Tag: addgene

Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

> Addgene NGS Result CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCTCTA GAGTTTAAACAAAAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACAT CTTTTCAGACGGCCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAAGAGCTGGAATGCTCTTCCGGTG TTTCGTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGAT AGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATT TTGTACTAATATCTTTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATA TGCAAATATGAAGGAATCATGGGAAATAGGCCCTCTTCCTGCCCGACCTTGACGGGTAGTGTTTAAACAA AAAAATAAACGATGCCCCTTAAAGCAGAAGCTTTAAGGGGCAGAGCGTTGCGGCACATCTTTTCAGACGG CCTTATTGTAGCAACGTTTCGGGAGCTACAACTGAGACGTGGAATCGTCTCCGGTGTTTCGTCCTTTCCA CAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAA CATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCT TTGTGTTTACAGTCAAATTAATTCTAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGG AATCATGGGAAATAGGCCCTCATTATCCTCTAGAATGGAGGCGGTACTATGTAGATGAGAATTCAGGAGC AAACTGGGAAAAGCAACTGCTTCCAAATATTTGTGATTTTTACAGTGTAGTTTTGGAAAAACTCTTAGCC TACCAATTCTTCTAAGTGTTTTAAAATGTGGGAGCCAGTACACATGAAGTTATAGAGTGTTTTAATGAGG CTTAAATATTTACCGTAACTATGAAATGCTACGCATATCATGCTGTTCAGGCTCCGTGGCCACGCAACTC ATACTTAAGCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAACACCGCCACCATGGT GCCTAAGAAGAAGAGAAAGGTGGAAGATATGGCCGCCTTCAAGCCTAACCCAATCAATTACATCCTGGGA CTGGACATCGGAATCGCATCCGTGGGATGGGCTATGGTGGAGATCGACGAGGAGGAGAATCCTATCCGGC TGATCGATCTGGGCGTGAGAGTGTTTGAGAGGGCCGAGGTGCCAAAGACCGGCGATTCTCTGGCTATGGC CCGGAGACTGGCACGGAGCGTGAGGCGCCTGACACGGAGAAGGGCACACAGGCTGCTGAGGGCACGCCGG CTGCTGAAGAGAGAGGGCGTGCTGCAGGCAGCAGACTTCGATGAGAATGGCCTGATCAAGAGCCTGCCAA ACACCCCCTGGCAGCTGAGAGCAGCCGCCCTGGACAGGAAGCTGACACCACTGGAGTGGTCTGCCGTGCT GCTGCACCTGATCAAGCACCGCGGCTACCTGAGCCAGCGGAAGAACGAGGGAGAGACAGCAGACAAGGAG CTGGGCGCCCTGCTGAAGGGAGTGGCCAACAATGCCCACGCCCTGCAGACCGGCGATTTCAGGACACCTG CCGAGCTGGCCCTGAATAAGTTTGAGAAGGAGTCCGGCCACATCAGAAACCAGAGGGGCGACTATAGCCA CACCTTCTCCCGCAAGGATCTGCAGGCCGAGCTGATCCTGCTGTTCGAGAAGCAGAAGGAGTTTGGCAAT CCACACGTGAGCGGAGGCCTGAAGGAGGGAATCGAGACCCTGCTGATGACACAGAGGCCTGCCCTGTCCG GCGACGCAGTGCAGAAGATGCTGGGACACTGCACCTTCGAGCCTGCAGAGCCAAAGGCCGCCAAGAACAC CTACACAGCCGAGCGGTTTATCTGGCTGACAAAGCTGAACAATCTGAGAATCCTGGAGCAGGGATCCGAG AGGCCACTGACCGACACAGAGAGGGCCACCCTGATGGATGAGCCTTACCGGAAGTCTAAGCTGACATATG CCCAGGCCAGAAAGCTGCTGGGCCTGGAGGACACCGCCTTCTTTAAGGGCCTGAGATACGGCAAGGATAA TGCCGAGGCCTCCACACTGATGGAGATGAAGGCCTATCACGCCATCTCTCGCGCCCTGGAGAAGGAGGGC CTGAAGGACAAGAAGTCCCCCCTGAACCTGAGCTCCGAGCTGCAGGATGAGATCGGCACCGCCTTCTCTC TGTTTAAGACCGACGAGGATATCACAGGCCGCCTGAAGGACAGGGTGCAGCCTGAGATCCTGGAGGCCCT GCTGAAGCACATCTCTTTCGATAAGTTTGTGCAGATCAGCCTGAAGGCCCTGAGAAGGATCGTGCCACTG ATGGAGCAGGGCAAGCGGTACGACGAGGCCTGCGCCGAGATCTACGGCGATCACTATGGCAAGAAGAACA CAGAGGAGAAGATCTATCTGCCCCCTATCCCTGCCGACGAGATCAGAAATCCTGTGGTGCTGAGGGCCCT GTCCCAGGCAAGAAAAGTGATCAACGGAGTGGTGCGCCGGTACGGATCTCCAGCCCGGATCCACATCGAG ACCGCCAGAGAAGTGGGCAAGAGCTTCAAGGACCGGAAGGAGATCGAGAAGAGACAGGAGGAGAATCGCA AGGATCGGGAGAAGGCCGCCGCCAAGTTTAGGGAGTACTTCCCTAACTTTGTGGGCGAGCCAAAGTCTAA GGACATCCTGAAGCTGCGCCTGTACGAGCAGCAGCACGGCAAGTGTCTGTATAGCGGCAAGGAGATCAAT CTGGTGCGGCTGAACGAGAAGGGCTATGTGGAGATCGATCACGCCCTGCCTTTCTCCAGAACCTGGGACG ATTCTTTTAACAATAAGGTGCTGGTGCTGGGCAGCGAGAACCAGAATAAGGGCAATCAGACACCATACGA GTATTTCAATGGCAAGGACAACTCCAGGGAGTGGCAGGAGTTCAAGGCCCGCGTGGAGACCTCTAGATTT…

