Category: tRNA

How to use stringtie without reference guide

How to use stringtie without reference guide 0 I’m reading an article about enhancer RNA, and the author described it like this in the method section: To identify and characterize the transcript features of eRNAs and uaRNAs, we performed de novo assembly of nascent transcriptome by the Stringtie algorithm (Pertea…

Continue Reading How to use stringtie without reference guide

EDGE-pro paired end read input

Hi, I am running EDGE-pro for prokaryotic RNA seq analysis for differential gene expression. ccb.jhu.edu/software/EDGE-pro/ I have paired end read data. The manual states ( ccb.jhu.edu/software/EDGE-pro/MANUAL ) // *MANDATORY FILES: -g genome: fasta file containing bacterial genome. If multiple chromosomes/plasmids exist, they must be combined into one file before running…

Continue Reading EDGE-pro paired end read input

Antigen receptor stimulation drives selection against pathogenic mtDNA variants that dysregulate lymphocyte responses

Abstract Pathogenic mitochondrial (mt)DNA molecules can exhibit heteroplasmy in single cells and tissues and cause a range of clinical phenotypes, although their contribution to immunity is poorly understood. Here, in mice carrying heteroplasmic C5024T in mt-tRNA Ala – that impairs oxidative phosphorylation – we found a reduced mutation burden in…

Continue Reading Antigen receptor stimulation drives selection against pathogenic mtDNA variants that dysregulate lymphocyte responses

Cannot find reasonable band width. Continue anyway

Cannot find reasonable band width. Continue anyway 0 i’m running a bioinformatic tool called ltr finder, when i runned the command bellow ltr_finder $DATA/$organis_name.fna -s $tRNA/${organis_name}_trna.fasta -a $LTR_Finder/ps_scan -w2 -E -C > $ltr_table/$organis_name.table with the $organis_name changes from one genome to another. in some genomes i don’t get this message…

Continue Reading Cannot find reasonable band width. Continue anyway

Cell reprogramming shapes the mitochondrial DNA landscape.

dc.contributor.author Wei, Wei dc.contributor.author Gaffney, Daniel J dc.contributor.author Chinnery, Patrick F dc.date.accessioned 2021-10-05T00:26:36Z dc.date.available 2021-10-05T00:26:36Z dc.date.issued 2021-09-02 dc.identifier.issn 2041-1723 dc.identifier.other 34475388 dc.identifier.other PMC8413449 dc.identifier.uri www.repository.cam.ac.uk/handle/1810/328995 dc.description.abstract Individual induced pluripotent stem cells (iPSCs) show considerable phenotypic heterogeneity, but the reasons for this are not fully understood. Comprehensively analysing the mitochondrial genome…

Continue Reading Cell reprogramming shapes the mitochondrial DNA landscape.

Quantitative PCR assay for detection of Helicobacter pylori

Introduction Helicobacter pylori is a common pathogen that infects nearly 50% of the global population.1 Infection with this pathogen causes chronic gastritis, which can cause chronic gastroduodenal diseases such as gastritis, gastric ulcer, duodenal ulcer, gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) B-cell lymphoma.2 Although H. pylori is the…

Continue Reading Quantitative PCR assay for detection of Helicobacter pylori

Calculation of tRNA abundances from different cell types

Calculation of tRNA abundances from different cell types 0 Dear all, My research group had completed an analysis on tRNA levels before I joined to study. The aim was to compare tRNA abundances of healthy and diseased groups and they have raw data from bulk RNA sequencing. However, bulk RNA-seq…

Continue Reading Calculation of tRNA abundances from different cell types

ASM398515v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::11/08/2018 19:10:23 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::4.6 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,991 CDS (total)::6,937 Genes (coding)::6,633 CDS (coding)::6,633 Genes (RNA)::54 rRNAs::1, 1, 1 (5S, 16S, 23S) complete rRNAs::1, 1, 1 (5S, 16S,…

Continue Reading ASM398515v1 – Genome – Assembly

ASM220219v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::12/14/2020 00:44:35 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,032 CDSs (total)::5,900 Genes (coding)::5,729 CDSs (with protein)::5,729 Genes (RNA)::132 rRNAs::9, 8, 8 (5S, 16S, 23S) complete rRNAs::9, 8,…

Continue Reading ASM220219v1 – Genome – Assembly

How to detect which Ensembl transcript ID corresponds to tRNAs

How to detect which Ensembl transcript ID corresponds to tRNAs 1 Dear all, I have a list of Ensembl transcript IDs (ENST00000492842, ENST00000495576, ENST00000477740, ENST00000610542 for example). These IDs are obtained after transcript quantification and annotation of RNA-Seq raw data. I would like to find which of these IDs corresponds…

