Open Source Biology & Genetics Interest Group

Sorting and writing multifasta entries to new fasta files 0 Hi, first post here. So I’m trying take the CDS out of various species’ orthologous sequences. I’m running on a Linux server, and am mainly aiming to use BioPython or Linux programs for this. I’ve run OrthoFinder on 28 species…

Unexpected Std::alloc Error Thrown During Etetoolkit Image Rendering 0 Hello, I am a long time python ete3 user and have yet to encounter the following error message when calling t.render(). I believe the issue has something to do with memory allocation when building the figure, but wonder if it could…

Until recently GEDmatch was a free genealogy website started and run by two men – Curtis Rogers and John Olson that was primarily used by geneologists. GEDmatch allowed users to upload raw DNA data from consumer genetic testing companies like 23andMe and Ancestry to compare with each other. But by…

Currently, there are several companies offering genetic genealogy testing (or genealogical DNA testing) in the United States. Ancestry.com is one of the most popular, offering autosomal testing that leverages software algorithms to match genealogical information with potential relatives. Origins Genealogy uses the AncestryDNA® test because Ancestry.com—the world’s most extensive genetic…

Description This will delete the supplied file or folder under the specified LabKey Server project using WebDAV. Usage labkey.webdav.delete( baseUrl=NULL, folderPath, remoteFilePath, fileSet=”@files” ) Arguments baseUrl a string specifying the baseUrl for the labkey server folderPath a string specifying the folderPath remoteFilePath the path to delete, relative to the LabKey…

Location: 2240 CIEMAS During the past decade, a new generation of high-throughput DNA sequencers has transformed biomedical and biotechnology research. These new technologies have fostered the development of a wide range of applications to basic and clinical research, including SNP discovery, transcriptome profiling, genome sequencing, and epigenetics. The goal of…

Analysts have endeavored to kill the vision-coordinated target attraction in mosquitoes. Analysts used CRISPR-Cas9 to make individuals vague as per Aedes aegypti mosquitoes. The experts using CRISPR-Cas9 mutated the gene encoding Op1, which is the most copious of the five rhodopsin imparted by Aedes aegypti. The examination drove by the…

This transcript has been edited for clarity. It’s Dr Kathy Miller from Indiana University. I’m here with a couple of end-of-summer book club recommendations for you. I realize many people think about the beach read or the pool read as being something light, fluffy, and entertaining. I tend to reach…

The speed, targeting flexibility, and ease-of-use of the CRISPR-Cas system gives researchers the capability to create relevant experimental models for drug discovery screening and testing. To avoid creating bottlenecks, data acquisition and analysis must keep pace with this boom in model generation. Highly sensitive multimode plate readers support CRISPR-Cas applications…

%PDF-1.6 % 1 0 obj >stream 2021-08-26T18:37:11-07:00 2021-06-16T17:01:32+05:30 2021-08-26T18:37:11-07:00 application/pdf untitled uuid:f43f56e3-16e7-49ac-adb2-349c50881175 uuid:fb8b28e1-e542-4d3f-8376-63a7d89fcff2 Acrobat Distiller 6.0.1 for Macintosh; modified using iText 4.2.0 by 1T3XT endstream endobj 4 0 obj >stream HWۖy[|@kX:;Z=Cr”h+?_z @jm’׸4zL+i4d+W`z~syč>髗-g*uC_ #7CbRUW7:bf˃al~ut^_}ײXtQU讝~bQND״u =e-T.Z%Jvj1]q%YPN”Pe$!ZY0U3^Qh{es#gɶMk”g(iaH٪DReR,O>]9λonbɄ$Zv*ey5WkZd ٲJKfxekf”n=xo۽z8ysPR_SNSVn~6iy߉Z6fPFSZ:LNi#mTE2P4j]Ul|m(@ӲRt8nD]XT-x5[ :D2uS-OK)M׿Ru”gřm(s.U>!OD֝^~tYFAD,5e| UYh Dk o8]EOq燩-ͻE3$jpd=~%&} D8U!KUYP*? Read more here: Source link

Fully intact, ancient DNA of a teenage girl dating back to 7,200 years ago has been discovered by archaeologists in Indonesia.  Initial excavation work began in 2015. But it was only ascertained recently that the remains belonged to a teenager who has been named “Bessé”.  The remains of the teenager…

