Category: EMBL

Single cell RNA-seq analysis using a Galaxy interface

In this webinar, we will look at a Galaxy interface for single cell analysis. Specifically, we will run Scanpy (which would otherwise require Python programming skills) to analyse a Drop-seq dataset located in EMBL-EBI’s Single Cell Expression Atlas. Who is this course for? This webinar is aimed at individuals…

Continue Reading Single cell RNA-seq analysis using a Galaxy interface

Anyone could help me with cutadapt?

I’, trying to trim my primers off from Illumina sequences. I ‘ve amplified with: Diat_rbcL_F1 AGGTGAAGTAAAAGGTTCWTACTTAAA, Diat_rbcL_F2 AGGTGAAGTTAAAGGTTCWTAYTTAAA and Diat_rbcL_F3 AGGTGAAACTAAAGGTTCWTACTTAAA as Forward primers and Diat_rbcL_R1 5’CCTTCTAATTTACCWACWACTG 3’ (Reverse Complement: 3’CAGTWGTWGGTAAATTAGAAGG 5’) and Diat_rbcL_R2 5’CCTTCTAATTTACCWACAACAG 3’ (Reverse Complement: 3’CTGTTGTWGGTAAATTAGAAGG 5’) Reverse primers. First, I used PEAR to assembly paired reads…

Continue Reading Anyone could help me with cutadapt?

the way to find pseudogenes in my scaffolds of genome

the way to find pseudogenes in my scaffolds of genome 3 Hello Recently, I assembled genome of a beetle living underground. My interest is searching pseudogenes (premature stop codon or frameshifts). I conducted tblastn using a few genes of model organisms (Tribolium) as query. But no premature stop codons were…

Continue Reading the way to find pseudogenes in my scaffolds of genome

biomaRt does not convert entrez gene id to ensembl gene id

biomaRt does not convert entrez gene id to ensembl gene id 0 I am trying to convert my entrez gene_id to ensembl gene_id. Here is my R codes > library(biomaRt) > ensembl<- useEnsemblGenomes(biomart = “plants_mart”) > searchDatasets(ensembl,pattern = “Beta”) dataset description 14 bvulgaris_eg_gene Beta vulgaris genes (RefBeet-1.2.2) version 14 RefBeet-1.2.2…

Continue Reading biomaRt does not convert entrez gene id to ensembl gene id

Sort a sub column within a column while keeping the feature (LINUX)

I have a vcf file with these column headers: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT BS_25YES2E3 BS_G5B6AD28 BS_QCGPE1ZX A sample feature within that vcf file chr1 10450 . T C 27.94 VQSRTrancheSNP99.90to100.00+ AC=1;AF=0.167;AN=6;BaseQRankSum=-1.676e+00;ClippingRankSum=0.789;DP=102;ExcessHet=4.7712;FS=4.868;MLEAC=1;MLEAF=0.167;MQ=34.67;MQRankSum=-1.084e+00;PG=0,0,0;QD=1.55;ReadPosRankSum=-2.169e+00;SOR=0.707;VQSLOD=-1.050e+01;culprit=MQ;ANN=C|upstream_gene_variant|MODIFIER|**DDX11L1**|ENSG00000223972|Transcript|ENST00000450305|transcribed_unprocessed_pseudogene|||||||||||1560|1||SNV|HGNC|HGNC:37102||||chr1:g.10450T>C,C|upstream_gene_variant|MODIFIER|DDX11L1|ENSG00000223972|Transcript|ENST00000456328|processed_transcript|||||||||||1419|1||SNV|HGNC|HGNC:37102|YES|||chr1:g.10450T>C,C|downstream_gene_variant|MODIFIER|WASH7P|ENSG00000227232|Transcript|ENST00000488147|unprocessed_pseudogene|||||||||||3954|-1||SNV|HGNC|HGNC:38034|YES|||chr1:g.10450T>C GT:AD:DP:FT:GQ:JL:JP:PL:PP 0/0:28,0:28:lowGQ:0:1:1:0,0,663:0,0,666 0/1:13,5:18:PASS:35:1:1:34,0,342:35,0,345 0/0:44,0:44:lowGQ:0:1:1:0,0,802:0,0,805 The portion in bold is what I want (DDX11L1). I…

Continue Reading Sort a sub column within a column while keeping the feature (LINUX)

Where can I find a complete mapping of Gencode versions to Ensembl versions?

Where can I find a complete mapping of Gencode versions to Ensembl versions? 2 The UCSC track browser has a page listing all the Gencode tracks currently available along with their corresponding Ensembl versions. For example, the latest version at time of writing says “All GENCODE annotations from V37 (Ensembl…

Continue Reading Where can I find a complete mapping of Gencode versions to Ensembl versions?

11th Place Solution of Kaggle Global Wheat Detection

Solution Summary Our solution is based on the excellent MMDetection framework. We trained an ensemble of the following models: To increase the score a single round of pseudo labelling was applied to each model. Additionally, for a much better generalization of our models, we used heavy augmentations. Jigsaw puzzles In…

Continue Reading 11th Place Solution of Kaggle Global Wheat Detection

Gromacs manual grompp

#725013 – gromacs-openmpi: grompp crashes with invalid GROMACS Molecular Dynamics & GPU Acceleration | NVIDIA Instead, frustrated and confused. The man was slumped over, but he absorbed the blow and stumbled back. But I think it will be better used in this situation.He stopped at my open window to address…

Continue Reading Gromacs manual grompp

Differential enrichment of H3K9me3 at annotated satellite DNA repeats in human cell lines and during fetal development in mouse

The removal of problematic regions The removal of problematic genomic regions is considered essential for the accurate analysis of data obtained by chromatin immunoprecipitation followed by genome sequencing (ChIP-Seq) [27, 35]. Repetitive regions including satellite DNA arrays comprise a majority of such problematic regions, mainly because they reside in the…

Continue Reading Differential enrichment of H3K9me3 at annotated satellite DNA repeats in human cell lines and during fetal development in mouse

Next-Generation Dna Sequencing Inf 2E Cb BOOKH NEW 9781621821236

Next-generation DNA sequencing (NGS) techlogy has revolutionized biomedical research, making geme and RNA sequencing an affordable and frequently used tool for a wide variety of research applications including variant (mutation) discovery, gene expression, transcription factor analysis, metagemics, and epigenetics. Bioinformatics methods to support DNA sequencing have become and remain a…

Continue Reading Next-Generation Dna Sequencing Inf 2E Cb BOOKH NEW 9781621821236

How to call variant minimum 3 read coverage to make consensus?