Continue Reading How to detect which Ensembl transcript ID corresponds to tRNAs

genbank database slideshare

Found inside – Page iiThis book describes the historical importance of potato (Solanum tuberosum L.),potato genetic resources and stocks (including S. tuberosum group Phureja DM1-3 516 R44, a unique doubled monoploid homozygous line) used for potato genome … If you continue browsing the site, you agree to the use of…

Continue Reading genbank database slideshare

genbank submission bankit

Submission of sequence data to NCBI archives . Learn more. This post will show you how to… Careers, General: your contact details, authors, publication, data release date, Original or third-party assembly/annotation, Set designation (if applicable) for multiple sequences of the same locus, Nucleotide sequences in FASTA or alignment format, Source…

Continue Reading genbank submission bankit

ASM736263v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::06/02/2020 01:47:34 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,988 CDSs (total)::3,870 Genes (coding)::3,819 CDSs (with protein)::3,819 Genes (RNA)::118 rRNAs::9, 9, 9 (5S, 16S, 23S) complete rRNAs::9, 9,…

Continue Reading ASM736263v1 – Genome – Assembly

ASM167996v1 – Genome – Assembly

##Genome-Annotation-Data-START##Annotation Provider::NCBIAnnotation Date::06/26/2015 16:52:29Annotation Pipeline::NCBI Prokaryotic Genome Annotation PipelineAnnotation Method::Best-placed reference protein set; GeneMarkS+Annotation Software revision::2.10Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_regionGenes::5,138CDS::4,851Pseudo Genes::241rRNAs::3 (5S, 16S, 23S)tRNAs::51ncRNA::2Frameshifted Genes::42##Genome-Annotation-Data-END## Read more here: Source link

Continue Reading ASM167996v1 – Genome – Assembly

MtDNA Analysis Indicates Human-Induced Temporal Changes of Serbian Honey Bees Diversity

Local populations of Apis mellifera are rapidly changing by modern beekeeping through the introduction of nonnative queens, selection and migratory beekeeping. To assess the genetic diversity of contemporary managed honey bees in Serbia, we sequenced mitochondrial tRNAleu-cox2 intergenic region of 241 worker bees from 46 apiaries at eight localities. Nine…

Continue Reading MtDNA Analysis Indicates Human-Induced Temporal Changes of Serbian Honey Bees Diversity

ASM1313853v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::04/13/2020 22:53:33 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,412 CDSs (total)::6,343 Genes (coding)::6,253 CDSs (with protein)::6,253 Genes (RNA)::69 rRNAs::1, 3, 1 (5S, 16S, 23S) complete rRNAs::1, 1, 1…

Continue Reading ASM1313853v1 – Genome – Assembly

ASM1227319v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::03/20/2021 14:54:46 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.1 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,410 CDSs (total)::5,316 Genes (coding)::5,040 CDSs (with protein)::5,040 Genes (RNA)::94 rRNAs::5, 5, 5 (5S, 16S, 23S) complete rRNAs::5, 5,…

Continue Reading ASM1227319v1 – Genome – Assembly

ASM970690v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::11/18/2019 18:15:11 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.10 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::1,947 CDSs (total)::1,901 Genes (coding)::1,870 CDSs (with protein)::1,870 Genes (RNA)::46 rRNAs::1, 1, 1 (5S, 16S, 23S) complete rRNAs::1, 1, 1…

Continue Reading ASM970690v1 – Genome – Assembly

ASM1284312v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::04/20/2020 16:43:15 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,003 CDSs (total)::5,939 Genes (coding)::5,837 CDSs (with protein)::5,837 Genes (RNA)::64 rRNAs::5, 3, 1 (5S, 16S, 23S) complete rRNAs::3, 1, 1…

Continue Reading ASM1284312v1 – Genome – Assembly

ASM1328274v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::06/07/2020 12:05:23 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::4,014 CDSs (total)::3,896 Genes (coding)::3,803 CDSs (with protein)::3,803 Genes (RNA)::118 rRNAs::8, 7, 7 (5S, 16S, 23S) complete rRNAs::8, 7,…

Continue Reading ASM1328274v1 – Genome – Assembly

ASM400961v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::03/08/2021 23:28:36 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.1 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,490 CDSs (total)::3,415 Genes (coding)::3,382 CDSs (with protein)::3,382 Genes (RNA)::75 rRNAs::4, 3, 3 (5S, 16S, 23S) complete rRNAs::4, 3,…