1. Thompson, J. N. & Pellmyr, O. Evolution of oviposition behavior and host preference in Lepidoptera. Annu. Rev. Entomol. 36, 65–89 (1991). Article  Google Scholar  2. Bowers, M. D. Iridoid glycosides and host-plant specificity in larvae of the buckeye butterfly, Junonia coenia (Nymphalidae). J. Chem. Ecol. 10, 1567–1577 (1984). CAS …

SNPs Datasets 0 Hello, I am looking for some public SNPs datasets for various diseases. I have already found some from GEO, but the number of samples are low. Could you give me some information about other resources? Copy Datasets SNPs Diseases Variation Number • 21 views Login before adding…

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Dear cp2k users and experts, I want to use ASE as a job submission tool on supercomputer and further I plan to use ASE to perform Genetic Algorithm global optimization. However, I find for relatively large system containing more than 200 atoms (generated by GA, so it is always a…

Introduction Nuclear protein in testis (NUT) carcinoma (NC) is defined by the rearrangement of the chromosomal region 15q14 harboring the NUTM1 gene. As a clinically aggressive neoplasm with poor differentiation, NC was previously believed to occur primarily in children and young adolescents. However, with an increasing number of reports, middle-aged…

Next generation sequencing can bring about a revolution in biological sciences and unprecedented progress to society as genomics is the sunrise sector of the 21st century just like Information Technology in the 90s took the country to great heights, said Defence Minister Rajnath Singh on Thursday. Mr. Singh was speaking…

looking for interaction tools 0 Hello, I am searching for a tool which can identify list of human genes directly regulated by a specific gene (for example : TP53). I have explored GeneMANIA and some other tools (STRING and inBio Discover) but I am not sure about the interactions which…

Aiming to address the technical challenges of measuring three-dimensional genome organization at the single-cell level, a group of California Institute of Technology researchers has developed a method to generate high-resolution, genome-wide maps of 3D DNA organization in thousands of individual cells. The approach — called single-cell split-pool recognition of interactions…

The high voltage drama surrounding the Illumina ILMN-Grail consolidation is showing no signs of drawing to a close. Following the completion of this longstanding and highly-disputed $7.1 billion merger last week without regulatory approvals, investors are currently waiting to see the magnitude of penalty that the European Commission (EC) might…

While the 2021 hurricane season has already seen a flurry of activity, the worst might still be to come. Expectations for an above average storm season have increased to 65 percent according to the latest forecast from the National Oceanic and Atmospheric Administration, with peak season typically taking shape between mid-August and…

Population sequencing data reveal a compendium of mutational processes in the human germ line By Vladimir B. Seplyarskiy, Ruslan A. Soldatov, Evan Koch, Ryan J. McGinty, Jakob M. Goldmann, Ryan D. Hernandez, Kathleen Barnes, Adolfo Correa, Esteban G. Burchard, Patrick T. Ellinor, Stephen T. McGarvey, Braxton D. Mitchell, Ramachandran S….

Developmental and evolutionary dynamics of cis-regulatory elements in mouse cerebellar cells By Ioannis Sarropoulos, Mari Sepp, Robert Frömel, Kevin Leiss, Nils Trost, Evgeny Leushkin, Konstantin Okonechnikov, Piyush Joshi, Peter Giere, Lena M. Kutscher, Margarida Cardoso-Moreira, Stefan M. Pfister, Henrik Kaessmann Science27 Aug 2021 Single-nucleus analysis of chromatin accessibility elucidates the…

In a new study, researchers from the University of Oxford found that the amount of influence our genes have on disease susceptibility declines as we get older. The results are published in PLoS Genetics. Age and disease risk Human beings are living longer than ever before. It’s estimated that by…

Detecting NUMTS (nuclear mitochondrial sequences) in the whole genome sequenced data 0 Hi All, I want to detect NUMTS (nuclear mitochondrial sequences) that have migrated from the mitochondrial to the nuclear genome using the whole genome sequence data. What could be the best Bioinformatic approach ?? Their presence, extent and…

Using DNA harvested from a museum collection of bear fossils, scientists have established a chronology of how widespread antibiotic use in humans and animals has contaminated the environment over time in Sweden. In a study published this week in Current Biology, researchers from Sweden’s Uppsala University conducted whole-genome sequencing on…

Elsewhere is a community that values inclusivity, joy, and creativity. In order to make this space accessible for everyone, we operate a strict zero-tolerance policy for harassment, discrimination, or hate of any kind. In order for you to join us, we require a US Government issued ID or foreign passport…

