Open Source Biology & Genetics Interest Group

September 17, 2021 1 min read ADD TOPIC TO EMAIL ALERTS Receive an email when new articles are posted on Please provide your email address to receive an email when new articles are posted on . “ data-action=”subscribe”> Subscribe We were unable to process…

Alternative to samtools quickcheck with bash scripting 1 Is there an alternative to samtools quickcheck? I need to perform a check some bam files in order to verify that they’re not truncated. Nevertheless, I can’t use samtools since in the linux machine where I have the data I can’t install…

gnomAD v3 link not working for download 1 your URL is wrong. $ wget -q -O – “https://storage.googleapis.com/gcp-public-data–gnomad/release/3.1.1/vcf/genomes/gnomad.genomes.v3.1.1.sites.chr1.vcf.bgz” | gunzip -c | head ##fileformat=VCFv4.2 ##hailversion=0.2.64-1ef70187dc78 ##FILTER=<ID=AC0,Description=”Allele count is zero after filtering out low-confidence genotypes (GQ < 20; DP < 10; and AB < 0.2 for het calls)”> ##FILTER=<ID=AS_VQSR,Description=”Failed VQSR filtering…

You can verify the problem is with Gradle scripts by running gradle help which executes configuration scripts but no Gradle tasks. If the error persists build. More examples on the classpath customization are available here. Tasks view and task execution. In the Eclipse IDE you can execute tasks from the…

difference between treat_pileup and bdgcmp fold enrichment tracks macs2 0 Hello, I created bigwig file from a treat_pileup.bdg file generated by macs2 and also used treat_pileup.bdg and control_lambda.bdg with macs2 bdgcmp. Here is my codes; macs2 callpeak -t sample.bam -c sample_input.bam -g hs -f BAM -q 0.001 –bdg –outdir /folder…

KEGG COMPOUND: C04020     COMPOUND: C04020 Help Entry C04020                      Compound                                Name D-Lysopine;N2-(D-1-Carboxyethyl)-L-lysine;Lysopine Formula C9H18N2O4 Exact mass 218.1267 Mol weight 218.2502 Structure Mol fileKCF fileDB search Reaction Pathway Enzyme Other DBs KCF data Show ATOM        15            1   N1a N    25.5724  -27.5100            2   C1b C    26.7849  -28.2100            3   C1b C    27.9973  -27.5100            4   C1b C    29.2097  -28.2100            5   C1b C    30.4222  -27.5100            6   C1c C    31.6346  -28.2100            7   C6a C    32.8470  -27.5100            8   O6a O    34.0595  -28.2100            9   O6a O    32.8470  -26.1101            10  N1b N    31.6346  -30.1700            11  C1c C    30.4262  -30.8677            12  C6a C    29.2327  -30.1784            13  O6a O    28.0444  -30.8645            14  C1a C    30.4261  -32.2698            15  O6a O    29.2803  -29.0584BOND        14            1     1   2 1            2     2   3 1            3     3   4…

Courtesy Intellia Therapeutics Intellia Therapeutics is celebrating another first today as the U.S. Food and Drug Administration (FDA) has accepted the Investigational New Drug (IND) application for NTLA-5001, its first wholly-owned ex vivo CRISPR genome editing candidate. NTLA-5001 is being developed for the treatment of acute myeloid leukemia (AML). Intellia…

About Us Starting out as a YouTube channel making Minecraft Adventure Maps, Hypixel is now one of the largest and highest quality Minecraft Server Networks in the world, featuring original games such as The Walls, Mega Walls, Blitz Survival Games, and many more! Hypixel Store The administration works very hard…

Fruit and berry crops, as well as grapes, are important parts of the human diet and, at the same time, significant objects of genetic, breeding, biochemical and nutritional research. Traditional approaches to crop research and improvement are now complemented by effective modern genetic technologies. In this review, the research team…

THE MOST BELOVED BIRD IN HISTORY may very well have been a 29-year-old pigeon by the name of Martha. It was the early 1900s, shortly before the United States entered the First World War, and Martha was at the height of her fame. Perched on her humble roost at the Cincinnati…

About Thermo Fisher Scientific Thermo Fisher Scientific Inc. (NYSE: TMO) is the world leader in serving science, with annual revenue of approximately $35 billion. Our Mission is to enable our customers to make the world healthier, cleaner and safer. Whether our customers are accelerating life sciences research, solving complex analytical…