Continue Reading Addgene: pEJS1096 Dual-sgRNA.Design 1 Sequences

Phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein PINLYP regulates type I interferon innate immunity

Significance Interferon (IFN)-mediated antiviral responses serve as the first line of the host innate immune defense against viral infection. Here we identify a previously uncharacterized protein designated phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein (PINLYP), which is essential for embryonic development and plays an important role in type I IFN…

Continue Reading Phospholipase A2 inhibitor and LY6/PLAUR domain-containing protein PINLYP regulates type I interferon innate immunity

p57 Suppresses the Pluripotency and Proliferation of Mouse Embryonic Stem Cells by Positively Regulating p53 Activation

Embryonic stem cells (ESCs) are pluripotent stem cells that have indefinite self-renewal capacities under appropriate culture conditions in vitro. The pluripotency maintenance and proliferation of these cells are delicately governed by the concert effect of a complex transcriptional regulatory network. Herein, we discovered that p57Kip2 (p57), a cyclin-dependent kinase inhibitor…

Continue Reading p57 Suppresses the Pluripotency and Proliferation of Mouse Embryonic Stem Cells by Positively Regulating p53 Activation

Single-cell delineation of lineage and genetic identity in the mouse brain

STICR lentiviral library preparation and validation We synthesized a high-complexity lentivirus barcode library that encodes approximately 60–70 million distinct oligonucleotide RNA sequences (STICR barcodes). STICR barcodes comprised three distinct oligonucleotide fragments cloned sequentially into a multicloning site within the 3′ UTR of an enhanced green fluorescent protein (eGFP) transgene under…

Continue Reading Single-cell delineation of lineage and genetic identity in the mouse brain

the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below?

James Guys, does anyone know the answer? get the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below? from EN Bilgi. Solved The spacer of sgRNA will hybridize with this sequence Answer to Solved The spacer of sgRNA will hybridize with this sequence Do…

Continue Reading the spacer of sgrna will hybridize with this sequence of dna from the fragment shown below?

Addgene: pBJB20 – eft-3p::mitofilin::Mac::GFP::unc-54 3’UTR Sequences

> unc-54 3′ UTR GCCTCTGACTTCTAAGTCCAATTACTCTTCAACATCCCTACATGCTCTTTCTCCCTGTGCTCCCACCCCC TATTTTTGTTATTATCAAAAAACTTCTCTTAATTTCTTTGTTTTTTAGCTTCTTTTAAGTCACCTCTAAC AATGAAATTGTGTAGATTCAAAAATAGAATTAATTCGTAATAAAAAGTCGAAAAAAATTGTGCTCCCTCC CCCCATTAATAATAATTCTATCCCAAAATCTACACAATGTTCTGTGTACACTTCTTATGTTTTTTTTACT TCTGATAAATTTTTTTTGAAACATCATAGAAAAAACCGCACACAAAATACCTTATCATATGTTACGTTTC AGTTTATGACCGCAATTTTTATTTCTTCGCACGTCTGGGCCTCTCATGACGTCAAATCATGCTCATCGTG AAAAAGTTTTGGAGTATTTTTGGAATTTTTCAATCAAGTGAAAGTTTATGAAATTAATTTTCCTGCTTTT GCTTTTTGGGG Read more here: Source link