How to call variant minimum 3 read coverage to make consensus? 0 I have a query regarding consensus sequence assembly where reference bases are replaced with variants with a minimum of 3 read depths, using bcftools using the below command. bcftools mpileup -f ref.fasta mapped.bam | bcftools call -c |…

Continue Reading How to call variant minimum 3 read coverage to make consensus?

Postdoctoral Fellow – Computational Analysis of Microbiome Data

We are seeking a highly motivated computational biologist to join the research group of Peer Bork within the Structural and Computational Biology Unit as a postdoctoral fellow. This bioinformatics group works on a wide range of topics with a current focus on microbiome analysis in ecosystems like the human gut…

Continue Reading Postdoctoral Fellow – Computational Analysis of Microbiome Data

The Biostar Handbook. A bioinformatics e-book for beginners.

March, 2020: Coronavirus Genome Analysis A new book has been released in the Biostar Handbook series: The book introduces readers to the practical aspects of investigating data from a viral outbreak. January, 2020: RNA-Seq by Example A new book has been released in the Biostar Handbook series: A step by…

Continue Reading The Biostar Handbook. A bioinformatics e-book for beginners.

3D Printed model of DNA-Sequencing Nanopore

DNA sequencing has revolutionized the study of biology. Its latest iteration – Nanopore sequencing, is rapidly developing due to the low cost of the device itself and the wide applicability of the technology.  The 3D printed model is a great addition to any lectures on sequencing with protein nanopores. The…

Continue Reading 3D Printed model of DNA-Sequencing Nanopore

Adjunct Faculty: Bioinformatics – Intro to Bioinformatics, Practical Computer Concepts for Bioinform – Baltimore

Johns Hopkins University Advanced Academic Programs Biotechnology Program Adjunct Faculty: Bioinformatics (Introduction to Bioinformatics, Practical Computer Concepts for Bioinformatics, Metagenomics) Institution Description: The Advanced Academic Programs (AAP) is a division of the Krieger School of Arts and Sciences at the Johns Hopkins University (JHU). As the nation’s oldest and one…

Continue Reading Adjunct Faculty: Bioinformatics – Intro to Bioinformatics, Practical Computer Concepts for Bioinform – Baltimore

Identification of electroporation sites in the complex lipid organization of the plasma membrane

Abstract The plasma membrane of a biological cell is a complex assembly of lipids and membrane proteins, which tightly regulate transmembrane transport. When a cell is exposed to a strong electric field, the membrane integrity becomes transiently disrupted by formation of transmembrane pores. This phenomenon, termed electroporation, is already utilized…

Continue Reading Identification of electroporation sites in the complex lipid organization of the plasma membrane

gmod post processing not working

In principle it is working. on gmod possessor mod. Found inside – Page 241The problem is that a postprocessing vertex for argument y in the call to Add from A is included in A’s procedure … summary information consists of the following sets , which are computed for each procedure…

Continue Reading gmod post processing not working

gmod roleplay model pack

Update: Fixed bumpmaps and rigging errors for all! –I did not make this addon, I’m only supporting the community by adding it to the Gmod 13 workshop.–. Go the the GMOD Textures Page. However, I feel that this pack has both more content at a higher quality than pack 1,…

Continue Reading gmod roleplay model pack

Junior Sections of FEBS Societies – The AlphaFold Database

To bring together students and young researchers in the molecular life sciences from all over Europe, the Junior Sections of the ÖGMBT (Austria), GBM (Germany), SIB (Italy), NVBMB (the Netherlands) SEBBM (Spain), and the Biochemical Society (UK) have collaborated with FEBS to establish an initiative: the Junior Sections of FEBS…

Continue Reading Junior Sections of FEBS Societies – The AlphaFold Database

teomotun/LAMMPS-Water-Methanol-Simulation: Molecular Dynamics Simulation of Water-Methanol Mixture to determine physical properties like self-diffusion coefficient, density and shear viscosity for a system consisting of 216 molecules of water and 216 molecules of methanol

GitHub – teomotun/LAMMPS-Water-Methanol-Simulation: Molecular Dynamics Simulation of Water-Methanol Mixture to determine physical properties like self-diffusion coefficient, density and shear viscosity for a system consisting of 216 molecules of water and 216 molecules of methanol Files Permalink Failed to load latest commit information. Type Name Latest commit message Commit time BACKGROUND…

Continue Reading teomotun/LAMMPS-Water-Methanol-Simulation: Molecular Dynamics Simulation of Water-Methanol Mixture to determine physical properties like self-diffusion coefficient, density and shear viscosity for a system consisting of 216 molecules of water and 216 molecules of methanol

What files (fasta, GTF) do I need for RNA seq analysis

What files (fasta, GTF) do I need for RNA seq analysis 1 I am very new to programming in general, and I’m trying my best to teach myself R for analyzing RNA-seq data we have. I am using this guide and have gotten to the step where I need to…

Continue Reading What files (fasta, GTF) do I need for RNA seq analysis

Get the snp id (rs) from the name of genes

Get the snp id (rs) from the name of genes 2 I have a list of genes and I want to see all available SNP related to those genes. so I need to get the SNP ID (rs) from the gene name by using python or R. snp rs gene…

