Tag: addgene

Cellular glycan modification by B3GAT1 broadly restricts influenza virus infection

Ethics statement All procedures involving laboratory mice were approved by the Duke University IACUC under the protocol numbers A189-18-08 and A142-21-07. Mice were housed with up to five mice per cage and the ambient room conditions ranged from 70–74 °F and 30–70% humidity with a 12-hour dark/light cycle. Animals were assessed…

Continue Reading Cellular glycan modification by B3GAT1 broadly restricts influenza virus infection

Evasion of cGAS and TRIM5 defines pandemic HIV

Cells and reagents HEK293T and U87 cells were maintained in DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Labtech) and 100 U ml−1 penicillin plus 100 μg ml−1 streptomycin (Pen/Strep; Gibco). THP-1-IFIT1 cells that had been modified to express Gaussia luciferase under the control of the IFIT1 promoter were described previously62. THP-1…

Continue Reading Evasion of cGAS and TRIM5 defines pandemic HIV

Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine

Animals and immunizations The study protocol and all veterinarian procedures were approved by the Bioqual IACUC per a memorandum of understanding with the Duke IACUC, and were performed based on standard operating procedures. Macaques studied were housed and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited…

Continue Reading Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine

Addgene: pLKO5-SgHottip-GFP-CRISPRa

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications. For your Materials & Methods section: pLKO5-SgHottip-GFP-CRISPRa was a gift from Suming Huang (Addgene plasmid # 134990…

Continue Reading Addgene: pLKO5-SgHottip-GFP-CRISPRa

The Global CRISPR Market Evaluated to Surge at $4521.76 Million

CRISPR Market A recent study by Triton Market Research titled ‘Global CRISPR Market’ includes the Global Analysis and Forecasts by Industry Verticals (Therapeutics and Drug Discovery, Biological Research, Agricultural Biotech, Industrial Biotech), Application (Genome Editing/Genetic Engineering, Cell Line Engineering, CRISPR Plasmid, Human Stem Cells, gRNA Database/Gene Library), Product (Designing Tools,…

Continue Reading The Global CRISPR Market Evaluated to Surge at $4521.76 Million

Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals

Screening of efficient mCherry-binding protein (MBP) pairs to design Cre recombinase dependent on RFPs First, we aimed to construct Cre recombinase dependent on RFPs based on the reported tool named Cre-DOG30. In this system, N-terminal and C-terminal split Cre recombinase fragments are fused with specific nanobodies for target proteins, and…

Continue Reading Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals

Live-seq enables temporal transcriptomic recording of single cells

Biological materials RAW264.7, 293T and HeLa cells were obtained from ATCC. RAW264.7 cells with Tnf-mCherry reporter and relA-GFP fusion protein (RAW-G9 clone) were kindly provided by I.D.C. Fraser (National Institutes of Health). The IBA cell line derived from the stromal vascular fraction of interscapular brown adipose tissue of young male…

Continue Reading Live-seq enables temporal transcriptomic recording of single cells

Proscillaridin A induces mitochondrial damage and autophagy in pancreatic cancer and reduces the stability of SMAD4 in Panc-1 cells – Hou

Introduction Pancreatic cancer (PC) is one of the most aggressive and lethal cancers (1). Previous studies have shown that aging, environmental and behavioral changes are more closely related to the dramatic increase in the incidence of PC worldwide than genetic factors (2–5). A position paper published by the European Federation…

Continue Reading Proscillaridin A induces mitochondrial damage and autophagy in pancreatic cancer and reduces the stability of SMAD4 in Panc-1 cells – Hou

Efficient genome editing in wild strains of mice using the i-GONAD method

Mice A laboratory strain B6 was purchased from CLEA Japan Inc. (Tokyo, Japan), while nine wild strains (BFM/2, BLG2, CHD, HMI, KJR, MSM, NJL, PGN2, and SWN) were bred at NIG (Shizuoka, Japan) (Table 1). All mice were maintained at the animal facility in NIG, under specific-pathogen-free conditions and controlled…