Job:HIRING: Data Brokers and Data Broker Supervisor at UCSC 0 Remote Candidates Considered The Pathogen Genomics team at the Genomics Institute uses the latest sequence analysis and visualization technologies to facilitate outbreak investigation and research for public health responses. If you are excited to work in a fast-paced, startup-like environment…

Contents Serial circulating tumor DNA (ctDNA) monitoring is emerging as a non-invasive strategy to predict and monitor immune checkpoint blockade (ICB) therapeutic efficacy across cancer types. Yet, limited data exist to show the relationship between ctDNA dynamics and tumor genome and immune microenvironment in patients receiving ICB. Here, we present…

Can you analyze in GEO2R? => No, because this is RNA-seq and not microarrays. You are lucky thought that the authors seem to provide raw counts so you can easily fede them into DESeq2. Here is a code suggestion, for details please read the DESeq2 vignette extensively, it contains answers…

doi: 10.1016/j.mex.2021.101419. eCollection 2021. Affiliations Expand Affiliations 1 Department of Biology, University of Alabama at Birmingham, Birmingham, AL, USA. 2 Cystic Fibrosis Research Center, Division of Pulmonary, Allergy, and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL, USA. Free PMC article Item in Clipboard Anil K Challa et al….

Using inspiration from this thread HISAT2 output direct to bam, I’m attempting to run this command. The shell variables in this case represent paths to files/locations that make sense and in fact this command runs fine on my Ubuntu 18.04 LTS server using hisat 2.1 and samtools 1.10 (this seems…

WWith the advent of cheap gene sequencing, the world of biology is flooded with 2D data. Today, artificial intelligence is pushing the field up in three dimensions. On Thursday, Alphabet’s AI costume, DeepMind, used the precision deep learning model AlphaFold2 to capture the 3D structure of 350,000 proteins from the…

Speed Dating Experiment | Kaggle Online Data – Robert Shiller Download Dating Dataset statoc.ristoranteallacacciatora.it 25.8.2021 Download This Dataset Download This Dataset But will her inexperience lead to her downfall? And why does she keep running into his bad-tempered friend instead? Stock…

Category Research / Academic Location Wageningen You might share our view that wild plant communities might act as viral reservoirs that are also connected to agricultural plants. Since viruses can spill over from natural to agricultural systems, it is highly relevant to characterize virus diversity in wild plants. Plant virus…

NMF tools for scRNA analysis 2 New to scRNA analysis, any suggestions on the an easy to use NMF tool? Something in R or python would be great! Thanks! NMF scRNA • 638 views • link updated 2 hours ago by zdebruine ▴ 10 • written 8 months ago by…

methylation beta distribution (minfi generated) 0 Hello, I am analyzing EPIC methylation array and did necessary filtering for cross-reactive probes, common snps, excluded XY chr. ~10% of my samples cluster separately (which I am calling “outliers” for now) than the rest. Since these samples are collected from human brain with…

Ranking gene list for GOrilla gene ontology enrichment analysis 0 Hi, I did a differential expression analysis using RNA-seq data from control and gene knockdown cells. Now I have a DE gene list and I want to do a gene ontology enrichment analysis using GOrilla, but I am not sure…

How to calculate dispersion DESeq2 – Step by Step 1 @gordon-smyth Last seen 8 hours ago WEHI, Melbourne, Australia The formula you quote is for the edgeR package rather than for DESeq2. The articles you cite are for three different packages. I doubt very much that you can compute the…

GitHub – anitaokoh/Automating_kaggle_dataset_download Files Permalink Failed to load latest commit information. Type Name Latest commit message Commit time This .sh script helps to switch to root directory Install kaggle create a .kaggle directory and move the kaggle.json file to .kaggle (.kaggle must be created in the root directory) get the…

My goal is to remove the second “column”, so the 10 in the first case, the 87 in the second and the 345 in the third. This statement is confusing. On one hand, you are (OP) saying you want to remove second column and on the other hand, you are…

Tool:Cell Type Prediction – covering 45 immune cell types 0 Dear Colleagues, We just released a new tool for predicting cell types from single-cell RNA-seq data (and scRNA-seq + CITE-Seq). Currently, it covers 45 sub-types of immune cells. More subtypes are continuously being added. This tool is available in both…