Continue Reading Get the snp id (rs) from the name of genes

Understanding pilon correction on the reference sequence

Understanding pilon correction on the reference sequence 0 Hello, I need some clarification about specific kind fix made by pilon on the reference sequence: ref -GGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA fix CGGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA *********************************************************** ref TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC fix TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC ************************************************************ ref GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA fix GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA ************************************************************ ref CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG fix CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG ************************************************************ ref AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG fix AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG ************************************************************ ref…

Continue Reading Understanding pilon correction on the reference sequence

DEXSeq prepare annotation script throws “object has no attribute ‘next'” for Ensemble GTFs

DEXSeq prepare annotation script throws “object has no attribute ‘next’” for Ensemble GTFs 0 @24764cda Last seen 23 hours ago United States Hi there, I am trying to run the dexseq_prepare_annotation.py script and the code keeps failing after parsing the first line of the gtf. Specifically, the code is failing…

Continue Reading DEXSeq prepare annotation script throws “object has no attribute ‘next'” for Ensemble GTFs

Workshop proceedings: GWAS summary statistics standards and sharing: Cell Genomics

Introduction Genome-wide association studies (GWASs) have brought enormous progress in mapping the genetic basis of common diseases or traits, 1 Visscher P.M. Wray N.R. Zhang Q. Sklar P. McCarthy M.I. Brown M.A. Yang J. 10 years of GWAS discovery: Biology, function, and translation. , 2 Claussnitzer M. Cho J.H. Collins…

Continue Reading Workshop proceedings: GWAS summary statistics standards and sharing: Cell Genomics

Postdoctoral Scientist – Koltsova Lab

– Advertisement – Postdoctoral Scientist – Koltsova Lab – Cancer Institute Job About the job When the work you do every single day has a crucial impact on the lives of others, every effort, every detail, and every second matters. This shared culture of happiness, passion, and dedication pulses through…

Continue Reading Postdoctoral Scientist – Koltsova Lab

Pseudogenes in the human genome annotation

Pseudogenes in the human genome annotation 2 Hi everyone, I was wondering if anyone if familiar of any annotation term in the human genes annotation e.g. from gencode or ensembl to be able to extract pseudogenes and separate them from non-pseudogenes. Any thoughts? Thanks in advance, Sergio human genome GRCh38…

Continue Reading Pseudogenes in the human genome annotation

Rsubread FeatureCounts return 0.0% assigned

Using featureCounts in the Rsubread package I am getting 0 annotations. I started from raw sequencing data and the Refseq genome and Refseq Genomic GTF files downloaded from here: www.ncbi.nlm.nih.gov/assembly/GCF_000001635.27/ through the download assembly button on the side. I had the top option to RefSeq for both downloads and chose…

Continue Reading Rsubread FeatureCounts return 0.0% assigned

Truncated/duplicated genes in Metagenome Assembled Genomes (MAGs) from ONT+Illumina hybrid assembly

Truncated/duplicated genes in Metagenome Assembled Genomes (MAGs) from ONT+Illumina hybrid assembly 0 Hello there, I have performed a metagenome assembly on a single sample using both Illlumina and ONT reads (average q-score 10) with opera-ms. Then contigs were binned using maxbin2, metabat2 and concoct, and metaWRAP was used for bin…

Continue Reading Truncated/duplicated genes in Metagenome Assembled Genomes (MAGs) from ONT+Illumina hybrid assembly

Genes associated with GO term

Genes associated with GO term 1 I’ve read in an older thread that to retrieve all of the gene names associated with a GO id you use the biomaRt package, eg: library(biomaRt) ensembl = useMart(“ensembl”,dataset=”hsapiens_gene_ensembl”) gene.data <- getBM(attributes=c(‘hgnc_symbol’, ‘ensembl_transcript_id’, ‘go_id’), filters=”go_id”, values=”GO:0072599″, mart = ensembl) However, I’m not sure this…

Continue Reading Genes associated with GO term

How can I be sure that raw read counts are well processed from fastq files?

How can I be sure that raw read counts are well processed from fastq files? 0 Hi. I’m new in bioinformatics and try to process fastq files for getting raw read count matrix. I downloaded fastq files from www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63452 I used fasterq -dump to download fastq files from SRR Aligned…

Continue Reading How can I be sure that raw read counts are well processed from fastq files?

Research Associate in Bioinformatics/Data Analysis (Fixed Term) – Job Opportunities

We are seeking a highly motivated full time Research Associate in Bioinformatics/Data analysis (grade 7) to join the Cambridge Centre for AI Medicine (CCAIM) directed by Prof Mihaela van der Schaar and co-directed by Prof Andres Floto You will be based in the Department of Medicine Molecular Immunity Unit based…

Continue Reading Research Associate in Bioinformatics/Data Analysis (Fixed Term) – Job Opportunities

BIOINFORMATICS POSTDOC IN EVOLUTIONARY GENOMICS

A postdoctoral position (3 years with possible extensions) is available immediately in the evolutionary genomics group of Henrik Kaessmann. We are seeking highly qualified and enthusiastic applicants with strong skills in computational biology/bioinformatics, ideally also with experience in data mining and comparative or evolutionary genome analyses. We have been interested…

Continue Reading BIOINFORMATICS POSTDOC IN EVOLUTIONARY GENOMICS

sanger method of dna sequencing flow chart

Flowchart Describing Assembly And Annotation Procedures The . Flow Chart Summarizing The Procedure For Identifying The Dna . Sangers Method Of Gene Sequencing Online Biology Notes . Sanger Sequencing Wikipedia . Flow Chart For The Analysis Of A Metagenome From Sequencing . Dna Sequencing Article Biotechnology Khan Academy . Flowchart…