Continue Reading Efficient genome editing in wild strains of mice using the i-GONAD method

Addgene: lentiCRISPR – CTRL sgRNA Citations

Plasmid Article: Identification and characterization of essential genes in the human genome.Wang T, Birsoy K, Hughes NW, Krupczak KM, Post Y, Wei JJ, Lander ES, Sabatini DM Science. 2015 Oct 15. pii: aac7041. PubMed Journal Articles Citing lentiCRISPR – CTRL sgRNA Articles HER2 + breast cancers evade anti-HER2 therapy via…

Continue Reading Addgene: lentiCRISPR – CTRL sgRNA Citations

Frontiers | A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiae

Introduction The clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) protein systems naturally exist in prokaryotes. They are RNA-mediated defense mechanisms to protect bacteria and archaea from invading nucleic acids (Barrangou et al., 2007). CRISPR–Cas systems are classified into two classes (1 and 2). Class 2 CRISPR–Cas require a single…

Continue Reading Frontiers | A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiae

CRISPR Gene-Editing Market May See a Big Move by 2029

Global Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Gene-Editing Market Synopsis: The finest Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Gene-Editing Market research report contains the drivers and restraints for the market that are obtained with the help of SWOT analysis, and also shows all the recent developments, product launches,…

Continue Reading CRISPR Gene-Editing Market May See a Big Move by 2029

Addgene 52961 Recipes

PTEN loss contributes to cetuximab resistance in head and Recipes Details: 1 Pathway-specific genome editing of PI3K/mTOR tumor suppressor genes reveals that PTEN loss contributes to cetuximab resistance in head and neck cancer . Authors and Affiliations . Hiroki Izumi1, Zhiyong Wang1, Yusuke Goto1, Toshinori Ando1,2, Xingyu Wu1, Xuefeng Zhang1,…

Continue Reading Addgene 52961 Recipes

Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

In nature, microbes have evolved different systems to sense external stimuli. Synthetic biology approaches (1) repurpose these systems as biosensors to specifically and sensitively detect various targets of interest. Although various highly sensitive and specific laboratory-based analytical methods (including high-performance liquid chromatography and mass spectrometry) can detect small-molecule targets, they…

Continue Reading Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

Butterfly eyespots evolved via cooption of an ancestral gene-regulatory network that also patterns antennae, legs, and wings

Although the hypothesis of gene-regulatory network (GRN) cooption is a plausible model to explain the origin of morphological novelties (1), there has been limited empirical evidence to show that this mechanism led to the origin of any novel trait. Several hypotheses have been proposed for the origin of butterfly eyespots,…

Continue Reading Butterfly eyespots evolved via cooption of an ancestral gene-regulatory network that also patterns antennae, legs, and wings

Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

Significance The extracellular concentration of adenosine triphosphate (ATP) reaches several hundred micromoles in the inflamed tissues or tumor environment. A high concentration of ATP activates P2X7, a purinergic receptor, and induces the formation of a nonselective cation channel, accompanied by reversible phosphatidylserine (PtdSer) exposure, leading to cell lysis. Here, we…

Continue Reading Requirement of Xk and Vps13a for the P2X7-mediated phospholipid scrambling and cell lysis in mouse T cells

Addgene: lentiCRISPR v2 puro – CRBN (#1)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications. For your Materials & Methods section: lentiCRISPR v2 puro – CRBN (#1) was a gift from Günter…

Continue Reading Addgene: lentiCRISPR v2 puro – CRBN (#1)

Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

> Addgene NGS Result CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTA GAGTTTAAACAAAAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACAT CTTTTCAGACGGCCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAAGAGCTGGAATGCTCTTCCGGTG TTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGAT AGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATT TTGTACTAATATCTTTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATA TGCAAATATGAAGGAATCATGGGAAATAGGCCCTCTTCCTGCCCGACCTTGACGGGTAGTGTTTAAACAA AAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACATCTTTTCAGACGG CCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAGACGTGGAATCGTCTCCGGTGTTTCGTCCTTTCCA CAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAA CATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCT TTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGG AATCATGGGAAATAGGCCCTCATTATCCTCTAGAATGGAGGCGGTACTATGTAGATGAGAATTCAGGAGC AAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCC TACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGG CTTAAATATTTACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTC ATACTTAAGCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAACACCGCCACCATGGT GCCTAAGAAGAAGAGAAAGGTGGAAGATATGGCCGCCTTCAAGCCTAACCCAATCAATTACATCCTGGGA CTGGACATCGGAATCGCATCCGTGGGATGGGCTATGGTGGAGATCGACGAGGAGGAGAATCCTATCCGGC TGATCGATCTGGGCGTGAGAGTGTTTGAGAGGGCCGAGGTGCCAAAGACCGGCGATTCTCTGGCTATGGC CCGGAGACTGGCACGGAGCGTGAGGCGCCTGACACGGAGAAGGGCACACAGGCTGCTGAGGGCACGCCGG CTGCTGAAGAGAGAGGGCGTGCTGCAGGCAGCAGACTTCGATGAGAATGGCCTGATCAAGAGCCTGCCAA ACACCCCCTGGCAGCTGAGAGCAGCCGCCCTGGACAGGAAGCTGACACCACTGGAGTGGTCTGCCGTGCT GCTGCACCTGATCAAGCACCGCGGCTACCTGAGCCAGCGGAAGAACGAGGGAGAGACAGCAGACAAGGAG CTGGGCGCCCTGCTGAAGGGAGTGGCCAACAATGCCCACGCCCTGCAGACCGGCGATTTCAGGACACCTG CCGAGCTGGCCCTGAATAAGTTTGAGAAGGAGTCCGGCCACATCAGAAACCAGAGGGGCGACTATAGCCA CACCTTCTCCCGCAAGGATCTGCAGGCCGAGCTGATCCTGCTGTTCGAGAAGCAGAAGGAGTTTGGCAAT CCACACGTGAGCGGAGGCCTGAAGGAGGGAATCGAGACCCTGCTGATGACACAGAGGCCTGCCCTGTCCG GCGACGCAGTGCAGAAGATGCTGGGACACTGCACCTTCGAGCCTGCAGAGCCAAAGGCCGCCAAGAACAC CTACACAGCCGAGCGGTTTATCTGGCTGACAAAGCTGAACAATCTGAGAATCCTGGAGCAGGGATCCGAG AGGCCACTGACCGACACAGAGAGGGCCACCCTGATGGATGAGCCTTACCGGAAGTCTAAGCTGACATATG CCCAGGCCAGAAAGCTGCTGGGCCTGGAGGACACCGCCTTCTTTAAGGGCCTGAGATACGGCAAGGATAA TGCCGAGGCCTCCACACTGATGGAGATGAAGGCCTATCACGCCATCTCTCGCGCCCTGGAGAAGGAGGGC CTGAAGGACAAGAAGTCCCCCCTGAACCTGAGCTCCGAGCTGCAGGATGAGATCGGCACCGCCTTCTCTC TGTTTAAGACCGACGAGGATATCACAGGCCGCCTGAAGGACAGGGTGCAGCCTGAGATCCTGGAGGCCCT GCTGAAGCACATCTCTTTCGATAAGTTTGTGCAGATCAGCCTGAAGGCCCTGAGAAGGATCGTGCCACTG ATGGAGCAGGGCAAGCGGTACGACGAGGCCTGCGCCGAGATCTACGGCGATCACTATGGCAAGAAGAACA CAGAGGAGAAGATCTATCTGCCCCCTATCCCTGCCGACGAGATCAGAAATCCTGTGGTGCTGAGGGCCCT GTCCCAGGCAAGAAAAGTGATCAACGGAGTGGTGCGCCGGTACGGATCTCCAGCCCGGATCCACATCGAG ACCGCCAGAGAAGTGGGCAAGAGCTTCAAGGACCGGAAGGAGATCGAGAAGAGACAGGAGGAGAATCGCA AGGATCGGGAGAAGGCCGCCGCCAAGTTTAGGGAGTACTTCCCTAACTTTGTGGGCGAGCCAAAGTCTAA GGACATCCTGAAGCTGCGCCTGTACGAGCAGCAGCACGGCAAGTGTCTGTATAGCGGCAAGGAGATCAAT CTGGTGCGGCTGAACGAGAAGGGCTATGTGGAGATCGATCACGCCCTGCCTTTCTCCAGAACCTGGGACG ATTCTTTTAACAATAAGGTGCTGGTGCTGGGCAGCGAGAACCAGAATAAGGGCAATCAGACACCATACGA GTATTTCAATGGCAAGGACAACTCCAGGGAGTGGCAGGAGTTCAAGGCCCGCGTGGAGACCTCTAGATTT…