The Defense POW/MIA Accounting Agency (DPAA) announced Monday that Army Sergeant Elwood M. Truslow, 20, of Batesville, Virginia, killed during the Korean War, was accounted for June 7, 2021. In late 1950, Truslow was a member of Company L, 3rd Battalion, 31st Infantry Regiment, 7th Infantry Division. He was reported…

Split Fasta file and rename output files with contig names 2 Hello! I am trying to split a large fasta file (19,336 lines) into individual contigs. The file set up is as follows: >k141_284136 flag=1 multi=3.0000 len=1875 AGCCTACATTGGCAAGGTACTGCTTTTGTCGCCCATCGTTGGCGAATTTGCTAATGAGAACACACGGAT >k141_407195 flag=1 multi=5.0000 len=1723 GCCAGTAGTTTTCAGATTTTCAATTACTTTCTTTGCTTCTTTTAACGCAGCCGCAAAGTTGTCATCAAGTTCTCCACCCTGTGCAATATGTTTATATAGAATGCTGCTTACTTTGTCAGCAA >k141_169332 flag=1 multi=3.0000 len=20 ATTATCCATCCTATTCATCGCTTGATGAAATGTTGCAAAATTCCAAAGATTTTCAGCGTCAAATCGTTCGTATATCCTAATTAAACACCGCTAAAAGTTATGTCTAAGCAATCTTTAA I am…

This article was originally published here PLoS Comput Biol. 2021 Aug 24;17(8):e1009290. doi: 10.1371/journal.pcbi.1009290. Online ahead of print. ABSTRACT Single-cell RNA-sequencing (scRNA-seq) has made it possible to profile gene expression in tissues at high resolution. An important preprocessing step prior to performing downstream analyses is to identify and remove cells…

What is the best program or way to solve undefined protein subcellular localizations? 1 Hi, I’m analyzing the subcellular localization of the proteins of a constructed pangenoma, using Cello 2.5 and PSORTB.I wanted to ask for some advice to further refine the output of each program and reach a consensus…

An Aussie cab company have announced that riders will be able to choose whether they use a driver who has had a Covid-19 vaccine. 13cabs have introduced a vaccination requirement, which means drivers can offer a “VAX” option once they are fully vaccinated. The company found they had been receiving…

MCKEE, Ky (WTVQ) – A 20-year-old McKee, Ky., soldier whose body was lost during his Berton McQueen unit’s hasty exit from a city in late 1944 during World War II has been identified. The Defense POW/MIA Accounting Agency announced Wednesday that U.S. Army Pfc. Berton J. McQueen was accounted for…

How to export count data as .csv file in Seurat 1 Hi, I’m trying to export the log normalized count data from Seurat in to a .csv file and get the following error: library (Seurat) fib.data <- subset(onlyharmonfib, subset = nFeature_RNA > 200 & nFeature_RNA < 2500 & percent.mito <5)…

Inside our cells are mitochondria, which act as their powerhouses – generating about 90 per cent of the energy required for the biochemical reactions required for them to function. This is just one of the vital biological functions of these organelles, which are unique in having their own genetic code….

Feasibility of genomic skimming on the ONT minION sequencer The term ’genomic skimming’ was first coined by in 2012 by Straub et al. (2012)20 as a way to utilize shallow sequencing of gDNA to obtain relatively deeper coverage of high-copy portions of the genome, including mitogenomes. In combining genomic skimming…

Pintuco Music – Donwload mp3, Free,Fresh and update Free Download Code with me (live): How to make your first Kaggle submission from scratch!, Free Code With Me Live How To Make Your First Kaggle Submission From Scratch streaming, created by Daniel Bourke, duration of songs : 05:45, file size :…

Python FASTA scripting 4 Hi all, I finally got that illusive Bioinformatician job and am now undergoing training. My first project is to write a FASTA parsing script that will take a FASTA file and split it into multiple files each containing a gene and its sequence. The task is…

How to calculate the AUC value for a ranger RF model ? 2 Hi Biostars community, How can I calculate the AUC value for a ranger model ? Ranger is a fast implementation of randomForest algorithm in R. I’m using the following code to build the ranger model for classification…

Output per variant and per sample heterozygosity fraction from VCF. 2 As a QC measure I would like to know the per variant and per sample heterozygosity fraction. I already used vcftools to output the missingness per variant and sample. vcftools.github.io/man_latest.html Is there any tool that can do the same…