Continue Reading sanger method of dna sequencing flow chart

Looking to start a nanopore sequencing related project

Looking to start a nanopore sequencing related project 0 Hi, I am a master’s student in my last year of study and I need to do a project before I graduate. I want to do something with nanopore sequencing, and I’ve been in contact with a faculty on campus about…

Continue Reading Looking to start a nanopore sequencing related project

Please advise a tutorial/course on genetic data analysis

Please advise a tutorial/course on genetic data analysis 1 Hello everyone! I’m by no means a bioinformaticist, but would like to learn some art (my background is chemistry/computer science/machine learning, I do ML-supported drug design). I would like to analyse human genetic data. Specifically, the task is as follows: given…

Continue Reading Please advise a tutorial/course on genetic data analysis

Reimagining DNA Sequencing With Long Reads: Christian Henry on The Long Run

Today’s guest on The Long Run is Christian Henry. Christian is the CEO of Menlo Park, Calif.-based PacBio. It makes DNA sequencing instruments that are used by scientists around the world. Christian Henry, CEO, PacBio The company has long toiled in the shadow of the market leader – some would…

Continue Reading Reimagining DNA Sequencing With Long Reads: Christian Henry on The Long Run

Plant virus isolate assembler

Plant virus isolate assembler 0 I have a data set of plant viruses contaminated leaves. After filtering out the chloroplast sequences, I’m looking out for a good assembler to assemble the genome of the virus which is a dsDNA virus. I’ve looked for SPAdes but it looks like it cannot…

Continue Reading Plant virus isolate assembler

Read at offset 59230953264 does not begin with “@”.

Read at offset 59230953264 does not begin with “@”. 1 I have been trying to assemble a human genome that has been sequenced on Nanopore-PromethION, basecalled on the latest version of bonito, and am now trying to run an assembly using shasta. The basecalling had no issues, but now when…

Continue Reading Read at offset 59230953264 does not begin with “@”.

[ccp4bb] Bioinformatician position at PDBe

Dear Colleagues, We have an exciting opportunity for a bioinformatician interested in structural biological data and functional annotations to work within the Protein Data Bank in Europe Team (PDBe) at the European Bioinformatics Institute (EMBL-EBI). The work includes standardising post translational modification information within the PDB archive in collaboration with…

Continue Reading [ccp4bb] Bioinformatician position at PDBe

Job: Principal Investigator – Bioinformatics

Education and Experience : – PhD with at least 5 years industrial/academic experience in bioinformatic and computational analysis of biological systems. – Experience in programming particularly Linux, Python, Java or R, to provide analytical tools for querying large sequence and relational databases. Familiarity with HP cluster computing in this context…

Continue Reading Job: Principal Investigator – Bioinformatics

dna seq analysis – Banya

Dna Sequencing Data Analysis Simple Software Tools . Omicscript Pipeline For Dna Seq Data Analysis Array Suite Wiki . Dna Sequencing Data Analysis Simple Software Tools . Omicscript Pipeline For Dna Seq Data Analysis Array Suite Wiki . Dna Sequence Alignment Dna Contig Assembly Software Sequence . Dna Sequence Alignment…

Continue Reading dna seq analysis – Banya

VEP for cancer annotation using COSMIC

VEP for cancer annotation using COSMIC 2 Dear all, I’m struggling in finding how to obtain information about COSMIC database after I annotate a vcf using VEP. The command that I used is: vep -i Mutect2_unfiltered_10643_vs_2434.vcf.gz -o Mutect2_unfiltered_10643_vs_2434_VEP.ann.vcf –assembly GRCh38 –species homo_sapiens –offline –cache –cache_version 99 –dir_cache /.vep –everything –filter_common…

Continue Reading VEP for cancer annotation using COSMIC

K-mer coverage of metgenomic data, what is the uper limit of K?

K-mer coverage of metgenomic data, what is the uper limit of K? 0 It is my understanding that k-mer coverage with regards to sequencing data is simply the distribution of k-mers across the raw sequencing reads and have nothing to do with coverage of the resulting assembly? To that end,…

Continue Reading K-mer coverage of metgenomic data, what is the uper limit of K?

Should you normalization metagenomic data

Should you normalization metagenomic data 0 I am given to understand you should not normalize when you have a smoother coverage and expected amount of data base on BBNorms documentation. Does this mean coverage over the resulting assembly or over something else? However ,given that normalisation is often used to…

Continue Reading Should you normalization metagenomic data

VEP cache issues

VEP cache issues 1 Hello, need some help with VEP cache files. So, I downloaded cache file as written in this manual with www.ensembl.org/info/docs/tools/vep/script/vep_cache.html#cache with curl -O ftp.ensembl.org/pub/release-102/variation/vep/homo_sapiens_vep_102_GRCh38.tar.gz I have file homo_sapiens_vep_102_GRCh38.tar.gz in my /.vep directory However, when running script, I got the error ——————– EXCEPTION ——————– MSG: ERROR: Cache…

Continue Reading VEP cache issues

The distance in nucleotide between two genes on different strands

The distance in nucleotide between two genes on different strands 1 Hello! I’ve a silly question concerning the way of calculating the distance between genes on the same chromosome but on different strand. I’ve retrieved the genes position from Ensembl. For example I’ve would like to calculate the distance between:…

Continue Reading The distance in nucleotide between two genes on different strands

How to do Functional Annotation for Wheat

How to do Functional Annotation for Wheat 1 I Analysed wheat Transcriptome, Ref_Genome: IWGSC ref genome and GFF The result Gene ID looks like TraesCS4A03G1003100 TraesCS3A03G0358300 TraesCS2B03G1298100 TraesCS2B03G1298100 TraesCS2A03G0291000 TraesCS2A03G0291000 TraesCS2A03G0291000 I tried in Ensemble Plant and get some useful annotation. However, how I do GO functional annotation? I tried…