Continue Reading Addgene: pBJB20 – eft-3p::mitofilin::Mac::GFP::unc-54 3’UTR Sequences

Focus on Design Tools, Plasmid and Vector, Cas9 and g-RNA, Delivery System Products

DUBLIN, Sept. 21, 2021 /PRNewswire/ — The “CRISPR Market – Forecasts from 2021 to 2026” report has been added to ResearchAndMarkets.com‘s offering. The global CRISPR market is evaluated at US$0.979 billion for the year 2019 and is estimated to grow at a CAGR of 35.96% to reach a market size…

Continue Reading Focus on Design Tools, Plasmid and Vector, Cas9 and g-RNA, Delivery System Products

Co-op DNA Sequencing QC/QA – Addgene

Company Description Addgene is a thriving nonprofit founded in 2004 that facilitates biomedical research and discovery. Our biorepository stores, archives, and distributes plasmids for scientists around the world. Addgene’s plasmid collection is used to advance research in a wide variety of disciplines, including cancer, heart disease, and neurodegenerative disorders, and…

Continue Reading Co-op DNA Sequencing QC/QA – Addgene

MYO10 drives genomic instability and inflammation in cancer

INTRODUCTION Genomic instability often refers to the existence of a variety of DNA alterations, ranging from single nucleotide changes (such as base substitution, deletion, and insertion) to chromosomal rearrangements (e.g., gain or loss of a segment or the whole chromosome) (1). Loss of genome stability can lead to early onset…

Continue Reading MYO10 drives genomic instability and inflammation in cancer

The Point of Base Editors: Correcting Point Mutations

Some genome editing systems are highly conspicuous. They introduce double-strand breaks to DNA that attract the attention of cellular mechanisms such as nonhomologous end joining and homology-directed repair. If a genome editing system is so brash as to attempt a sizable insertion of new DNA, homology-directed repair must ensure that…

Continue Reading The Point of Base Editors: Correcting Point Mutations

Modification of endoglin-targeting nanoliposomes | IJN

Introduction Today, malignant tumors (cancer) still severely imperil human health and cause millions of global mortality rates.1,2 Deep-seated solid tumors are challenging to cure by most therapeutic tools, mainly blamed on the complex tumor microenvironment (TME).3,4 Adoptive cell therapy (ACT), as one of the effective immunotherapeutic means for cancer treatment,…

Continue Reading Modification of endoglin-targeting nanoliposomes | IJN

High-purity production and precise editing of DNA base editing ribonucleoproteins

Abstract Ribonucleoprotein (RNP) complex–mediated base editing is expected to be greatly beneficial because of its reduced off-target effects compared to plasmid- or viral vector–mediated gene editing, especially in therapeutic applications. However, production of recombinant cytosine base editors (CBEs) or adenine base editors (ABEs) with ample yield and high purity in…

Continue Reading High-purity production and precise editing of DNA base editing ribonucleoproteins

Genome-wide synthetic lethal screen unveils novel CAIX-NFS1/xCT axis as a targetable vulnerability in hypoxic solid tumors

Abstract The metabolic mechanisms involved in the survival of tumor cells within the hypoxic niche remain unclear. We carried out a synthetic lethal CRISPR screen to identify survival mechanisms governed by the tumor hypoxia–induced pH regulator carbonic anhydrase IX (CAIX). We identified a redox homeostasis network containing the iron-sulfur cluster…

Continue Reading Genome-wide synthetic lethal screen unveils novel CAIX-NFS1/xCT axis as a targetable vulnerability in hypoxic solid tumors

CRISPR: Guide to gRNA design

Introduction to CRISPR in SnapGene Genome editing technology has been evolving for many years. The Holy Grail of genome engineering has always been to introduce a specific genetic change that affects only the genomic target and leaves no undesired changes in the DNA. The discovery and application of the bacterial…

Continue Reading CRISPR: Guide to gRNA design