How does MetaProdigal handle metagenomics where different genetic codes are used? 1 I’m wondering how prodigal when using -p meta can handle genes from different genetic codes? For example, if Gracilibacteria/SR1 was in there it would use genetic code 25. Would it catch this? When running in meta mode does…

Why does Cutadapt output much larger files than I am inputting? 0 I am using usegalaxy.org to work with paired end RNAseq data. I am using Cutadapt to trim adapter sequences, and the Cutadapt output files are larger than the files I am inputting. Example, my first sample SRR6467550, the…

PRSice “command not found” 0 Hi all, When running PRSice (version 2.3.3), I got the “command not found” for the commands: –perm –thread –binary-target T How to make these commands working. Best regards, Redha Command • 17 views • link updated 1 hour ago by Sam &starf; 3.7k • written…

Bioinformatics courses online? 0 Hi, Where can I find online courses or workshops (free and not-free) about bioinformatics and/or metagenomics similar to Physalia? Unfortunately, my time-zone is not good for this. Also, excluding resources like Coursera etc.. Thanks in advance bioinformatics courses • 83 views Login before adding your answer….

Which counts to use for RNA-seq heatmap and PCA? 1 Hi, I have RNA-seq data that I would like to visualise with a PCA plot and a heatmap. I am wondering whether I should use normalised or log transformed normalised counts for this. I have generated TMM-normalised counts per million…

pipeline/software/script to connect (whatshap) VCF phase blocks with Hi-C reads 0 Hi, I have a phased vcf file (generated by whatshap) of a diploid plant species. Each chromosome holds many separate phase blocks, and I want to connect these blocks/phases with Hi-C reads that I have from the same plant,…

PROJECT POLICY ANL 2 (Bioinformatics Core Project and Workshop Coordinator) Job Summary DEPARTMENT DESCRIPTION The UC Davis Genome Center is a campus-wide initiative integrating experimental and computational approaches to address key problems at the forefront of genomics. The Bioinformatics core provides expertise and infrastructure to carry out complex acquisition, curation…

best automated method (unix commandline) to get genome-assembly-accession number for given protein-accession-number (ncbi) 1 What would be the best way (if there is any) to get the accession number of a genome assembly that contains a given protein accession number? E.g. if i just have the results of a blastp…

This is a grant funded position and is not eligible for severance pay. The Jean Mayer USDA Human Nutrition Research Center on Aging (HNRCA) is one of six USDA human research centers created by Congress to study the effects of human nutrition on health. The HNRCA is the site…

RNA STAR tool in GALAXY? 1 Hello everyone, I am working on a project and I need to map my reads to a genome. I’ve been working for 3 months using diferent species’ reads in the same way and now I’ve realized that RNA STAR tool doesn’t appear anymore in…

Q2 Solutions is a leading clinical trial laboratory services organization with end-to-end laboratory services and secure, enterprise-wide biospecimen and consent management solutions. With a relentless focus on quality and innovation, Q2 Solutions uses its global experience and scientific expertise to transform science and data into actionable medical insights that help…

R cannot delete tmp file 0 Hello guys, I am using R and more precisely the library taxonomisr to analyse some data. However I have an error message when running : taxaId<-accessionToTaxa(c(“LN847353.1″,”AL079352.3″),”accessionTaxa.sql”) The error is : Warning messages: 1: In file.remove(tmp) : impossible to delete the file ‘C:UserspdoinelAppDataLocalTempRtmpMNsOgYfile87c027271e99’, because of…

Genmab is focused on the creation and development of innovative and differentiated antibody products, with the aim of improving the lives of cancer patients. The Role The successful candidate will lead the global bioinformatics function and be responsible for many aspects of data including architecture, access, classification, standards, integration, pipelines…

HiC data – How to know the restriction enzymes that were used for generating HiC datasets 1 Hello! Any tool for the downstream analysis of the HiC Sequencing data requires the restriction enzyme which was used for generating the HiC data. Is there any way to get it from the…

The role We are looking for an experienced bioinformatician to provide support for academic users of the University of Bristol Genomics facility and to teach on our Bioinformatics Masters course. What will you be doing? The role holder will be working as part of the Genomics Facility team, a core…

About the team/job We are seeking two highly motivated X-ray Imaging Research Scientists/Technical Officers to join EMBL Hamburg. EMBL Hamburg has implemented a full-field X-ray microscope on beamline P14 on the PETRA III synchrotron at DESY (Hamburg, Germany). For recent references, see: Polikarpov et al. (2019) Acta Cryst. D75:975, Geier…