Continue Reading Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

Phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein PINLYP regulates type I interferon innate immunity

Significance Interferon (IFN)-mediated antiviral responses serve as the first line of the host innate immune defense against viral infection. Here we identify a previously uncharacterized protein designated phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein (PINLYP), which is essential for embryonic development and plays an important role in type I IFN…

Continue Reading Phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein PINLYP regulates type I interferon innate immunity

p57 Suppresses the Pluripotency and Proliferation of Mouse Embryonic Stem Cells by Positively Regulating p53 Activation

Embryonic stem cells (ESCs) are pluripotent stem cells that have indefinite self-renewal capacities under appropriate culture conditions in vitro. The pluripotency maintenance and proliferation of these cells are delicately governed by the concert effect of a complex transcriptional regulatory network. Herein, we discovered that p57Kip2 (p57), a cyclin-dependent kinase inhibitor…

Continue Reading p57 Suppresses the Pluripotency and Proliferation of Mouse Embryonic Stem Cells by Positively Regulating p53 Activation

Single-cell delineation of lineage and genetic identity in the mouse brain

STICR lentiviral library preparation and validation We synthesized a high-complexity lentivirus barcode library that encodes approximately 60–70 million distinct oligonucleotide RNA sequences (STICR barcodes). STICR barcodes comprised three distinct oligonucleotide fragments cloned sequentially into a multicloning site within the 3′ UTR of an enhanced green fluorescent protein (eGFP) transgene under…

Continue Reading Single-cell delineation of lineage and genetic identity in the mouse brain

the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below?

James Guys, does anyone know the answer? get the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below? from EN Bilgi. Solved The spacer of sgRNA will hybridize with this sequence Answer to Solved The spacer of sgRNA will hybridize with this sequence Do…

Continue Reading the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below?

Addgene: pBJB20 – eft-3p::mitofilin::Mac::GFP::unc-54 3’UTR Sequences

> unc-54 3′ UTR GCCTCTGACTTCTAAGTCCAATTACTCTTCAACATCCCTACATGCTCTTTCTCCCTGTGCTCCCACCCCC TATTTTTGTTATTATCAAAAAACTTCTCTTAATTTCTTTGTTTTTTAGCTTCTTTTAAGTCACCTCTAAC AATGAAATTGTGTAGATTCAAAAATAGAATTAATTCGTAATAAAAAGTCGAAAAAAATTGTGCTCCCTCC CCCCATTAATAATAATTCTATCCCAAAATCTACACAATGTTCTGTGTACACTTCTTATGTTTTTTTTACT TCTGATAAATTTTTTTTGAAACATCATAGAAAAAACCGCACACAAAATACCTTATCATATGTTACGTTTC AGTTTATGACCGCAATTTTTATTTCTTCGCACGTCTGGGCCTCTCATGACGTCAAATCATGCTCATCGTG AAAAAGTTTTGGAGTATTTTTGGAATTTTTCAATCAAGTGAAAGTTTATGAAATTAATTTTCCTGCTTTT GCTTTTTGGGG Read more here: Source link

