Tag: AnnotationDbi

DOI: 10.18129/B9.bioc.GmicR     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see GmicR. Combines WGCNA and xCell readouts with bayesian network learrning to generate a Gene-Module Immune-Cell network (GMIC) Bioconductor version: 3.13 This package uses bayesian network learning to detect relationships between Gene…

DOI: 10.18129/B9.bioc.MSnID     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see MSnID. Utilities for Exploration and Assessment of Confidence of LC-MSn Proteomics Identifications Bioconductor version: 3.13 Extracts MS/MS ID data from mzIdentML (leveraging mzID package) or text files. After collating the search…

DOI: 10.18129/B9.bioc.maPredictDSC     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see maPredictDSC. Phenotype prediction using microarray data: approach of the best overall team in the IMPROVER Diagnostic Signature Challenge Bioconductor version: 3.13 This package implements the classification pipeline of the best overall…

DOI: 10.18129/B9.bioc.trackViewer   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see trackViewer. A R/Bioconductor package with web interface for drawing elegant interactive tracks or lollipop plot to facilitate integrated analysis of multi-omics data Bioconductor version: 3.16 Visualize mapped reads along with annotation as…

Hi everyone First of all thank you for making rna-seq data much more accessible to an average clinical doctor through the DEseq2 packages and vignettes. I am though running into some trouble: I have a dataset of Nanostring mRNA-data from clinical study, which later was followed up. I therefore have…

DOI: 10.18129/B9.bioc.karyoploteR     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see karyoploteR. Plot customizable linear genomes displaying arbitrary data Bioconductor version: 3.13 karyoploteR creates karyotype plots of arbitrary genomes and offers a complete set of functions to plot arbitrary data on them….

DOI: 10.18129/B9.bioc.gpart     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see gpart. Human genome partitioning of dense sequencing data by identifying haplotype blocks Bioconductor version: 3.13 we provide a new SNP sequence partitioning method which partitions the whole SNP sequence based on…

DOI: 10.18129/B9.bioc.methylGSA     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see methylGSA. Gene Set Analysis Using the Outcome of Differential Methylation Bioconductor version: 3.13 The main functions for methylGSA are methylglm and methylRRA. methylGSA implements logistic regression adjusting number of probes as…

DOI: 10.18129/B9.bioc.phenoTest     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see phenoTest. Tools to test association between gene expression and phenotype in a way that is efficient, structured, fast and scalable. We also provide tools to do GSEA (Gene set enrichment analysis)…

Phylogenetic tree construction Tree diagram showing relationships between CDK proteins was constructed from a multi-sequence alignment (MSA) using Geneious95. The “Geneious Aligner”, was used to generate the MSA, and the neighbor joining method was used to construct the tree. All default parameters were used except where otherwise indicated. Combinatorial CRISPR…

Hello! I’m having problems with lfcShrink in my DESeq2 workflow. I’m trying to do a differential expression analysis (with only one comparison term: “MULTIseq_ID_call2”) on my single-cell data. However when I do lfcShrink I get an error that I cannot interpret. Can you help me? dds <- DESeq(dds, test =…

DOI: 10.18129/B9.bioc.IMAS     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see IMAS. Integrative analysis of Multi-omics data for Alternative Splicing Bioconductor version: 3.12 Integrative analysis of Multi-omics data for Alternative splicing. Author: Seonggyun Han, Younghee Lee Maintainer: Seonggyun Han <hangost at ssu.ac.kr>…

DOI: 10.18129/B9.bioc.mgu74b.db     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see mgu74b.db. Affymetrix Murine Genome U74v2 annotation data (chip mgu74b) Bioconductor version: 3.10 Affymetrix Murine Genome U74v2 annotation data (chip mgu74b) assembled using data from public repositories Author: Marc Carlson Maintainer: Bioconductor…

DOI: 10.18129/B9.bioc.mastR   Markers Automated Screening Tool in R Bioconductor version: Release (3.17) mastR is an R package designed for automated screening of signatures of interest for specific research questions. The package is developed for generating refined lists of signature genes from multiple group comparisons based on the results from…

DOI:10.18129/B9.bioc.mgu74c.db This is thedevelopmentversion of mgu74c.db; for the stable release version, seemgu74c.db. Affymetrix Affymetrix MG_U74C Array annotation data (chip mgu74c) Bioconductor version: Development (3.17) Affymetrix Affymetrix MG_U74C Array annotation data (chip mgu74c) assembled using data from public repositories Author: Marc Carlson Maintainer: Bioconductor Package Maintainer Citation (from within R, entercitation(“mgu74c.db”)):…

DOI: 10.18129/B9.bioc.OutSplice   This is the development version of OutSplice; to use it, please install the devel version of Bioconductor. Comparison of Splicing Events between Tumor and Normal Samples Bioconductor version: Development (3.17) An easy to use tool that can compare splicing events in tumor and normal tissue samples using…