Continue Reading ASM400961v1 – Genome – Assembly

ASM1297410v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::05/05/2020 16:09:27 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::2,251 CDSs (total)::2,191 Genes (coding)::2,085 CDSs (with protein)::2,085 Genes (RNA)::60 rRNAs::2, 2, 2 (5S, 16S, 23S) complete rRNAs::2, 2,…

Continue Reading ASM1297410v1 – Genome – Assembly

ASM304080v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::04/01/2018 01:38:47 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::4.5 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::2,367 CDS (total)::2,274 Genes (coding)::2,243 CDS (coding)::2,243 Genes (RNA)::93 rRNAs::7, 8, 15 (5S, 16S, 23S) complete rRNAs::7, 1 (5S, 16S) partial…

Continue Reading ASM304080v1 – Genome – Assembly

ASM1176462v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::12/15/2020 08:11:39 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,914 CDSs (total)::3,831 Genes (coding)::3,661 CDSs (with protein)::3,661 Genes (RNA)::83 rRNAs::6, 6, 6 (5S, 16S, 23S) complete rRNAs::6, 6,…

Continue Reading ASM1176462v1 – Genome – Assembly

ASM219714v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::04/12/2021 12:00:30 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.1 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,585 CDSs (total)::6,517 Genes (coding)::6,275 CDSs (with protein)::6,275 Genes (RNA)::68 rRNAs::3, 3, 3 (5S, 16S, 23S) complete rRNAs::3, 3,…

Continue Reading ASM219714v1 – Genome – Assembly

ASM1256225v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::03/03/2021 03:39:52 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.1 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,121 CDSs (total)::5,004 Genes (coding)::4,912 CDSs (with protein)::4,912 Genes (RNA)::117 rRNAs::9, 8, 8 (5S, 16S, 23S) complete rRNAs::9, 8,…

Continue Reading ASM1256225v1 – Genome – Assembly

ASM287772v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::08/10/2016 13:47:02 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::3.3 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,239 CDS (total)::5,153 Genes (coding)::5,058 CDS (coding)::5,058 Genes (RNA)::86 rRNAs::4, 1, 3 (5S, 16S, 23S) complete rRNAs::4 (5S) partial rRNAs::1, 3…

Continue Reading ASM287772v1 – Genome – Assembly

ASM294440v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::04/12/2021 12:36:44 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.1 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::6,152 CDSs (total)::6,087 Genes (coding)::5,833 CDSs (with protein)::5,833 Genes (RNA)::65 rRNAs::3, 3, 3 (5S, 16S, 23S) complete rRNAs::3, 3,…

Continue Reading ASM294440v1 – Genome – Assembly

ASM350094v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::04/27/2018 21:42:42 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::4.5 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,542 CDS (total)::3,498 Genes (coding)::3,451 CDS (coding)::3,451 Genes (RNA)::44 tRNAs::40 ncRNAs::4 Pseudo Genes (total)::47 Pseudo Genes (ambiguous residues)::2 of 47 Pseudo…

Continue Reading ASM350094v1 – Genome – Assembly

ASM314399v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::05/15/2018 16:18:51 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::4.5 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::1,893 CDS (total)::1,839 Genes (coding)::1,782 CDS (coding)::1,782 Genes (RNA)::54 rRNAs::3, 1, 1 (5S, 16S, 23S) complete rRNAs::3, 1 (5S, 16S) partial…

Continue Reading ASM314399v1 – Genome – Assembly

ASM1227490v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::02/09/2021 05:00:21 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::4,608 CDSs (total)::4,469 Genes (coding)::4,408 CDSs (with protein)::4,408 Genes (RNA)::139 rRNAs::10, 9, 9 (5S, 16S, 23S) complete rRNAs::10, 9,…

Continue Reading ASM1227490v1 – Genome – Assembly

ASM298219v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::01/12/2021 08:24:12 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,192 CDSs (total)::5,077 Genes (coding)::4,870 CDSs (with protein)::4,870 Genes (RNA)::115 rRNAs::9, 8, 8 (5S, 16S, 23S) complete rRNAs::9, 8,…

Continue Reading ASM298219v1 – Genome – Assembly

Researchers Engineer a Mini CRISPR Genetic Editing System That Could Be Easier To Deliver Into Cells

CRISPR illustration. Credit: National Institutes of Health A compact and efficient CRISPR-Cas system, named CasMINI, could be broadly useful for cell-engineering and gene-therapy applications because it is easier to deliver into cells. The findings appear in a study that was published on September 3, 2021, in the journal Molecular Cell….