Having issue running TransposonPSI 0 Hi, I have tried running the transposonPSI on our sever several times and always come back with an error message below. Is there anyone that knows how this can be resolved. Your help and contribution would be much appreciated. (base) taiwo@zetaadmin:/home/programs/repeatmasker/TransposonPSI_08222010$ sudo ./transposonPSI.pl /home/taiwo/Genome_Annotations/funannotate_E34/genome.proteins.fasta prot…

Transcriptome Analysis Console (TAC) VS Oligo package in bioconductor 0 I’m a beginner at processing microarray data. I have 114 CEL files (chip: GeneChip™ miRNA 4.0 Array). I tried the following 2 ways to get the signal values and the output is different with no consistent direction. 1.Transcriptome Analysis Console…

Can KING relatedness software be set to ignore FID? 0 Hi all, I’m using KING to determine relatedness and duplicated samples in a dataset. The FID column in my fam files has been used for batch IDs, and doesn’t refer to family relatedness at all. Will this have an impact…

Microarray data normalization 1 Dear all, Sorry for such a basic question, but I got confused. As far as I know, the RMA method implemented in affy package is a standard method for microarray data normalization. Could you let me know if the main code data.rma.norm = rma(raw.data) normalize data…

How to download the Homo_sapiens.GRCh38.100.gtf and Homo_sapiens.GRCh38.dna.primary_assembly.fa files for my analysis? 0 I am trying to perform STAR alignment and I need the reference files for indexing. I would like to know how to download the Homo_sapiens.GRCh38.100.gtf and Homo_sapiens.GRCh38.dna.primary_assembly.fa files so that I can use my following code for indexing…

Error in pipe output to samblaster from bwa-mem2 0 Hi, I am trying to upgrade my command from bwa to bwa-mem2. This command usually works. bwa mem -M -R “@RGtID:idtSM:sampletLB:lib” human_g1k_v37.fasta sample.1.fq sample.2.fq | samblaster -M –excludeDups –addMateTags –maxSplitCount 2 –minNonOverlap 20 | samtools view -S -b – > sample.bam…

Batch conversion of InterPro IDs to GO IDS for TopGO analysis 0 Hi all, I have a list of about two thousand InterPro IDs that I would like to convert to their corresponding GO IDs for subsequent enrichment analyses in TopGO. I initially used the Interpro2go batch text file to…

Previously, I have recommended two powered online tools for genomic analysis and data visualization here. I want to share with you other handy tools that I found recently. iTOL is perfect for beautifying genomic data. circos is useful for displaying the relationships between objects and positions. You could discover their…

How to access NCBI .bbs files 0 Hello, I’m trying to find genome annotation information for a genome that has been uploaded to NCBI. The only downloadable files that I can find for this genome are the Genbank file (.gbff), FASTA file (.fsa_nt), and something called ASN.1 (.bbs). Knowing that…

How to write design and contrast in DESeq2 to find the up-regulated genes where the design have interactions 0 Hello I have the following design in DESeq2: ~GT+TP+TP:GT . GT has two levels (K,W) . TP has two levels (0,2). I am looking for the genes that are up-regulated in…

WGCNA (TRAIT DATA) 0 I had already obtained a group of significant proteins after performing analysis on data obtained from LC-MS. I would like to perform network analysis on selected proteins using WGCNA package in R. Network analysis using WGCNA:- Removed outlier samples and Genes. Identified softpower (Beta) for singed…

featureCounts: unable to find chromosome in SAM header 0 I am using featureCounts to try and create a count table for some RNA-Seq data I collected using an Oxford Nanopore platform. I have .sam files aligned with minimap2, and am running the following command to try to get a count…

Seqio.Parse Some Error 2 I am a beginner in bioinformatics world. I am following exercise on biopython but i am stuck here. I am not sure why print command is not working. Please let me know to correct this step. > from Bio import SeqIO > for seq_record in SeqIO.parse(“…

U.S. Equal Opportunity Employment Information (Completion is voluntary) Individuals seeking employment at Invitae are considered without regards to race, color, religion, national origin, age, sex, marital status, ancestry, physical or mental disability, veteran status, gender identity, or sexual orientation. You are being given the opportunity to provide the following information…