DOI: 10.18129/B9.bioc.Ularcirc     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see Ularcirc. Shiny app for canonical and back splicing analysis (i.e. circular and mRNA analysis) Bioconductor version: 3.13 Ularcirc reads in STAR aligned splice junction files and provides visualisation and analysis tools…

DOI: 10.18129/B9.bioc.eegc     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see eegc. Engineering Evaluation by Gene Categorization (eegc) Bioconductor version: 3.12 This package has been developed to evaluate cellular engineering processes for direct differentiation of stem cells or conversion (transdifferentiation) of somatic…

This is the development version of GenomicRanges; for the stable release version, see GenomicRanges. The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyzing high-throughput sequencing data (a.k.a. NGS data). The GenomicRanges package defines general purpose containers for storing…

I am running DEseq2 analysis on human RNAseq data. I finally just want my heatmap of top 20 DE genes so I can call it a day. Code: library(org.Mm.eg.db) keytypes(org.Mm.eg.db) mykeys<- c( “ENSG00000157077”, “ENSG00000230844”, “ENSG00000161055″ ,”ENSG00000172244”, “ENSG00000066933″ ,”ENSG00000197497″ ,”ENSG00000170631″ ,”ENSG00000260285”, “ENSG00000136193”, “ENSG00000260744”, “ENSG00000141540”, “ENSG00000197978”, “ENSG00000235781”, “ENSG00000197093″ ,”ENSG00000106868”, “ENSG00000171596”, “ENSG00000204475”, “ENSG00000163053”,…

Gene duplicate 1 Hi there, I am pretty new to single cell RNA seq and I am trying to learn by doing analysis for a data that has been published already. I am using monocle3 and I realized that some Ensembl IDs that are the same and I was wondering…

DOI: 10.18129/B9.bioc.scRNAseq   This is the development version of scRNAseq; for the stable release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: Development (3.17) Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso [aut, cph],…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see GeneRegionScan. GeneRegionScan Bioconductor version: 2.11 A package with focus on analysis of discrete regions of the genome. This package is useful for investigation of one or a few genes using Affymetrix data, since…

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see limmaGUI. GUI for limma package with two color microarrays Bioconductor version: 3.3 A Graphical User Interface for differential expression analysis of two-color microarray data using the limma package. Author: James Wettenhall [aut], Gordon…

Hi, I am attempting to work through the workflow described in “Swimming downstream: statistical analysis of differential transcript usage following Salmon quantification.” I am running into an error message when I try to make the counts dataframe for DRIMseq: Error in data.frame(gene_id = txdf$GENEID, feature_id = txdf$TXNAME, cts) : arguments…

I am trying to annotate a list of SNPs using the hg38 genome (knownGene) and locateVariants(). The program is able to successfully run and provide “GeneIDs” for several of the loci. However, some GeneIDs are applied to SNPs in completely different regions and on completely different chromosomes. When I cross…

Hi all, I am not sure if this is the right place to ask this question, but I’ve just updated my DESeq2 package from version 1.4.5 to version 1.6.3 and my scripts are no longer working. Specifically, I get the following error when generating a DESeqDataSet object with the function…

DOI: 10.18129/B9.bioc.crisprDesign   This is the development version of crisprDesign; for the stable release version, see crisprDesign. Comprehensive design of CRISPR gRNAs for nucleases and base editors Bioconductor version: Development (3.17) Provides a comprehensive suite of functions to design and annotate CRISPR guide RNA (gRNAs) sequences. This includes on- and…

How to retrieve Microarray probe annotations 0 Hi , I have a question about retrieving Microarray probe annotations. I am interested in analyzing at-least 10-15 NCBI GEO Public Microarray datasets. Each of them are related to different platform (see below). Is there a way to retrieve them using a certain…

DOI: 10.18129/B9.bioc.SpidermiR     SpidermiR: An R/Bioconductor package for integrative network analysis with miRNA data Bioconductor version: Release (3.6) The aims of SpidermiR are : i) facilitate the network open-access data retrieval from GeneMania data, ii) prepare the data using the appropriate gene nomenclature, iii) integration of miRNA data in…

Genes in 10x don’t match genes in ENSBL 0 Hi everyone, I am trying to map my genes to chromosome location so I can remove low quality cells using high mitochondrial content. When mapping to the cromosoms I obtain the below error. gene_annot <- AnnotationDbi::select(ens.hs.107, keys = genes, keytype =…

DOI: 10.18129/B9.bioc.restfulSE     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see restfulSE. Access matrix-like HDF5 server content or BigQuery content through a SummarizedExperiment interface Bioconductor version: 3.10 This package provides functions and classes to interface with remote data stores by operating on…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see OrganismDbi. Software to enable the smooth interfacing of different database packages. Bioconductor version: 2.11 The package enables a simple unified interface to several annotation packages each of which has its own schema by…