Continue Reading Researchers Engineer a Mini CRISPR Genetic Editing System That Could Be Easier To Deliver Into Cells

Mutational Analysis of Mitochondrial tRNA Genes

Introduction Diabetes is a very complex disease characterized by the presence of chronic hyperglycemia. Clinically, insulin-dependent type 1 and non-insulin-dependent type 2 are the main types of diabetes. Among them, type 2 diabetes mellitus (T2DM, [MIM125853]) is a common endocrine disorder affecting approximately 10% of adult population.1 In most cases,…

Continue Reading Mutational Analysis of Mitochondrial tRNA Genes

ASM212806v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::10/12/2020 21:58:49 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.13 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::767 CDSs (total)::724 Genes (coding)::684 CDSs (with protein)::684 Genes (RNA)::43 rRNAs::1, 1, 1 (5S, 16S, 23S) complete rRNAs::1, 1,…

Continue Reading ASM212806v1 – Genome – Assembly

ASM238634v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::06/05/2020 15:45:56 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::4.11 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::1,994 CDSs (total)::1,917 Genes (coding)::1,885 CDSs (with protein)::1,885 Genes (RNA)::77 rRNAs::4, 4, 4 (5S, 16S, 23S) complete rRNAs::4, 4,…

Continue Reading ASM238634v1 – Genome – Assembly

Comparative genomics provides insights into the aquatic adaptations of mammals

Species invasions into novel habitats mark major transitions in the evolution of life on Earth. Some of these are relatively ancient, such as the vertebrate transition from the oceans to life on land (∼375 Mya) or the evolution of arboreal vertebrate species (∼160 Mya). When divergent lineages transition to the…

Continue Reading Comparative genomics provides insights into the aquatic adaptations of mammals

Bacterial endosymbionts protect beneficial soil fungus from nematode attack

A healthy soil nourishes plants and animals, purifies water and air, and promotes sustainable agriculture. Characteristic for highly complex and competitive soil ecosystems are the frequent and direct interactions between all soil-dwelling microorganisms, animals, and plants (1, 2), all of which need to be provided with minerals and carbon sources….

Continue Reading Bacterial endosymbionts protect beneficial soil fungus from nematode attack

chloramphenicol resistance

Using these strains, it is possible to integrate plasmids that carry the complementary ΦC31 att site onto the chromosome (attP, in this figure). Because the mtDNA codes for key OXPHOS polypeptides, genetic alterations in the mtDNA will affect energy metabolism. Proc Natl Acad Sci U S A. 1969 Jun;98(3):1248-57 eCollection…

Continue Reading chloramphenicol resistance

Where is the annotation file if using the GtRNAdb (tRNA SE analysis) for mapping to RNAseq libraries?

Where is the annotation file if using the GtRNAdb (tRNA SE analysis) for mapping to RNAseq libraries? 0 Hi all, On the GtRNAdb (tRNA-SE analysis) website there is a file containing fasta sequences of different tRNA genes. gtrnadb.ucsc.edu/genomes/eukaryota/Hsapi38/ I aligned this GtRNAdb database with RNAseq libraries using bowtie2 and got…

Continue Reading Where is the annotation file if using the GtRNAdb (tRNA SE analysis) for mapping to RNAseq libraries?

Bioconductor – tRNAdbImport

DOI: 10.18129/B9.bioc.tRNAdbImport     Importing from tRNAdb and mitotRNAdb as GRanges objects Bioconductor version: Release (3.13) tRNAdbImport imports the entries of the tRNAdb and mtRNAdb (trna.bioinf.uni-leipzig.de) as GRanges object. Author: Felix G.M. Ernst [aut, cre] Maintainer: Felix G.M. Ernst <felix.gm.ernst at outlook.com> Citation (from within R, enter citation(“tRNAdbImport”)): Installation To…

Continue Reading Bioconductor – tRNAdbImport

The Point of Base Editors: Correcting Point Mutations

Some genome editing systems are highly conspicuous. They introduce double-strand breaks to DNA that attract the attention of cellular mechanisms such as nonhomologous end joining and homology-directed repair. If a genome editing system is so brash as to attempt a sizable insertion of new DNA, homology-directed repair must ensure that…