Continue Reading How to do Functional Annotation for Wheat

Replacing BAM with CRAM Files

Replacing BAM with CRAM Files 0 I’m starting to explore mapped sequence data formats. Specifically the possibility of replacing bam files with cram files, as bam and/or ubam files are generally quite heavy. Thus can affect transfer and computational times used in my linux systems. However I wanted to know…

Continue Reading Replacing BAM with CRAM Files

What If Cathie Wood’s Deflation Really Arrives? Now There’s an Antidote

Cathie Wood is a lonely apostate where consumer prices are concerned. The head of Ark Invest, an avid devotee of disruptive technology, ardently believes that deflation lies ahead. This puts her at odds with most of Wall Street, to say the least. But now, just in case she and a…

Continue Reading What If Cathie Wood’s Deflation Really Arrives? Now There’s an Antidote

Lipid biomarkers: molecular tools for illuminating the history of microbial life

1. Berner, E. K. & Berner, R. A. Global Environment: Water, Air, and Geochemical Cycles (Princeton Univ. Press, 2012). 2. Cavosie, A. J., Valley, J. W. & Wilde, S. A. The oldest terrestrial mineral record: a review of 4400 to 4000 Ma detrital zircons from Jack Hills, Western Australia. Dev….

Continue Reading Lipid biomarkers: molecular tools for illuminating the history of microbial life

10X Genomica Supernova Troubleshooting

10X Genomica Supernova Troubleshooting 1 Hi all! I am attempting to perform de novo assembly of sunflower with Supernova 2.0.0. I am having some difficulty getting it to finish within the wallclock limit for resources I am using. I have a wallclock limit of 48 hours on SDSC Comet (64…

Continue Reading 10X Genomica Supernova Troubleshooting

NGSeq/DHPGIndex: This tool is for compressing and indexing pan-genomes and genome sequence collections for scalable sequence and read alignment purposes.

General This tool is for compressing and indexing pan-genomes and genome sequence collections for scalable sequence and read alignment purposes. The pipeline can be deployed in cloud computing environment or in dedicated computing cluster. The tool extends the CHIC aligner gitlab.com/dvalenzu/CHIC with distributed and scalable features. DHPGIndex have been tested…

Continue Reading NGSeq/DHPGIndex: This tool is for compressing and indexing pan-genomes and genome sequence collections for scalable sequence and read alignment purposes.

ENA _Webin submission portal _ERROR

ENA _Webin submission portal _ERROR 0 I have recently uploaded some sequencing runs to the EBI’s ENA database via the Webin submission and upload to their FTP. All sequencing files were successfully uploaded to their FTP but when I am trying to upload their meta file in Webin submission portal…

Continue Reading ENA _Webin submission portal _ERROR

kallisto genomebam error

Hello! I am trying to produce bam files to load to igv after kallisto quant with –genobam option. This is the code that I am using kallisto quant -i Homo_sapiens.GRCh38.cdna.all.release-100.idx -o $FOLDER -t 12 –genomebam -g Homo_sapiens.GRCh38.100.gtf.gz -c hg38.chrom.sizes_clean_tab.txt –rf-stranded ${FILES[$i]} ${FILES[$i+1]} My chromosome file looks like that, tabbed and…

Continue Reading kallisto genomebam error

How to download UCSC bed files for exons/introns/etc

How to download UCSC bed files for exons/introns/etc 0 I’m trying to download reference annotation data –specifically bed files for exons/introns in the mm10 genome, and I saw this question here saying that you can download mm10_exons.bed file from UCSC using the Table browser tool, however I need some help…

Continue Reading How to download UCSC bed files for exons/introns/etc

The new metagenome assembler can generate accurate DNA sequences

Metagenomics often involves the sequencing of DNA samples which can only be described as “complicated”. Such DNA exhibits high heterogeneity, which can cause interspecies disassembly. These disassemblies threaten the very purpose of metagenome sequencing, which is to comprehensively study the gene pool, generating multiple draft genomes in a given sample….

Continue Reading The new metagenome assembler can generate accurate DNA sequences

New metagenome assembler can generate accurate DNA sequences

Metagenomics often involves sequencing DNA samples that can only be described as “tricky.” Such DNA shows high heterogeneity, which can cause interspecies misassemblies. These misassemblies threaten the very purpose of metagenome sequencing, which is to comprehensively study the gene pool, by generating multiple draft genomes in a given sample. This…

Continue Reading New metagenome assembler can generate accurate DNA sequences

Gromacs: gmx::ImdSession::Impl Class Reference

Implementation type for the IMD session. Todo: Make this class (or one extracted from it) model IForceProvider. Use RAII for files and allocations   Impl (const MDLogger &mdlog)   Constructor.   void  prepareMasterSocket ()   Prepare the socket on the MASTER.   void  disconnectClient ()   Disconnect the client.  …

Continue Reading Gromacs: gmx::ImdSession::Impl Class Reference

How to assemble read with a minimum 2 coverage per site

How to assemble read with a minimum 2 coverage per site 0 Hi, I have a query regarding read assembly I have a bam file I made a consensus sequence but I want to make a consensus sequence with a minimum of 2 coverage per site instead of full coverage…

Continue Reading How to assemble read with a minimum 2 coverage per site

Epigenetics, the misunderstood science that could shed new light on ageing | Genetics

A little over a decade ago, a clutch of scientific studies was published that seemed to show that survivors of atrocities or disasters such as the Holocaust and the Dutch famine of 1944-45 had passed on the biological scars of those traumatic experiences to their children. The studies caused a…

Continue Reading Epigenetics, the misunderstood science that could shed new light on ageing | Genetics

Is it advisable to input a count matrix that consists of reads aligned using different algorithms (HT-Seq and Salmon)?