Hi, I am running the HTSeqGenie on both MacOS and Linux with the test TP53 samples. They both gave me error in reading the fastq files. It seems having problems reading the fastq.gz files in each parallel process. Could anyone help me with this please? Error are at below: checkConfig.R/checkConfig.template:…

I have results of a functional analysis as a data.frame with the following columns: names(BP) [1] “category” “ID” “Term” “Genes” “adj_pval” The third column is a comma seperated list the genes containing in each GO term given as ENSEMBL id: Genes 1 ENSG00000159618, ENSG00000197471, ENSG00000166928, ENSG00000134539, ENSG00000116824, ENSG00000198821, ENSG00000111796, ENSG00000150045,…

Potential problem with independent filtering in DESeq2 1 @8a6e6497 Last seen 16 hours ago United States Hello, I was routinely using DESeq2 for some small RNA-seq datasets, and suddenly I noticed that FDR corrections are too aggressive. After some investigation, I found out that independent filtering is wrongly determining the…

DOI: 10.18129/B9.bioc.crisprseekplus     crisprseekplus Bioconductor version: Release (3.16) Bioinformatics platform containing interface to work with offTargetAnalysis and compare2Sequences in the CRISPRseek package, and GUIDEseqAnalysis. Author: Sophie Wigmore <Sophie.Wigmore at umassmed.edu>, Alper Kucukural <alper.kucukural at umassmed.edu>, Lihua Julie Zhu <julie.zhu at umassmed.edu>, Michael Brodsky <Michael.Brodsky at umassmed.edu>, Manuel Garber <Manuel.Garber…

DOI: 10.18129/B9.bioc.PartheenMetaData.db     PartheenMetaData swegene.onk.lu.se Annotation Data (PartheenMetaData) Bioconductor version: Release (3.14) PartheenMetaData swegene.onk.lu.se Annotation Data (PartheenMetaData) assembled using data from public repositories Author: Marc Carlson Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from within R, enter citation(“PartheenMetaData.db”)): Installation To install this package, start R (version “4.1”) and…

Hi, I’m currently trying to assess fold change when comparing two different sample types using DESeq2 package and I’m getting weird Cook’s distance values which are causing major problems. The two different samples have different amounts of replicates (6 replicates vs 5 replicates) which might be the reason for these…

DOI: 10.18129/B9.bioc.illuminaHumanv4.db     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see illuminaHumanv4.db. Illumina HumanHT12v4 annotation data (chip illuminaHumanv4) Bioconductor version: 3.12 Illumina HumanHT12v4 annotation data (chip illuminaHumanv4) assembled using data from public repositories Author: Mark Dunning, Andy Lynch, Matthew Eldridge Maintainer: Mark…

HI everyone. I have a set of mouse SNPs (~974) from GRCm39 that I’m trying to get either GERP or UCSC Conservation scores on. To do this, I’m using rtracklayer to try to query the ranges of the SNP and return the multiz35way conservation score. However, when I do this,…

I’m trying to annotate some data from a Bisulphite experiment, from which I have a GRanges object without any annotation: GRanges object with 872900 ranges and 0 metadata columns: seqnames ranges strand <Rle> <IRanges> <Rle> [1] chr10 48196 * [2] chr10 48486 * [3] chr10 49247 * [4] chr10 49258…

Error in UseMethod(“rescale”) 0 @2528ae94 Last seen 17 hours ago United States While using cnetplot to plot enrichGo results, I am getting the following error. It used to work before, but now I am constantly getting this error. I am using clusterprofiler package gse <- enrichGO(gene = deGenes, ont =…

DOI: 10.18129/B9.bioc.EasyCellType     Annotate cell types for scRNA-seq data Bioconductor version: Release (3.16) We developed EasyCellType which can automatically examine the input marker lists obtained from existing software such as Seurat over the cell markerdatabases. Two quantification approaches to annotate cell types are provided: Gene set enrichment analysis (GSEA)…

Hello! I am working on analyzing a dataset I created with the 10x Chromium Single Cell Multiome kit. In order to add gene annotation to the ATAC data, I am trying to install and use the “EnsDb.Mmusculus.v79” and “BSgenome.Mmusculus.UCSC.mm10” packages with bioconductor. The same ERROR has come up repeatedly whenever…

Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…

DOI: 10.18129/B9.bioc.lumi     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see lumi. BeadArray Specific Methods for Illumina Methylation and Expression Microarrays Bioconductor version: 3.12 The lumi package provides an integrated solution for the Illumina microarray data analysis. It includes functions of Illumina…