A CRISPR-Cas9 gene editing technology that has shown promise in clearing HIV from mice is headed into human testing. Excision BioTherapeutics will usher the CRISPR-based therapy EBT-101 into clinical trials after the FDA cleared an investigational new drug application, according to the company’s press release. EBT-101 is under development as…

Time this week released its “100 Most Influential People” list, which includes a number of individuals who have made major contributions to health care. The 10 ‘most influential’ health care companies, according to TIME The list This year, TIME recognized several health care providers, scientists, public health officials, and advocates for their…

Convert UCSC isoform ID to Ensembl transcript ID 2 Hello everyone, I have a few UCSC isoform IDs and I would like to convert them to the corresponding Ensembl transcript IDs. I have tried to use some online conversion tools (such as DAVID), looked up the UCSC annotation files, but…

Computational Biology Jobs Full and part time jobs with good salary Computational Biology Jobs. Start your new career with us today! Indeed may be compensated by these employers. BioInformatics Postdoctoral Associate Job Position @ Miami … (Christina Poole) We have had researchers with backgrounds in biology, physics, statistics, math, and…

Students Aarthi Vijayakumar, Rebecca Li, Michelle Sung and David Li won the competition in 2018, and their project became the Genes in Space-6 experiment. The student team’s investigation made history. For the first time in space, NASA astronauts successfully edited DNA using CRISPR/Cas9 technology while working on the Genes in…

About Us… Obsidian Therapeutics is pioneering engineered cell and gene therapies to deliver transformative outcomes for patients. Obsidian’s programs apply our CytoDriveTM technology in Cell and Gene therapy products to control expression of proteins for enhanced therapeutic efficacy and safety. We’re proud of our diverse talented team and committed to…

One of the most revolutionary discoveries of the century, the CRISPR gene-editing system is built on a bacterial defense mechanism that allows scientists to make precise edits to DNA. Now scientists at MIT have discovered a new class of enzymes called OMEGAs that perform a similar function – and perhaps…

Othram, The Woodlands, TX-based developer of technology for investigators to crack unsolved law enforcement cases through advanced genomics, raised $18m in Series B funding. The round was led by Gigafund. In conjunction with the funding, Stephen Oskoui, Managing Partner of Gigafund, will…

NEW YORK – An ancient DNA analysis reaching back thousands of years has provided a more detailed view of the ancestral groups contributing to present-day populations in Japan, uncovering genetic signals from three historical populations spanning pre- and post-agricultural periods. “[O]ur study provides a detailed look into the changing genomic…

How to Create Loop for all fastq file 0 Dear All, hope you are doing well. I am trying to write a loop for my all fastq and doing preprocessing using bash. I am taking an error, Can you help me to write bash loops? for file in *.fastq; do…

Newswise — The cold polar oceans give rise to some of the largest food webs on Earth. And at their base are microscopic, photosynthetic algae. But human-induced climate change, a new study suggests, is displacing these important cold-water communities of algae with warm-adapted ones, a trend that threatens to destabilize…

The problem with exploring space is that it takes too long to travel and send information to Earth. Data technology is the solution as it develops hardware, software, and strategies to make transmissions faster, easier, and more robust. Here’s what experts have accomplished so far in connecting data technology with…

As Vice President of Product Management at Qumulo, Ben oversees innovation and builds products that radically simplify file data management. getty When we think of a factory, we imagine smokestacks and machinery. But some of the most innovative production today isn’t happening in a factory warehouse: It’s happening digitally. The “digital…

Small countries often like to boast of having been the first to do something special, and the three Caucasus nations are no exception: For Georgia, it’s viniculture; Armenia – adopting Christianity; Azerbaijan was the first secular Muslim republic. So here’s something new for them to claim collectively: Scientists now say…

Introduction Antimicrobial resistance is a global issue associated with an increased and often unrestricted antibiotic use in clinical settings, which leads to the dissemination of carbapenem-resistant Enterobacterales (CRE) in healthcare facilities (World Health Organization, 2017).1 CRE constitutes a large group of bacteria with different mechanisms for drug resistance. Among them,…