Hello! First of all, thank you for the great package and the excellent documentation that supports it, much appreciated! Sadly, I could not find an answer to my problem, so I wanted to ask here. I have two different bulk RNA-seq datasets, one obtained from TCGA using the TCGAbiolinks package,…

Continue Reading Is it advisable to input a count matrix that consists of reads aligned using different algorithms (HT-Seq and Salmon)?

Nuisance alga discovered at Papahanaumokuakea Marine National Monument

A team of divers conducting marine debris removal efforts in Papahanaumokuakea Marine National Monument in September recently found a nuisance alga known to grow quickly and smother coral reefs. The alga that resembled Chondria tumulosa was located near the north reef of Midway Atoll National Wildlife Refuge and Battle of…

Continue Reading Nuisance alga discovered at Papahanaumokuakea Marine National Monument

Integrated DNA Technologies hiring Bioinformatics Staff Scientist in Coralville, Iowa, United States

IDT is the leading manufacturer of custom oligonucleotides and proprietary technologies for genomics applications. Our work is complex and cutting-edge, and our team members are curious, creative thinkers who understand that good data drives smart decisions. At IDT, we realize that although science may be uniform, people are unique. We…

Continue Reading Integrated DNA Technologies hiring Bioinformatics Staff Scientist in Coralville, Iowa, United States

mdozmorov/excluderanges: Genomic coordinates of problematic genomic regions as GRanges

Genomic ranges of problematic genomic regions that should be avoided when working with genomic data. For human, mouse, and selected model organisms. TL;DR – For human hg38 genome assembly, Anshul recommends ENCFF356LFX exclusion list regions. BED files of exclusion regions are available on the ENCODE project website (Amemiya, Kundaje, and…

Continue Reading mdozmorov/excluderanges: Genomic coordinates of problematic genomic regions as GRanges

Metaplatanus improves metagenome assembly | Mirage News

Metagenomics often involves sequencing DNA samples that can only be described as “tricky.” Such DNA shows high heterogeneity, which can cause interspecies misassemblies. These misassemblies threaten the very purpose of metagenome sequencing, which is to comprehensively study the gene pool, by generating multiple draft genomes in a given sample. This…

Continue Reading Metaplatanus improves metagenome assembly | Mirage News

Next-Gen Test Uses Robotics & AI to Predict Responses to Cancer Drugs

Almost always, cancers have multiple coexisting mutations, which makes finding a drug to treat them very difficult. “We’re so used to thinking. ‘Oh, HER2 breast cancer, Herceptin,’ but that’s the rarity,” said Carla Grandori, MD, PhD, co-founder and CEO of SEngine Precision Medicine, in an interview with MD+DI. “Most of…

Continue Reading Next-Gen Test Uses Robotics & AI to Predict Responses to Cancer Drugs

Research Technician at European Molecular Biology Laboratory (EMBL)

About the team/job A Research Technician position is available at the High Throughput Crystallization Laboratory (HTX Lab) of the EMBL Grenoble Outstation. The HTX lab is one of the largest platforms for automated macromolecular crystallization screening in Europe and is offering services through the EC-funded project iNEXT Discovery programme and…

Continue Reading Research Technician at European Molecular Biology Laboratory (EMBL)

Local scientists: Blue crabs have double the chromosomes of humans

Those blue crabs eaten at a picnic table in the summer from the Chesapeake Bay had a long mystery behind them. Now, local scientists have cracked the code and know the makeup of their DNA. Sook Chung during her research project on finding the genetic blueprint for the blue crab….

Continue Reading Local scientists: Blue crabs have double the chromosomes of humans

A Tool for Rapid Sequence Comparison

MinHash Sketch is a method of rapidly comparing large strings or sets. In genomics, you can use it like this: 1) Gather all the kmers in a genome. 2) Apply a hash function to them. 3) Keep the 10000 smallest hashcodes and call this set a “sketch”. If you do…

Continue Reading A Tool for Rapid Sequence Comparison

Maximizing GROMACS Throughput with Multiple Simulations per GPU Using MPS and MIG

GROMACS, a simulation package for biomolecular systems, is one of the most highly used scientific software applications worldwide, and a key tool in understanding important biological processes including those underlying the current COVID-19 pandemic. In a previous post, we showcased recent optimizations, performed in collaboration with the core development team,…

Continue Reading Maximizing GROMACS Throughput with Multiple Simulations per GPU Using MPS and MIG

Science Papers Examine Role of Epigenetics in Liver Fibrosis, Present Bdelloid Genome Assembly

Using single-cell omics analysis, a team led by scientists from Sichuan University has identified an epigenetic cause of liver fibrosis, which may lead to a new treatment strategy for nonalcoholic steatohepatitis (NASH) and other chronic hepatic diseases. NASH is a rising cause of chronic disease that leads to fibrosis, cirrhosis,…

Continue Reading Science Papers Examine Role of Epigenetics in Liver Fibrosis, Present Bdelloid Genome Assembly

Mapping contigs back to samples from co-assembled metagenome.

Mapping contigs back to samples from co-assembled metagenome. 0 In an attempt to increase the quality of our metagenomic assembly and ensure we capture low abundance species we are co assembling ~20 samples. However after the assembly we need to perform some analysis based on the samples, thus I need…

Continue Reading Mapping contigs back to samples from co-assembled metagenome.

