Tag: BBMap
Alfalfa vein mottling virus, a novel potyvirid infecting Medicago sativa L. | Virology Journal
Plant material Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1. Table 1 Geographic locations of alfalfa fields Total…
Quast Genome assembly Quality (Galaxy Version 5.2.0+galaxy1) – usegalaxy.org support
Busrak November 29, 2023, 9:55am 1 Hi dear galaxy family, When I put my metagenome single read Megahit assembly data into Quast, I encounter the following error code. How can I solve this problem? Assembly_with_MEGAHIT_on_data_658 /usr/local/opt/quast-5.2.0/metaquast.py –single /jetstream2/scratch/main/jobs/53997042/inputs/dataset_f68c8b4a-bea0-4985-8324-4c64cdbe4d6d.dat –labels Assembly_with_MEGAHIT_on_data_658 -o outputdir –max-ref-num 50 –m 822: Quast on data 196…
Generating count matrix from Chromium Fixed RNA Profiling (FRP) data outside Cell Ranger.
Looks like 10x has example datasets on their web site. Will take a look to see what these BC sequences look in reality. Should be possible to bin them using seal.sh from BBMap. Edit: From one of the test datasets it is possible to see these BC barcodes in Read…
BBtools bug in reporting the number of substitutions in the console output, it seems to report insanely high rates of heterozygosity
Hello, I know Brian is sometimes around, but here is my command: while read p; do callvariants.sh in=${p}.recal.bam ploidy=2 vcf=${p}.20score.vcf useidentity=f overwrite=true ref=ref.fsa -Xmx50g ; done <ID java -ea -Xmx50g -Xms50g -cp /home/alessandro/software/bbmap/current/ var2.CallVariants in=ancestor.recal.bam ploidy=2 vcf=ancestor.20score.vcf useidentity=f overwrite=true ref=ref.fsa -Xmx50g Executing var2.CallVariants [in=ancestor.recal.bam, ploidy=2, vcf=ancestor.20score.vcf, useiden tity=f, overwrite=true, ref=Adineta_vaga.fsa,…
filtering SAM/BAM to remove hits spanning short combined alignment lengths and low counts
filtering SAM/BAM to remove hits spanning short combined alignment lengths and low counts 0 hi folks, apologies if this has been answered elsewhere. I’m using read mapping to quantitate the abundance of viral metagenome assembled genomes (MAGs) across samples and I’d like to do a bit of data cleaning that’s…
Accepted bbmap 39.06+dfsg-1 (source) into unstable
—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Fri, 24 Nov 2023 11:55:22 +0100 Source: bbmap Architecture: source Version: 39.06+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Étienne Mollier <emoll…@debian.org> Changes: bbmap (39.06+dfsg-1) unstable; urgency=medium . * New upstream version 39.06+dfsg * java_syntax.patch: delete: applied…
Genomic evidence that microbial carbon degradation is dominated by iron redox metabolism in thawing permafrost
Tarnocai C, Canadell JG, Schuur EA, Kuhry P, Mazhitova G, Zimov S. Soil organic carbon pools in the northern circumpolar permafrost region. Global Biogeochem Cycles. 2009;23:1–11. Article Google Scholar Hugelius G, Strauss J, Zubrzycki S, Harden JW, Schuur EA, Ping CL, et al. Estimated stocks of circumpolar permafrost carbon with…
BBMap : NH:i:1 and XT:A:R
BBMap : NH:i:1 and XT:A:R 0 Hi, I aligned some paired-end reads on hg19 and found some strange stuff (at least for me..). Some reads have NH:i:1 i.e. the read aligned in one position and XT:A:R i.e. XT:A:R flag indicates that the second read is repetitive. I don’t understand how…
Do threads matter for host DNA removal with bbmap?
Do threads matter for host DNA removal with bbmap? 1 Hello, I want to use bbmap to filter out host sequences from my metagenomics reads. It is my understanding that bbmap calculates the insert size independently for each thread that it is run on, and I am trying to figure…
How do I know how much memory to use when piping to with BBMap suite (OutOfMemoryError)?