Somewhere in India last October, a person—likely immunocompromised, perhaps taking drugs for rheumatoid arthritis or with an advanced case of HIV/AIDS—developed COVID-19. Their case might have been mild, but because of their body’s inability to clear the coronavirus it lingered and multiplied. As the virus replicated and moved from one…

According to the GRAS determination​​ (submitted in April and currently pending with the FDA), the myoglobin preparation – supplied as a frozen liquid – is intended for use at inclusion rates of ≤2%, to “mimic flavors associated with cooked ground meat​” in fresh or frozen plant-based burgers, patties, sausages, and other…

September 17, 2021 2 min read Source/Disclosures Published by: Disclosures: The authors report no relevant financial disclosures. ADD TOPIC TO EMAIL ALERTS Receive an email when new articles are posted on Please provide your email address to receive an email…

Extract root(start) and leaf(end) states programmatically in monocle2 0 Dear bioinformaticians, do you know how to extract starting state and end states from the CDS in monocle2 ? I know I can detect them visually inspecting the States plot after I compute the pseudotime. I am asking if there is…

An interdisciplinary team of researchers from Japan and Ireland have discovered that modern day populations in Japan have a tripartite genetic origin, rather dual genomic ancestry as previously thought. The study is published in Science Advances. The history of Japan Archaeological data suggests that humans have occupied the Japanese archipelago…

Hey guys, The topic is Hate Speech Detection and I’m using this Kaggle competition: kaggle.com/c/detecting-insults-in-social-commentary I’m also trying to solve this task in a python notebook (.ipynb) using the FARM framework farm.deepset.ai/ and BERT model of huggingface huggingface.co/bert-base-uncased From what I’m understanding is that there are 3 relevant datasets for…

Double-stranded DNA fragment. Credits: Vcpmartin / Wikimedia / CC BY-SA 4.0 Everyone seems to have a completely unique immune system. Researchers at Utrecht University discovered this immune diversity after mapping antibodies from healthy and sick people. This finding may help explain, for example, why the corona vaccine appears to be…

This was a summer of unprecedented heat and runaway algae. At hundreds of beaches, lakes, and rivers across the US, the public was greeted by signs like this one at Hensley Lake in northern California: “Harmful algae may be present in this water.” Although blue-green algae, known as cyanobacteria, occur…

plotting roh from bcftools 0 Heys, I am following this small tutorial on how to calculate ROHs from a vcf file using bcftools (samtools.github.io/bcftools/howtos/roh-calling.html) and I am getting this txt file: # This file was produced by: bcftools roh(1.10.2+htslib-1.10.2-3) # The command line was: bcftools roh -G30 –AF-dflt 0.4 my_file.vcf…

Creating Heatmaps Of Diffrentially Expressed Genes In Angilent Single-Color Array Analysis 0 I am using limma to analyze Agilent’s single color arrays to find differentially expressed genes, using the following procedure. targets <- limma::readTargets(“targets.txt”) project <- limma::read.maimages(targets,source=”agilent”, green.only=TRUE) project.bgc <- backgroundCorrect(project, method=”normexp”, offset=50) project.NormData <-normalizeBetweenArrays(project.bgc,method=”quantile”) design <- paste(targets$Target, sep=””) design…

Hi all, I have recently tried to estimate runs of homozygosity (ROH) from my vcf file by using plink 1.9. I ran following code to generate binary files that plink required: plink –vcf myfile.vcf –make-bed –out out_name –no-sex –no-parents –no-fid –no-pheno –allow-extra-chr This vcf file only contains one individual and…

Quast Ouput 0 Hi, I have done a assembly statistics of a transcriptome assembly. I have found 102072 headers (“>”) and for that simply i thought that my assmbly has 102072 transcripts and i also considered one transcript as one contig. But when i run the quast i found in…

Tool:Genozip: A new compression tool for FASTQ, BAM, VCF and more 0 Genozip is a new(ish) compression software for compressing genomic files. It usually compresses x2-x5 times better than standard compression (eg .gz), and it works on all common genomic file formats. I am its developer. It is a lot…

How to add metadata to dendrogram of hierarchical clustering in R 0 I have a RNAseq dataset with genes as rows and samples as columns. I have managed to do hierarchical clustering of the samples, and I want to look for subgroups in the disease. I additionally have metadata with…