Artificial intelligence takes structural biology to the next level

The AI ​​program AlphaFold2 can predict the key characteristics of uromodulin protein filaments. Its cryo-EM structure reveals a complex structure in which one subunit (blue) encloses the other two subunits (teal and magenta). The overall shape of the AI ​​prediction is not the same as the cryo-EM model due to…

Continue Reading Artificial intelligence takes structural biology to the next level

kallisto genomebam not showing reads on igv

Hello! I am trying to produce bam files to load to igv after kallisto quant with –genobam option. After producing and loading the pseudoalignment bam to the igv, it is empty. This is my initial command: kallisto quant -i Homo_sapiens.GRCh38.cdna.all.release-100.idx -o pseudo -t 10 –genomebam -g Homo_sapiens.GRCh38.100.gtf -c hg38.chrom.sizes R1.fastq.gz.trim_1.fq.gz…

Continue Reading kallisto genomebam not showing reads on igv

See how students fused art and science for stunning 2021 PDB Art project

They are the building blocks of life – and their extraordinary structures have inspired these striking artworks from students in Cambridge and beyond. Each year, art students are invited to create pieces based on the Protein Data Bank in Europe (PDBe) – and this year’s work has gone on display…

Continue Reading See how students fused art and science for stunning 2021 PDB Art project

Barostat cp2k error

Barostat cp2k error 08-10-2021 right! like your idea. suggest error barostat cp2k attentively would read, but has CP2K or with plane-wave-based codes such as Error. Espresso. In doing so, the Rahman barostat The statistical…

Continue Reading Barostat cp2k error

Phytoplankton exudates and lysates support distinct microbial consortia with specialized metabolic and ecophysiological traits

Significance Marine dissolved organic matter, which originates from phytoplankton, holds as much carbon as Earth’s atmosphere; yet, the biological processes governing its fate are primarily studied under idealized laboratory conditions or through indirect measures such as genome sequencing. In this work, we used isotope labeling to directly quantify uptake of…

Continue Reading Phytoplankton exudates and lysates support distinct microbial consortia with specialized metabolic and ecophysiological traits

Metagenomic assembly, removing redundant contigs.

Metagenomic assembly, removing redundant contigs. 0 What is the purpose of the following excerpt from paper using metagenomic assemblies: Redundancies of sequences from the same organism within the metagenome were removed by clustering all contigs at 95% identity with CD-hit v4.6.6 (72), and only the longest contig per cluster was…

Continue Reading Metagenomic assembly, removing redundant contigs.

Keeping up with the human genome

The human genome is made up of over three billion base pairs of DNA, which in turn create the 23 chromosome pairs which make up a human being’s genetic code. The initial draft sequence of the human genome was unveiled by Celera Genomics and the International Human Genome Sequencing Consortium…

Continue Reading Keeping up with the human genome

Genome Assembly and Annotation

News:Genome Assembly and Annotation 0 Dear all, registrations are now open for the Physalia course on “Genome Assembly and Annotation”: www.physalia-courses.org/courses-workshops/course20/ When: March, 14th-18th This course will introduce biologists and bioinformaticians to the concepts of de novo assembly and annotation, providing a theoretical framework and practical examples. A variety of…

Continue Reading Genome Assembly and Annotation

EMBL’s two-phase microscopy technique enables deep in vivo brain imaging

06 Oct 2021 Method, combining 3-photon microscopy and adaptive optics, allows neuroscientists to see deeper and observe live neuron activity. A pioneering optical technique developed by the Prevedel Group at EMBL (the European Molecular Biology Laboratory, based in Heidelberg, Germany) allows neuroscientists to observe live neurons deep inside the brain – or…

Continue Reading EMBL’s two-phase microscopy technique enables deep in vivo brain imaging

Unit Administrator – Developmental Biology Jobs in Heidelberg

EMBL is one of the world’s leading research institutions, and Europe’s flagship life sciences organisation. An intergovernmental organisation of 27 member states, EMBL operates sites in France, Germany, Italy, Spain, and the United Kingdom, and provides life science training and service programmes globally. The Developmental Biology (DB) Unit, a department…

Continue Reading Unit Administrator – Developmental Biology Jobs in Heidelberg

Frontiers | Free DNA and Metagenomics Analyses: Evaluation of Free DNA Inactivation Protocols for Shotgun Metagenomics Analysis of Human Biological Matrices

Introduction The advent of modern culture-independent bacterial DNA sequencing technologies allows to achieve an in-depth characterization of the microbial communities inhabiting the human and animal bodies as well as the microbial consortia residing in other environments (Browne et al., 2016; Milani et al., 2017). These innovative metagenomics approaches, such as…

Continue Reading Frontiers | Free DNA and Metagenomics Analyses: Evaluation of Free DNA Inactivation Protocols for Shotgun Metagenomics Analysis of Human Biological Matrices

DeepMind and other AIs: who has the best weather forecast?

The London AI forge DeepMind has a knack for good PR. News that the company has worked with the UK’s national weather service to develop a new, better model for forecasting rainfall has been widely reported. But how much progress is really in the “DGMR”, the “Deep Generative Model of…

Continue Reading DeepMind and other AIs: who has the best weather forecast?

Align sample to two different assemblies, then classify pairs that differ significantly in alignment score

Align sample to two different assemblies, then classify pairs that differ significantly in alignment score 0 Using Bowtie2, I need to align paired-end reads from one sample to two different assemblies. Then, I need to classify pairs that differ significantly in alignment score due to mismatches/gaps. Does anyone have any…

Continue Reading Align sample to two different assemblies, then classify pairs that differ significantly in alignment score

How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)?

How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)? 0 I have a set of metatranscriptomics sequence samples. Let’s say the following sample fastq file is what I have. I would like to map these reads to a bacterial…

Continue Reading How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)?

Ensembl vep. How to filter population frequency less than 1%?

Ensembl vep. How to filter population frequency less than 1%? 0 Hi everyone, I have gotten many responses from the site even though I never asked a question, this is my first query. I am working with ensemble vep to annotate and filter a vcf file. With this script I…

Continue Reading Ensembl vep. How to filter population frequency less than 1%?

