seattle, WA | Allen Institute for Brain Science

Feature selection

Feature selection 0 Hello, I am starting out with bulk ATAC data as bed files that include the read counts. I want to use this data for a package called MOFA, which requires these preprocessing steps: Normalisation: For count-based data such as RNA-seq or ATAC-seq we recommend size factor normalisation…

Continue Reading Feature selection

edgeR parameters

edgeR parameters 0 I have a doubt regarding filtering results of edgeR I am not getting how to consider whether our genes which we got from edgeR are significant or not.We got 22,000 genes but I need to filter .The parameters set wereMin CPM =1, Log2fc=0,Pvalue adj=0.05. How should I…

Continue Reading edgeR parameters

The day the world turned upside down

This newspaper’s headlines on this day 20 years ago spoke of a standard day in the news cycle for our journalists in Academy Street, Cork and Harcourt Street, Dublin.  Billions had been wiped off the value of Irish pensions in one of the market’s periodic slumps; Tipperary was celebrating the…

Continue Reading The day the world turned upside down

Kaggle Learn Pandas

Listing Results Kaggle learn pandas Learn Pandas Tutorials Kaggle Learn Kaggle.com All Courses 5 hours agoPrepares you for these Learn Courses: Geospatial Analysis, Data Cleaning. Tags: pandas. Instructor. Aleksey Bilogur. Educator. Aleksey is a civic data specialist and … 1. Creating, Reading and WritingCreating, Reading and Writing | Kaggle2. Indexing,…

Continue Reading Kaggle Learn Pandas

Kaggle Mini Courses

Listing Results Kaggle mini courses Learn Python, Data Viz, Pandas & More Tutorials Kaggle Data Kaggle.com All Courses 8 hours agoPython Learn the most important language for data science. Intro to Machine Learning Learn the core ideas in machine learning, and build your first models. Intermediate Machine Learning Handle missing…

Continue Reading Kaggle Mini Courses

MAPQ (Mapping quality) of 0 for most reads from BWA-MEM2 (with no secondary alignment or other apparent reason)

Hello, I got a very weird output from BWA-mem2 – most of the reads have mapping quality of 0, even though there is no secondary alignment or anything else suspicious. I got sequencing data that was aligned with Novoalign to hg18, the data was bam files. I needed to realign…

Continue Reading MAPQ (Mapping quality) of 0 for most reads from BWA-MEM2 (with no secondary alignment or other apparent reason)

WNN in Seurat

Dear all, I am trying to follow the WNN vignette here satijalab.org/seurat/articles/weighted_nearest_neighbor_analysis.html After the steps below, I would like to annotate my clusters, hence I need to know the markers which best represent each cluster. pbmc <- FindMultiModalNeighbors(pbmc, reduction.list = list(“pca”, “lsi”), dims.list = list(1:50, 2:50)) pbmc <- RunUMAP(pbmc, nn.name

Continue Reading WNN in Seurat

Replace fasta header using bash : bioinformatics

Hello people, I got stucked with my new script and perhaps you can help me. Its goal is to take an input table with querys and subjects (originated by a local blast) and replace query names with subject names in the corresponding fasta file. In detail, the table input file…

Continue Reading Replace fasta header using bash : bioinformatics

How to get Read Counts from MACS2 output files?

How to get Read Counts from MACS2 output files? 0 Hello, I am working with GEO datasets that supply both bigwig(bw) and bed files for each ATAC sample. I need the read counts/pile up value for downstream analysis, but the 6+4 narrow peak file format from MACS2 does not include…

Continue Reading How to get Read Counts from MACS2 output files?

Comparative genomics provides insights into the aquatic adaptations of mammals

Species invasions into novel habitats mark major transitions in the evolution of life on Earth. Some of these are relatively ancient, such as the vertebrate transition from the oceans to life on land (∼375 Mya) or the evolution of arboreal vertebrate species (∼160 Mya). When divergent lineages transition to the…

Continue Reading Comparative genomics provides insights into the aquatic adaptations of mammals

Normalization and differential analysis in ATAC-seq data

Normalization and differential analysis in ATAC-seq data 2 Hello everyone! I would like to know if someone had experiences with normalization and differential expression on ATAC-seq data. After using MACS2 for the peak calling, how can we use Dseq2 or EdgeR on these datas? Someone try this? What is the…

Continue Reading Normalization and differential analysis in ATAC-seq data

Population of Treatment-Resistant Cells Identified in Prostate Cancer Samples

Prostate cancer is the most common male cancer and approximately 5,000 Finnish men are diagnosed with it each year. While most prostate cancers are not aggressive, some tumors develop into a deadly castration-resistant form of the disease. One of the most significant clinical challenges today is deciding which type of…

Continue Reading Population of Treatment-Resistant Cells Identified in Prostate Cancer Samples

The 10 Best Tableau Tutorials on YouTube to Watch Right Now

This list of the best Tableau tutorials on YouTube will introduce you to one of the most popular analytics and business intelligence platforms. Tableau is one of the most widely used business intelligence and data analytics platforms in the world. It features powerful data discovery and exploration capabilities that allow…

Continue Reading The 10 Best Tableau Tutorials on YouTube to Watch Right Now