(ERR): bowtie2-align died with signal 24 (XCPU) (core dumped) 0 Hi all, it is my first time using bowtie2, and I have a problem. I conducted the following command for reads mapping: bowtie2 -q –local -x mm10 -U SRR5839956_trimmed.fq -S SRR5839956.sam It created a 600MB sam file then come with…

Interpreting output of BCFtools RoH 0 Hello! I am using BCFtools RoH for the first time, and I am having some trouble understanding its output file. The input is a gvcf file with genotype calls for one sample only, and I want to infer where there might be autozygous tracts….

get read length from sra 0 hi everyone ! i need a method “api” to retrive reads length form sra thanks in advance rna api seq • 44 views • link updated 38 minutes ago by Renesh &starf; 2.0k • written 2 hours ago by Sar • 0 Login before…

Database for Enhancers with Coordinates 4 Can anyone recommend some good databases for extracting bed files with enhancer coordinates. I have used UCSC in the past, I was hoping to find some alternatives ChIP-Seq genome • 163 views • link updated 11 minutes ago by Papyrus &starf; 1.3k • written…

ABOUT affymetrix genotyping console (GTC) software and TCGA CNV workflow 0 The TCGA CNV workflow uses Birdsuite to estimate raw copy number (CN). The affymetrix genotyping console (GTC) use similar algorithm developed by broad. Is GTC used to estimate raw CN, too? Otherwise, could GTC output files that could be…

Filtration of paired reads with both length higher than 50 from bam file 1 I understand that for filtering reads based on length i can simply use: samtools view -h file.bam | awk ‘length($10) > 50 || $1 ~ /^@/’ | samtools view -bS – > output.bam But how can…

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Gene coordinates for hg19 0 Hi, is there a list which gives for each gene its starting coordinate (chr:pos) and its ending one with respect to the hg19 reference genome? I have a list of positions on hg19 expressed as chr:pos and I have to assign each one to the…

Obtaining The Snp Rs Number With The Chromosomal Position 3 This question is similar to this one (Get rs number based on position). I have a text file with SNPs in the chr:position format 10:71086 10:72876 10:75794 I was wondering if there is an R package (or perhaps one in…

This repo gathers all the input files and scripts related to our study entitled “Exploiting genomic surveillance to map the spatio-temporal dispersal of SARS-CoV-2 spike mutations in Belgium across 2020” (Bollen et al. submitted): R scripts to prepare, analyse, and visualise the phylogeographic analyses performed in this study, Geographic Information…

How to merge many huge gVCFs with high speed. 3 Hello, In order to perform population gnomic analysis, I am trying to merge many and huge variants data (gVCF), such as several dozens Gb, over 20 files. Bcftools merge and vcf-merge were used so far but very slow to merge…

The global distribution of genes from a single peanut variety has had a profound legacy on our food systems—providing immeasurable food security, and spreading its pest- and disease-resistant traits around the world. These are the findings of a recent study, which traced the genetic contributions made by the species in…

Life is the most complex system known to humankind. Bioinformatics driven data analyses is a unique approach to study life in all its complexity, ranging from molecules to ecosystems. At Utrecht Life Sciences, internationally leading bioinformatic educators and researchers connect to address the complexity of life in different biological and…

Omics data collection and merging of datasets from different studies 0 Hi! I’m going to do omics analysis on skin basal cell carcinoma. I’m currently trying to find publicly available data to use to make a data collection. I have looked after RNA-seq(high throughput) in GEO and found some studies…

snpEff: annottation problem 0 Hi everyone. I am using snpEff on my personal computer, and when I try to annotate a VCF file I get this error: [[0Kjava.lang.OutOfMemoryError: Java heap space[[0KM at java.util.Arrays.copyOfRange(Unknown Source)[[0KM at java.lang.String.<init>(Unknown Source)[[0KM at java.lang.StringBuilder.toString(Unknown Source)[[0KM at java.io.BufferedReader.readLine(Unknown Source)[[0KM at java.io.BufferedReader.readLine(Unknown Source)[[0KM at org.snpeff.fileIterator.LineFileIterator.readNext(LineFileIterator.java:46)[[0KM [[0K at…

I am a recent graduate of a neuroscience master’s degree looking to branch out into a more bioinformatics based future career. My main problem is that most jobs/PhDs with a bioinformatics focus will already expect experience in bioinformatics as a prerequisite, whilst I do have some experience of analyzing RNA-seq…