How do I know how much memory to use when piping to with BBMap suite (OutOfMemoryError)? 1 pv trimmomatic.fastq.gz | reformat.sh int=f in=stdin.fastq.gz out=stdout.fasta | dedupe.sh in=stdin.fasta out=trimmomatic.dedupe.fasta | clumpify.sh in=stdin.fasta out=trimmomatic.dedupe.clumpify.fasta.gz My gzipped file size is 40G. I specified 250G on our server but still got the issue. I…
Can clumpify.sh be used in a streaming fashion downstream of bcl-convert
Can clumpify.sh be used in a streaming fashion downstream of bcl-convert 0 Hi I wanted to know if it is possible to use clumpify.sh in a streaming fashion – like one would do with bwa mem …. | samtools I would like to demultiplex with bcl-convert and on the fly,…
Index of /ubuntu/pool/universe/b/bbmap
Name Last modified Size Description Parent Directory – bbmap-jni_38.79+dfsg-1_amd64.deb 2020-02-27 14:23 23K bbmap-jni_38.90+dfsg-1_amd64.deb 2021-02-05 14:24 23K bbmap-jni_38.94+dfsg-2_amd64.deb 2021-10-19 08:55 25K bbmap_38.79+dfsg-1.debian.tar.xz 2020-02-27 14:13 22K bbmap_38.79+dfsg-1.dsc 2020-02-27 14:13 2.0K bbmap_38.79+dfsg-1_all.deb 2020-02-27 14:23 5.0M bbmap_38.79+dfsg.orig.tar.xz 2020-02-27 14:13 4.1M bbmap_38.90+dfsg-1.debian.tar.xz 2021-02-05 14:24 22K …
Diagnostic and commensal Staphylococcus pseudintermedius genomes reveal niche adaptation through parallel selection of defense mechanisms
Bond, R. & Loeffler, A. What’s happened to Staphylococcus intermedius? Taxonomic revision and emergence of multi-drug resistance. J. Small Anim. Pr. 53, 147–154 (2012). Article CAS Google Scholar Carroll, K. C., Burnham, C. D. & Westblade, L. F. From canines to humans: clinical importance of Staphylococcus pseudintermedius. PLoS Pathog. 17,…
Invasive Californian death caps develop mushrooms unisexually and bisexually
Mushroom collecting Sporocarps were collected from various herbaria and during three expeditions to Point Reyes National Seashore (PRNS), California in 2004, 2014 and 2015, and in 2015 from three sites in Portugal. A total of 86 sporocarps were collected: 67 Californian sporocarps (one early herbarium sample dates to 1993), 11…
The Fundamentals of Metagenomics | Devpost
Inspiration Computational Biology allows for the intersection of biology and computing for technological innovations and optimizations in genomics, modeling systems, biology, phylogenetics, etc. In our project, we chose to focus on studying the structure and function of sequences from a community of organisms, like on human skin, in the soil,…
Rational probe design for efficient rRNA depletion and improved metatranscriptomic analysis of human microbiomes | BMC Microbiology
Cho I, Blaser MJ. The human microbiome: at the interface of health and disease. Nat Rev Genet. 2012;13:260–70. Article CAS PubMed PubMed Central Google Scholar Gilbert JA, Blaser MJ, Caporaso JG, Jansson JK, Lynch SV, Knight R. Current understanding of the human microbiome. Nat Med. 2018;24:392 NIH Public Access. Article …
Accepted bbmap 39.03+dfsg-1 (source) into unstable
—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Thu, 19 Oct 2023 22:23:06 +0200 Source: bbmap Architecture: source Version: 39.03+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Pierre Gruet <p…@debian.org> Changes: bbmap (39.03+dfsg-1) unstable; urgency=medium . * Team upload * Fixing some syntax issues linked…
Common loss of far-red light photoacclimation in cyanobacteria from hot and cold deserts: a case study in the Chroococcidiopsidales
Quesada A, Vincent WF. Strategies of adaptation by antarctic cyanobacteria to ultraviolet radiation. Eur J Phycol. 1997;32:335–42. Article Google Scholar Genuário DB, Corrêa DM, Komárek J, Fiore MF. Characterization of freshwater benthic biofilm-forming Hydrocoryne (Cyanobacteria) isolates from Antarctica. J Phycol. 2013;49:1142–53. Article PubMed Google Scholar Makhalanyane TP, Valverde A, Gunnigle…
Aligner with statistics included?
Aligner with statistics included? 1 Hello, