Tag: AnnotationDbi

Bioconductor – EasyCellType

DOI: 10.18129/B9.bioc.EasyCellType     Annotate cell types for scRNA-seq data Bioconductor version: Release (3.16) We developed EasyCellType which can automatically examine the input marker lists obtained from existing software such as Seurat over the cell markerdatabases. Two quantification approaches to annotate cell types are provided: Gene set enrichment analysis (GSEA)…

Continue Reading Bioconductor – EasyCellType

lazy loading failed, unable to load shared object rtracklayer.so

Hello! I am working on analyzing a dataset I created with the 10x Chromium Single Cell Multiome kit. In order to add gene annotation to the ATAC data, I am trying to install and use the “EnsDb.Mmusculus.v79” and “BSgenome.Mmusculus.UCSC.mm10” packages with bioconductor. The same ERROR has come up repeatedly whenever…

Continue Reading lazy loading failed, unable to load shared object rtracklayer.so

Log2FC values slightly higher in some genes after DESeq2 shrinkage

Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…

Continue Reading Log2FC values slightly higher in some genes after DESeq2 shrinkage

Bioconductor – lumi

DOI: 10.18129/B9.bioc.lumi     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see lumi. BeadArray Specific Methods for Illumina Methylation and Expression Microarrays Bioconductor version: 3.12 The lumi package provides an integrated solution for the Illumina microarray data analysis. It includes functions of Illumina…

Continue Reading Bioconductor – lumi

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

[BioC] rtracklayer 1.6: invalid class “ucscCart” object

Dear Bioc, Following the rtracklayer documentation, section 2.2.4, ‘A Shortcut’, I encounter the following error browseGenome (subTargetTrack) Error in validObject(.Object) :invalid class “ucscCart” object: superclass “ANYTHING” not defined in the environment of the object’s class traceback () 13: stop(msg, ” “, errors, domain = NA)12: validObject(.Object)11: initialize(value, …)10: initialize(value, …)9:…

Continue Reading [BioC] rtracklayer 1.6: invalid class “ucscCart” object

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

deseq2 problem

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Continue Reading deseq2 problem

Bioconductor – keggorthology

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see keggorthology. graph support for KO, KEGG Orthology Bioconductor version: 2.13 graphical representation of the Feb 2010 KEGG Orthology. The KEGG orthology is a set of pathway IDs that are not to be confused…

Continue Reading Bioconductor – keggorthology

Bioconductor – neaGUI

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see neaGUI. An R package to perform the network enrichment analysis (NEA). Bioconductor version: 2.13 neaGUI is an easy to use R package developed to perform the network enrichment analysis (NEA) proposed by Alexeyenko…

Continue Reading Bioconductor – neaGUI

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

DESeq2 and high prefiltering cutoff

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

Continue Reading DESeq2 and high prefiltering cutoff

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

traviz 1.0.0 installation fails: ERROR: lazy loading failed

Hi, I cannot install traviz package (version 1.0.0) from Bioconductor on a linux machine (from source). I have a conda environment, and I installed traviz from conda, but it cannot be used – when I do library(traviz) R just crashes and quits without any message. So I tried to install…

Continue Reading traviz 1.0.0 installation fails: ERROR: lazy loading failed

Bioconductor – Roberts2005Annotation.db (development version)

DOI: 10.18129/B9.bioc.Roberts2005Annotation.db     This is the development version of Roberts2005Annotation.db; for the stable release version, see Roberts2005Annotation.db. Roberts2005Annotation Annotation Data (Roberts2005Annotation) Bioconductor version: Development (3.15) Roberts2005Annotation Annotation Data (Roberts2005Annotation) assembled using data from public repositories Author: Marc Carlson Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from within R,…

Continue Reading Bioconductor – Roberts2005Annotation.db (development version)

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

Design formula in DESeq2

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

Continue Reading Design formula in DESeq2

Bioconductor – interactiveDisplay

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see interactiveDisplay. Package for enabling powerful shiny web displays of Bioconductor objects Bioconductor version: 3.2 The interactiveDisplay package contains the methods needed to generate interactive Shiny based display methods for Bioconductor objects. Author: Shawn…