EMAIL* UPLOAD YOUR RESUME By clicking Agree, I consent to our data usage policies as stated here By agreeing to submit your resume, you consent (in accordance with our Terms of Use and Privacy Policy) to: A) Salary.com storing your resume for purposes of providing you with the job posting…

An illustrated recreation of a woolly mammoth, on display at the Royal Victoria Museum, British Columbia. Credit: Thomas Quine/Flickr, CC BY 2.0 Like Sergey Zimov’s ‘Pleistocene Park’, George Church’s company Colossal plans to repopulate the Arctic tundra with woolly mammoths. Church, a genetic engineering expert, plans to splice mammoth genes…

    This package is for version 2.9 of Bioconductor; for the stable, up-to-date release version, see ecolitk. Meta-data and tools for E. coli Bioconductor version: 2.9 Meta-data and tools to work with E. coli. The tools are mostly plotting functions to work with circular genomes. They can used with…

We are currently looking for a Bioinformatics Scientist to join a leading biotech company based in the Cambridge area. As the Bioinformatics Scientist you will drive the development of computational tools and perform omics data analysis to support target identification and therapeutics development platforms KEY DUTIES AND RESPONSIBILITIES: Your duties…

Latest version of com.github.samtools:htsjdk javadoc.io/doc/com.github.samtools/htsjdk Current version 2.2.4 javadoc.io/doc/com.github.samtools/htsjdk/2.2.4 package-list path (used for javadoc generation -link option) javadoc.io/doc/com.github.samtools/htsjdk/2.2.4/package-list Read more here: Source link

Is there any software that can use ATAC-seq to identify super enhancer 1 Hello Everyone! Has anyone tried to identify super-enhancers by using ATAC-seq? I am wondering whether some one can recommend some software 🙂 Thanks a lot in advance for your comments and ideas! Best wishes Guandong Shang ATAC-seq…

Researchers at The University of Auckland have stated that a major genetic trigger for type 1 diabetes — which leaves a person unable to produce enough insulin to keep their blood sugar in a normal range — may act in the lung, suggesting that lung infections could trigger the onset…

Procambarus fallax collections and PCR genotyping Animals were collected from various wild populations (Table S1) in compliance with state and local regulations (Georgia department of natural resources scientific collection permit 115621108, state of Florida collection permits S-19-10 and S-20-04). DNA was isolated from abdominal muscle tissue using SDS-based extraction and precipitation…

1. Dudas, G. et al. Virus genomes reveal factors that spread and sustained the Ebola epidemic. Nature 544, 309–315 (2017). ADS  CAS  Article  Google Scholar  2. Kafetzopoulou, L. E. et al. Metagenomic sequencing at the epicenter of the Nigeria 2018 Lassa fever outbreak. Science 363, 74–77 (2019). ADS  CAS  Article …

Advanced Duplicator 2 is a Garry’s Mod addon which implements a tool similar to the Duplicator, but with many added features. Yeah no problem mate, thanks for the response. I’m done with gmod and I don’t take requests, so please stop spamming the comment section. “Originally published in single magazine…

IskillsSolutions HR Nandhini 7358407557(whatsapp) info@iskillssolutions.com Job Description: Position: Medical Coder. Medical Coding is the process of converting Verbal Descriptions into numeric or alpha numeric by using ICD 10-CM, CPT && HCPCS . Eligibility: All (UG/PG) Life Science& Paramedical Graduates Bsc Msc Dip Medical Lab Tech Nursing GNM/DGNM Biomedical Biochemistry Biotechnology…

Flat Volcano plot 0 Hello everyone I have performed differential expression analysis on human dataset (GPL14550 Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version)). I have 12 samples of Th1 and Th2 sample type. At the end I visualized the top genes using volcano plot and it came…

Mitochondrial diseases are a major genetic disease. The prevalence rate among newborns in the United States is about 1 in 5000. China currently lacks complete epidemiological data on mitochondrial diseases. At present, nearly 300 genes that cause mitochondrial diseases are known, including both mitochondrial DNA (mtDNA) coding and nuclear DNA…