Bioinformatics Specialist, Lab of Human Genomics, GIS at Agency for Science, Technology and Research Singapore

Job Description Bioinformatics Specialist We are inviting applications for a bioinformatics specialist position at the Genome Institute of Singapore. Successful candidate will join the research program on generating a human pangenome reference for Asian populations. The current reference (hg37/38) plays an essential role in large-scale genome sequencing analysis of human…

Continue Reading Bioinformatics Specialist, Lab of Human Genomics, GIS at Agency for Science, Technology and Research Singapore

Colossal Begins Ambitious De-Extinction Plan With Elephant Sequencing Project, Despite Critics

NEW YORK – Bioscience and genetics startup Colossal made headlines around the world last month when it revealed its intentions to bring the woolly mammoth back from extinction. But underneath that sensational plan lies a mission that’s slightly more nuanced, beginning with the goal of genetically preserving endangered species for the benefit of…

Continue Reading Colossal Begins Ambitious De-Extinction Plan With Elephant Sequencing Project, Despite Critics

Cenozoic climatic changes drive evolution and dispersal of coastal benthic foraminifera in the Southern Ocean

1. Thomson, M. R. A. Geological and palaeoenvironmental history of the Scotia Sea region as a basis for biological interpretation. Deep Sea Res. II 51, 1467–1487 (2004). Article  ADS  Google Scholar  2. Maldonado, A. et al. A model of oceanic development by ridge jumping: Opening of the Scotia Sea. Glob….

Continue Reading Cenozoic climatic changes drive evolution and dispersal of coastal benthic foraminifera in the Southern Ocean

Sequencing, mRNA, nanocrystals: Field for Nobel Prize in chemistry wide open

Stockholm – Breakthroughs in DNA sequencing, innovative gas storage, nanocrystals or a second chance for mRNA COVID-19 vaccines? Speculators on the Nobel Prize in chemistry are spoiled for choice ahead of the announcement on Wednesday. The winner — or winners — of the prestigious prize will be unveiled at 11:45…

Continue Reading Sequencing, mRNA, nanocrystals: Field for Nobel Prize in chemistry wide open

Index of /~psgendb/birchhomedir/GenBank/workspace/reads.spadescorr.k99/K99

Name Last modified Size Description Parent Directory   –   assembly_graph.fastg 2021-06-17 16:25 156M   assembly_graph_with_..> 2021-06-17 16:25 78M   before_rr.fasta 2021-06-17 16:24 78M   configs/ 2021-06-17 13:22 –   final.lib_data 2021-06-17 16:25 12K   final_contigs.fasta 2021-06-17 16:25 77M   final_contigs.paths 2021-06-17 16:25 3.3M   intermediate_contigs..> 2021-06-17 16:15 78M  …

Continue Reading Index of /~psgendb/birchhomedir/GenBank/workspace/reads.spadescorr.k99/K99

Sequencing, mRNA, or maybe nanocrystals? Wide-open field for Nobel Chemistry Prize

Issued on: 06/10/2021 – 07:28 Stockholm (AFP) Breakthroughs in DNA sequencing, innovative gas storage, nanocrystals or a second chance for mRNA Covid-19 vaccines? Speculators on the Nobel Prize in Chemistry are spoiled for choice ahead of the announcement on Wednesday. The winner — or winners — of the prestigious prize…

Continue Reading Sequencing, mRNA, or maybe nanocrystals? Wide-open field for Nobel Chemistry Prize

Biochemistry Jobs In Germany

Technical University of MunichPeople who searched for Microbiology jobs in Germany also searched for lab technician, assistant professor molecular biology, biology intern, research scientist fermentation, synthetic biology, pharmacy technician, scientific project manager, research technologist, scientist biology, research microbiologist. If you’re getting few results, try a …Website listing Biochemistry jobs in…

Continue Reading Biochemistry Jobs In Germany

Bionexus: Gene Synthesis Services

 GENE SYNTHESIS SERVICES Gene SynthesisBionexus will construct any gene the way you want it, from a few hundred base pairs to thousands of base pairs. The experts at Bionexus (over 9 years experience), will construct your gene and sequence both strands to ensure that you get no mutants.  Gene Synthesis…

Continue Reading Bionexus: Gene Synthesis Services

EMBL and University of Tartu sign MoU to boost scientific collaboration

Since June 2019, Estonia has been a prospect member state of the European Molecular Biology Laboratory (EMBL). A memorandum of understanding (MoU) has now been signed between EMBL and the University of Tartu, a leading centre of research and training. The MoU aims to strengthen cooperation between EMBL and the…

Continue Reading EMBL and University of Tartu sign MoU to boost scientific collaboration

Nobel Prize in Physics Honors Work on Climate Change

The Nobel Prize in Physics was awarded on Tuesday to three scientists whose work “laid the foundation of our knowledge of the Earth’s climate and how humanity influences it.” The winners were Syukuro Manabe of Princeton University, Klaus Hasselmann of the Max Planck Institute for Meteorology in Hamburg, Germany, and…

Continue Reading Nobel Prize in Physics Honors Work on Climate Change

Cis-acting mutation affecting GJA5 transcription is underlying the Melanotic within-feather pigmentation pattern in chickens

Significance The molecular mechanisms underlying pigmentation patterns in animals is to a large extent an unresolved mystery in biology. For example, compared with mammals, birds show a stunning diversity in pigmentation patterns. This study advances the knowledge concerning the mechanisms creating periodic pigmentation patterns in individual feathers. We show that…

Continue Reading Cis-acting mutation affecting GJA5 transcription is underlying the Melanotic within-feather pigmentation pattern in chickens

How do I get GO term annotations using VEP?

How do I get GO term annotations using VEP? 1 I’m running VEP version 85 in offline mode, but I wasn’t asked to download any database for GO. I’m using the GO.pm plugin in my command-line, but the GO column is completely empty. The Clinvar column is not empty, and…

Continue Reading How do I get GO term annotations using VEP?