If a disability prevents you from applying for a job through this website, click here. No other requests will be acknowledged. MSK is an equal opportunity and affirmative action employer committed to diversity and inclusion in all aspects of recruiting and employment. All qualified individuals are encouraged to apply and…

The Opportunity Asuragen, a Bio-Techne brand, is a global molecular diagnostics product and solutions company, and we use our unique combination of proprietary chemistry and bioinformatics to develop products that address unmet needs for both clinical research and diagnostic laboratories. Our product portfolio is comprised of reagent kits and software…

cellranger-dna: Your reference doesn’t appear to be indexed. Please run the mkref tool. 1 I received the following error when running cellranger-dna: “Your reference doesn’t appear to be indexed. Please run the mkref tool”. The reference that I used was downloaded from 10X database. I thought the reference was already…

install GenomicFeatures fail 1 @5b9023e7 Last seen 19 hours ago China BiocManager::install(‘GenomicFeatures’) results show ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: mirrors.tuna.tsinghua.edu.cn/CRAN/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.0 (2021-05-18) Installing package(s) ‘GenomicFeatures’ also installing the dependencies ‘Rhtslib’, ‘Rsamtools’, ‘GenomicAlignments’, ‘rtracklayer’ Packages which are only…

DOI: 10.18129/B9.bioc.scRNAseq     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: 3.11 Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso…

 About browsing: master Branches RELEASE_3_13 master Files Commits Stats Network Graph hca Clone ZIP TAR × SSH HTTPS Name Mode Size R 040000 man 040000 tests 040000 vignettes 040000 .Rbuildignore 100644 0 kb .gitignore 100644 1 kb DESCRIPTION 100644 1 kb LICENSE 100644 0 kb LICENSE.md 100644 1 kb NAMESPACE…

Unbeknownst to them, at DeepMind, an extensive scientific paper detailing their system was already under review at Nature, according to John Jumper, who leads the AlphaFold project. DeepMind had submitted their manuscript to Nature on May 11. At that point, the scientific community knew little about DeepMind’s timeline. That changed…

Most proteins self-assemble into specific 3D structures that, together with other biological molecules, determine the function and behaviour of cells. Over the past five decades, biologists have experimentally determined the structures of more than 180,000 proteins and deposited them in the Protein Data Bank1, a freely available online resource. Despite…

By Kalli Spencer The main goal of focal therapy is the targeted focal destruction of cancer tissue with the preservation of surrounding healthy prostate tissue. There have been conflicting opinions on the definition, but it seems the consensus is “ablation of the dominant or index lesion”1. The principle of targeted…

Abstract Genomics researchers do better work when they can interactively explore and visualize data. However, due to the vast size of experimental datasets, researchers are increasingly using powerful, cloud-based systems to process and analyze data. These remote systems, called science gateways, offer user-friendly, Web-based access to high performance computing and…

The Gracz lab is hiring a bioinformatics analyst to join our group in the Division of Digestive Diseases at Emory University. We are interested in understanding the genetic regulation of stem and progenitor cells in the intestine and liver. Our lab works at the intersection of cell biology and genomics…

GWASpower calculation 0 Dear All, Sorry , sounds like a stupid question but been struggling with this for a while. I am trying to do post-hoc power calculation for my GWAS using GWASpower software for quantitative trait (i know many don’t prefer post-hoc power calculation, but reviewer asked me despite…

I hope any of this is of use to you: www.ncbi.nlm.nih.gov/snp/rs121434448?horizontal_tab=true#frequency_tab There is only one publication associated with this area and it is linked on that site – but here is the full version: academic.oup.com/hmg/article/7/11/1671/2355991 & CORRECTION: academic.oup.com/hmg/article/7/12/1987/581729 It’s rather unfortunate that there have been no more recent studies into…

Louis Vuitton has teamed up with Maison TAMBOITE, an artisanal, Paris-based bike-maker, to craft a selection of fashion-punched two-wheelers. Under the moniker “Louis Vuitton Bike,” the collaboration sees a blending of both Maisons’ penchant for leather craftsmanship and woodwork across two new models: the “Closed Frame” and the “Step-Through.” The…

Mitochondria.Credits: Wikipedia Commons One of the first population-scale studies on how common genetic traits are affected by changes in mitochondrial DNA, the driving force of human cells, was the European Molecular Biology Laboratory at the Wellcome Trust Sanger Institute, University of Cambridge, EMBL. Tokoro (EMBL-EBI) and its collaborators. The team…