Bioinformatics Engineer – London Paramount is working closely with a client who is now moving towards a future of enabling faster, deeper genomic research, bringing genomic healthcare to all who need it. They are now urgently looking for a Bioinformatics Engineer to join their team in London. As a Bioinformatics…

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

AlphaFold This package provides an implementation of the inference pipeline of AlphaFold v2.0. This is a completely new model that was entered in CASP14 and published in Nature. For simplicity, we refer to this model as AlphaFold throughout the rest of this document. Any publication that discloses findings arising from…

is one of the nation’s top-ranked medical schools. For 175 years, NYU Grossman School of Medicine has trained thousands of physicians and scientists who have helped to shape the course of medical history and enrich the lives of countless people. An integral part of , the Grossman School of Medicine…

These files contain the source data and code used for the analyses included in the publication Robichaux et al 2021, “Structure-based classification predicts drug response in EGFR mutant NSCLC” These files will be made public at the time of acceptance.The files include but are not limited to: Summary of EGFR…

I have written a rule for CombineGVCFs in gatk4. The rule is as follow all_gvcf = get_all_gvcf_list() rule cohort: input: all_gvcf_list = all_gvcf, ref=”/data/refgenome/hg38.fa”, interval_list = prefix+”/bedfiles/hg38.interval_list”, params: extra = “–variant”, output: prefix+”/vcf/cohort.g.vcf”, shell: “gatk CombineGVCFs -R {input.ref} {params.extra} {input.all_gvcf_list} -O {output} –tmp-dir=/data/tmp -L {input.interval_list}” all_gvcf is the dataset for…

gene comparative 0 Hi,Everyone.I am a new guy in bioimformatics.My supervisor gave me a topic “Comparative analysis of functional gene alleles”. But I don’t know what specific work should do. Please give me some advice .Thanks! alleles gene comparative • 10 views • link 2 hours ago by Xh •…

We are looking for bioinformatics help to analyze specific data sets available from GEO / NCBI using standard bioinformatics analysis pipeline We will provide the study, design and data We will ask you to create a standard bioanalytical report that will include :– Differential gene expression, clustering – Pathway enrichment/analysis–…

EMAIL* UPLOAD YOUR RESUME By clicking Agree, I consent to our data usage policies as stated here By agreeing to submit your resume, you consent (in accordance with our Terms of Use and Privacy Policy) to: A) Salary.com storing your resume for purposes of providing you with the job posting…

EPFL, the Swiss Federal Institute of Technology in Lausanne, is one of the most dynamic university campuses in Europe and ranks among the top 20 universities worldwide. The EPFL employs more than 6,000 people supporting the three main missions of the institutions: education, research and innovation. The EPFL campus offers…

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see odseq. Outlier detection in multiple sequence alignments Bioconductor version: 3.4 Performs outlier detection of sequences in a multiple sequence alignment using bootstrap of predefined distance metrics. Outlier sequences can make downstream analyses unreliable…

Illumina’s Customer Collaboration & Innovation (CCI) team transforms the relationship between top-tier customers and our Product Development organization, and we are looking for a select individual to join the team as a Bioinformatics Software Engineer 2.  The team works externally with a small number of Illumina’s top customers to design…

Electroporation-mediated transcatheter arterial chemoembolization in the rabbit VX2 liver tumor model – Fingerprint — University of Texas Southwestern Medical Center Sort by Weight Alphabetically Medicine & Life Sciences Electroporation 100% Rabbits 59% Liver 43% Neoplasms 26% Cisplatin 20% Magnetic Resonance Imaging 15% Mass Spectrometry 13% Catheters 11% Cell Membrane Permeability…

##Genome-Annotation-Data-START## Annotation Provider::NCBI RefSeq Annotation Date::01/12/2021 08:24:12 Annotation Pipeline::NCBI Prokaryotic Genome Annotation Pipeline (PGAP) Annotation Method::Best-placed reference protein set; GeneMarkS-2+ Annotation Software revision::5.0 Features Annotated::Gene; CDS; rRNA; tRNA; ncRNA; repeat_region Genes (total)::5,192 CDSs (total)::5,077 Genes (coding)::4,870 CDSs (with protein)::4,870 Genes (RNA)::115 rRNAs::9, 8, 8 (5S, 16S, 23S) complete rRNAs::9, 8,…