Continue Reading Bioconductor – interactiveDisplay

Bioconductor – rgsepd

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see rgsepd. Gene Set Enrichment / Projection Displays Bioconductor version: 3.4 R/GSEPD is a bioinformatics package for R to help disambiguate transcriptome samples (a matrix of RNA-Seq counts at RefSeq IDs) by automating differential…

Continue Reading Bioconductor – rgsepd

Bioconductor – reactome.db

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see reactome.db. A set of annotation maps for reactome Bioconductor version: 2.14 A set of annotation maps for reactome assembled using data from reactome Author: Willem Ligtenberg Maintainer: Willem Ligtenberg <willem.ligtenberg at openanalytics.eu> Citation…

Continue Reading Bioconductor – reactome.db

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

R Bioconductor Courses

Listing Results R bioconductor courses Bioconductor Introduction To R / Bioconductor Harvard Bioconductor.org All Courses 016-05-16 Just NowIntroduction to R / Bioconductor. Buffalo, NY. 2016-05-16 ~ 2016-05-17. Instructors. Martin Morgan; Lori Shepherd; Description. This is a two-day course introducing R and Bioconductor for the analysis and comprehension of high-throughput genomic…

Continue Reading R Bioconductor Courses

Outliers on DESEq2 Results

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

Continue Reading Outliers on DESEq2 Results

Bioconductor – human.db0

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see human.db0. Base Level Annotation databases for human Bioconductor version: 2.14 Base annotation databases for human, intended ONLY to be used by AnnotationDbi to produce regular annotation packages. Author: Marc Carlson, Nianhua Li, Herve…

Continue Reading Bioconductor – human.db0

Bioconductor – conclus

DOI: 10.18129/B9.bioc.conclus     ScRNA-seq Workflow CONCLUS – From CONsensus CLUSters To A Meaningful CONCLUSion Bioconductor version: Release (3.13) CONCLUS is a tool for robust clustering and positive marker features selection of single-cell RNA-seq (sc-RNA-seq) datasets. It takes advantage of a consensus clustering approach that greatly simplify sc-RNA-seq data analysis…

Continue Reading Bioconductor – conclus

Bioconductor – geecc

DOI: 10.18129/B9.bioc.geecc     This package is for version 3.11 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see geecc. Gene Set Enrichment Analysis Extended to Contingency Cubes Bioconductor version: 3.11 Use log-linear models to perform hypergeometric and chi-squared tests for gene…

Continue Reading Bioconductor – geecc

GO Enrichment Analysis in R

GO Enrichment Analysis in R – Count all the parents of each Term 0 Hi, I’m trying to implement a new GO tool in R. After I have a list of genes, I’m using the following code to retrieve the relevant annotation for each gene: library(AnnotationDbi) AnnotationDbi::select(org.Hs.eg.db, keys = genes.list,…

Continue Reading GO Enrichment Analysis in R

Bioconductor – scRNAseq

DOI: 10.18129/B9.bioc.scRNAseq     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: 3.11 Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso…

Continue Reading Bioconductor – scRNAseq

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

Annotation Forge Error: makeOrgPackageFromNCBI

Annotation Forge Error: makeOrgPackageFromNCBI 0 Hi, I just run a code inherited from a recent nature paper: github.com/RoundLab/Ost_CandidaRNASeq However, I got a lot of errors with annotation forge. Would you please help me? Yesterday, I had another error. Today I have rerun it, and I got another error. 🙁 library(“biomaRt”)…

Continue Reading Annotation Forge Error: makeOrgPackageFromNCBI

[HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], hugene10sttranscriptcluster.db, AnnotationDbi

[HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], hugene10sttranscriptcluster.db, AnnotationDbi 1 Hello, I have microarray data from the chip [HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], and I am trying to annotate the probe IDs in R using the hugene10sttranscriptcluster.db package and the following function:…

Continue Reading [HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version], hugene10sttranscriptcluster.db, AnnotationDbi

weird MAplot or volcano plot of DESeq2 diff result

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

Continue Reading weird MAplot or volcano plot of DESeq2 diff result

Highly used R packages with no Python equivalent

The biggies are obviously DESeq2, limma and edgeR, but they are massive packages doing some very complex statistics, and also have dependency trees that would need to be considered. Depending on your background, you might want to look into the rtracklayer/GenomicRanges eco-system. While I personally am not a fan, I…

Continue Reading Highly used R packages with no Python equivalent