Continue Reading The Point of Base Editors: Correcting Point Mutations

Gene mutation analysis in papillary thyroid carcinoma

Introduction Thyroid tumors are the most common malignant tumors of the endocrine system, and their incidence has been increasing in the recent decades. Currently, there are some target drugs that can effectively treat PTC, and next-generation sequencing (NGS) can be used for targeted therapy. In order to make better informed…

Continue Reading Gene mutation analysis in papillary thyroid carcinoma

Scientists Harness Human Protein To Deliver RNA Molecular Medicines to Cells

A fully assembled SEND package is released from the cells and collected for gene therapy. Credit: McGovern Institute Programmable systems, made up of components found in the human body, are a step towards safer targeting and delivery of genetic editing and other targeted therapies. Researchers from MIT, MIT’s McGovern Institute…

Continue Reading Scientists Harness Human Protein To Deliver RNA Molecular Medicines to Cells

Insects | Free Full-Text | MtDNA Analysis Indicates Human-Induced Temporal Changes of Serbian Honey Bees Diversity

Local populations of Apis mellifera are rapidly changing by modern beekeeping through the introduction of nonnative queens, selection and migratory beekeeping. To assess the genetic diversity of contemporary managed honey bees in Serbia, we sequenced mitochondrial tRNAleu-cox2 intergenic region of 241 worker bees from 46 apiaries at eight localities. Nine…

Continue Reading Insects | Free Full-Text | MtDNA Analysis Indicates Human-Induced Temporal Changes of Serbian Honey Bees Diversity

An epigenetic basis of inbreeding depression in maize

INTRODUCTION Charles R. Darwin documented inbreeding depression as growth disadvantages from self-fertilization compared to outcrossing in many plants (1). Prevailing hypotheses suggest that inbreeding depression results from the exposure of deleterious recessive alleles and/or loss of overdominant alleles due to increased homozygosity (2, 3) or reduced recombination frequency in some…

Continue Reading An epigenetic basis of inbreeding depression in maize

Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Continue Reading Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

ASM287662v1 – Genome – Assembly

##Genome-Annotation-Data-START## Annotation Provider::NCBI Annotation Date::08/10/2016 16:40:10 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline Annotation Method::Best-placed reference protein set; GeneMarkS+ Annotation Software revision::3.3 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::3,675 CDS (total)::3,608 Genes (coding)::3,557 CDS (coding)::3,557 Genes (RNA)::67 rRNAs::2, 1, 1 (5S, 16S, 23S) complete rRNAs::1, 1, 1 (5S, 16S,…

Continue Reading ASM287662v1 – Genome – Assembly

A new mtDNA point mutation on tRNA Ser(UCN) in a cardiomyopathic patient – ePrints

A new mtDNA point mutation on tRNA Ser(UCN) in a cardiomyopathic patient Lookup NU author(s): Professor Laurence Bindoff, Dr Margaret Johnson, Professor Robert Lightowlers Downloads Full text for this publication is not currently held within this repository. Alternative links are provided below where…

Continue Reading A new mtDNA point mutation on tRNA Ser(UCN) in a cardiomyopathic patient – ePrints

How to determine exact tRNA sequence

How to determine exact tRNA sequence 0 I use the tRNAscan-SE v2.0.9 for trna prediction. One of the trna predicted is trnG-GCC (with CORE 16.5). The sequence is shown below at coordinate 91435-91506: AGCGGAAGGATGAACCCTCAACCTCAGCCTTGGCAAGGCTATGCTCTACCATTAAGATTAAGCTATTTCCGC I also use MITOFY webserver for annotation. The same trnG-GCC (with CORE 25.78) was predicted by the…

Continue Reading How to determine exact tRNA sequence

How to fix GTF files by adding specific strings into empty gene_id “”

How to fix GTF files by adding specific strings into empty gene_id “” 1 Hi, I want to repair GTF file by adding a unique string (such as Product name) to empty gene_id “”. I would really appreciate it if anyone could provide any solution. For example: grep -m1 ‘gene_id…

Continue Reading How to fix GTF files by adding specific strings into empty gene_id “”

MAKER genome annotation error with SNAP ab initio prediction

I am trying to do a second round of maker genome annotation with ab initio prediction by snap. The error I am getting is as follows: error: unknown command “genome.hmm”, see ‘snap help’. ERROR: Snap failed –> rank=NA, hostname=bioinformatics ERROR: Failed while preparing ab-inits ERROR: Chunk failed at level:0, tier_type:2…

Continue Reading MAKER genome annotation error with SNAP ab initio prediction