Database of mouse ligand receptors 3 Hi All, I was wondering if there is a website or a database where you can download a list of mouse genes that are ligand receptors in a tab-delimited format. Thanks AB ligand-receptor database mm9 • 2.0k views • link updated 2 hours ago…

# # Open AlphaFold database models for proteins larger than 1400 amino acids. # These calculated in 1400 amino acid segments every 200 amino acids due to # limitations (GPU memory) of the AlphaFold software. We load and align # the segment models. This produces many clashes. # # Opening…

FGR Bogoso Prestea Limited progresses to finals of Inter-Mines First Aid and Safety competition FGRBPL, operators of the Bogoso Prestea Mines (BPM), emerged as joint winners of the Inter-Mines Zonal First Aid Competition with industry “rivals,” Anglogold Iduapriem Mine. The other competitors in a tough contest, were Gold Fields –…

Job Description Farmington, Connecticut Apply Summary The Robinson lab is seeking a Bioinformaticician to join our team that focuses on the development of software and ontologies for biomedical research. Our team of expert biological curators, bioinformaticians, and computer scientists maintain and enhance a knowledge extraction and refinement process that delivers…

Details A remote healthcare data scientist works for designing programs and software that are helpful in the analysis of healthcare information, and medical records. Remote healthcare data science jobs allow workers to execute their exterior to conventional office settings. Instead of computing and analysis on the office and hospital desks,…

Visulization of raw 4C-seq reads in UCSC 1 I’m trying to create bedGraph files to view raw and normalised reads from a 4C-seq experiment to view in UCSC for two biological replicates. Is there a simple way to do this? I’ve tried using bamCoverage and expected to get peaks for…

Aging gracefully is an art that involves maintaining good health—but, as we age, our bodies become more vulnerable and will need extra attention. In the case of postmenopausal women, reduced estrogen makes it more likely that they will experience oxidative stress, which is an indication of the imbalance between the…

How to download BED file with all the fields? 2 Hello, my goal : to download a certain BED file from ucsc website that contains all these fields: bin chrom chromStart chromEnd name score strand signalValue pValue qValue peak I will describe my actions and my problem: – I go…

how to to download a BED file from ucsc to directory using linux 2 Hello, my goal : to download a BED file as desribed here to my directory using linux commands . in the meantine, I am trying to download the wanted file directly in the following way: my…

Why some SNP’s are not assigned to any gene? 0 Hi everyone, I am doing polygenic risk analysis (PRS) ; As you may know PRS is done based on SNP’s. On the other hand, I would like to do some visualizations at gene level. Thus, I used rsnps library (ncbi_snp_query…

3D-Beacons Network acts as a one-stop shop for protein structures by combining and standardising data from several providers Cryo-EM structure of the BRCA1-UbcH5c/BARD1 E3-E2 module bound to a nucleosome. Image obtained from PDBe A new platform called 3D-Beacons Network brings together experimentally determined and predicted protein structure models and related…

Thing I want to do – Simulated Annealing of a Polymer Methodology I am following – Create a Polymer chain of desired length. Use PACKMOL to pack desired number of chains in a conveniently huge box. Using LAMMPS follow the general equilibration protocol, NVE, NVT, NPT dynamics. Shrink the box…

Detail Information about inmate Gengis Roman – Public Records Gengis Roman commited felony under Federal Jurisdiction USA and is hold captive in facility NY DOC – Upstate Correctional Facility for the crimes commited by the person. Current location of the inmate is Malone, New York, and can be visited during…

Most of us have credit cards, but there are still some people that do not. Skin lesion detection and classification is always observed as a difficult problem to solve. Got it. We then applied dropout again to further prevent overfitting. This problem is important as it will potentially save a…

I want to import a public dataset from Kaggle (www.kaggle.com/unsdsn/world-happiness?select=2017.csv) into a local jupyter notebook. I don’t want to use any credencials in the process. I saw diverse solutions including: pd.read_html, pd.read_csv, pd.read_table (pd = pandas). I also found the solutions that imply a login. The first set of solutions…

Search within r/cscareerquestions r/cscareerquestions Read more here: Source link

Groups are a dead end, since there is no way to restrict or differentiate pairwise interactions by groups. Thus I think the only way that you can currently realize such a model would be to have different atom types for each molecule and then use the hybrid pair style. So…