Continue Reading Addgene: pBJB20 – eft-3p::mitofilin::Mac::GFP::unc-54 3’UTR Sequences

Focus on Design Tools, Plasmid and Vector, Cas9 and g-RNA, Delivery System Products

DUBLIN, Sept. 21, 2021 /PRNewswire/ — The “CRISPR Market – Forecasts from 2021 to 2026” report has been added to ResearchAndMarkets.com‘s offering. The global CRISPR market is evaluated at US$0.979 billion for the year 2019 and is estimated to grow at a CAGR of 35.96% to reach a market size…

Continue Reading Focus on Design Tools, Plasmid and Vector, Cas9 and g-RNA, Delivery System Products

Co-op DNA Sequencing QC/QA – Addgene

Company Description Addgene is a thriving nonprofit founded in 2004 that facilitates biomedical research and discovery. Our biorepository stores, archives, and distributes plasmids for scientists around the world. Addgene’s plasmid collection is used to advance research in a wide variety of disciplines, including cancer, heart disease, and neurodegenerative disorders, and…

Continue Reading Co-op DNA Sequencing QC/QA – Addgene

MYO10 drives genomic instability and inflammation in cancer

INTRODUCTION Genomic instability often refers to the existence of a variety of DNA alterations, ranging from single nucleotide changes (such as base substitution, deletion, and insertion) to chromosomal rearrangements (e.g., gain or loss of a segment or the whole chromosome) (1). Loss of genome stability can lead to early onset…

Continue Reading MYO10 drives genomic instability and inflammation in cancer

The Point of Base Editors: Correcting Point Mutations

Some genome editing systems are highly conspicuous. They introduce double-strand breaks to DNA that attract the attention of cellular mechanisms such as nonhomologous end joining and homology-directed repair. If a genome editing system is so brash as to attempt a sizable insertion of new DNA, homology-directed repair must ensure that…

Continue Reading The Point of Base Editors: Correcting Point Mutations

Modification of endoglin-targeting nanoliposomes | IJN

Introduction Today, malignant tumors (cancer) still severely imperil human health and cause millions of global mortality rates.1,2 Deep-seated solid tumors are challenging to cure by most therapeutic tools, mainly blamed on the complex tumor microenvironment (TME).3,4 Adoptive cell therapy (ACT), as one of the effective immunotherapeutic means for cancer treatment,…

Continue Reading Modification of endoglin-targeting nanoliposomes | IJN

High-purity production and precise editing of DNA base editing ribonucleoproteins

Abstract Ribonucleoprotein (RNP) complex–mediated base editing is expected to be greatly beneficial because of its reduced off-target effects compared to plasmid- or viral vector–mediated gene editing, especially in therapeutic applications. However, production of recombinant cytosine base editors (CBEs) or adenine base editors (ABEs) with ample yield and high purity in…

Continue Reading High-purity production and precise editing of DNA base editing ribonucleoproteins

Genome-wide synthetic lethal screen unveils novel CAIX-NFS1/xCT axis as a targetable vulnerability in hypoxic solid tumors

Abstract The metabolic mechanisms involved in the survival of tumor cells within the hypoxic niche remain unclear. We carried out a synthetic lethal CRISPR screen to identify survival mechanisms governed by the tumor hypoxia–induced pH regulator carbonic anhydrase IX (CAIX). We identified a redox homeostasis network containing the iron-sulfur cluster…

Continue Reading Genome-wide synthetic lethal screen unveils novel CAIX-NFS1/xCT axis as a targetable vulnerability in hypoxic solid tumors

CRISPR: Guide to gRNA design

Introduction to CRISPR in SnapGene Genome editing technology has been evolving for many years. The Holy Grail of genome engineering has always been to introduce a specific genetic change that affects only the genomic target and leaves no undesired changes in the DNA. The discovery and application of the bacterial…

Continue Reading CRISPR: Guide to gRNA design