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Dear Bioc, Following the rtracklayer documentation, section 2.2.4, ‘A Shortcut’, I encounter the following error browseGenome (subTargetTrack) Error in validObject(.Object) :invalid class “ucscCart” object: superclass “ANYTHING” not defined in the environment of the object’s class traceback () 13: stop(msg, ” “, errors, domain = NA)12: validObject(.Object)11: initialize(value, …)10: initialize(value, …)9:…

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see keggorthology. graph support for KO, KEGG Orthology Bioconductor version: 2.13 graphical representation of the Feb 2010 KEGG Orthology. The KEGG orthology is a set of pathway IDs that are not to be confused…

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see neaGUI. An R package to perform the network enrichment analysis (NEA). Bioconductor version: 2.13 neaGUI is an easy to use R package developed to perform the network enrichment analysis (NEA) proposed by Alexeyenko…

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Hi, I cannot install traviz package (version 1.0.0) from Bioconductor on a linux machine (from source). I have a conda environment, and I installed traviz from conda, but it cannot be used – when I do library(traviz) R just crashes and quits without any message. So I tried to install…

DOI: 10.18129/B9.bioc.Roberts2005Annotation.db     This is the development version of Roberts2005Annotation.db; for the stable release version, see Roberts2005Annotation.db. Roberts2005Annotation Annotation Data (Roberts2005Annotation) Bioconductor version: Development (3.15) Roberts2005Annotation Annotation Data (Roberts2005Annotation) assembled using data from public repositories Author: Marc Carlson Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from within R,…

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see interactiveDisplay. Package for enabling powerful shiny web displays of Bioconductor objects Bioconductor version: 3.2 The interactiveDisplay package contains the methods needed to generate interactive Shiny based display methods for Bioconductor objects. Author: Shawn…

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see rgsepd. Gene Set Enrichment / Projection Displays Bioconductor version: 3.4 R/GSEPD is a bioinformatics package for R to help disambiguate transcriptome samples (a matrix of RNA-Seq counts at RefSeq IDs) by automating differential…

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see reactome.db. A set of annotation maps for reactome Bioconductor version: 2.14 A set of annotation maps for reactome assembled using data from reactome Author: Willem Ligtenberg Maintainer: Willem Ligtenberg <willem.ligtenberg at openanalytics.eu> Citation…

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Listing Results R bioconductor courses Bioconductor Introduction To R / Bioconductor Harvard Bioconductor.org All Courses 016-05-16 Just NowIntroduction to R / Bioconductor. Buffalo, NY. 2016-05-16 ~ 2016-05-17. Instructors. Martin Morgan; Lori Shepherd; Description. This is a two-day course introducing R and Bioconductor for the analysis and comprehension of high-throughput genomic…

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see human.db0. Base Level Annotation databases for human Bioconductor version: 2.14 Base annotation databases for human, intended ONLY to be used by AnnotationDbi to produce regular annotation packages. Author: Marc Carlson, Nianhua Li, Herve…

DOI: 10.18129/B9.bioc.conclus     ScRNA-seq Workflow CONCLUS – From CONsensus CLUSters To A Meaningful CONCLUSion Bioconductor version: Release (3.13) CONCLUS is a tool for robust clustering and positive marker features selection of single-cell RNA-seq (sc-RNA-seq) datasets. It takes advantage of a consensus clustering approach that greatly simplify sc-RNA-seq data analysis…

DOI: 10.18129/B9.bioc.geecc     This package is for version 3.11 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see geecc. Gene Set Enrichment Analysis Extended to Contingency Cubes Bioconductor version: 3.11 Use log-linear models to perform hypergeometric and chi-squared tests for gene…

GO Enrichment Analysis in R – Count all the parents of each Term 0 Hi, I’m trying to implement a new GO tool in R. After I have a list of genes, I’m using the following code to retrieve the relevant annotation for each gene: library(AnnotationDbi) AnnotationDbi::select(org.Hs.eg.db, keys = genes.list,…

DOI: 10.18129/B9.bioc.scRNAseq     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: 3.11 Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso…

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Annotation Forge Error: makeOrgPackageFromNCBI 0 Hi, I just run a code inherited from a recent nature paper: github.com/RoundLab/Ost_CandidaRNASeq However, I got a lot of errors with annotation forge. Would you please help me? Yesterday, I had another error. Today I have rerun it, and I got another error. 🙁 library(“biomaRt”)…

[HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], hugene10sttranscriptcluster.db, AnnotationDbi 1 Hello, I have microarray data from the chip [HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], and I am trying to annotate the probe IDs in R using the hugene10sttranscriptcluster.db package and the following function:…

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

The biggies are obviously DESeq2, limma and edgeR, but they are massive packages doing some very complex statistics, and also have dependency trees that would need to be considered. Depending on your background, you might want to look into the rtracklayer/GenomicRanges eco-system. While I personally am not a fan, I…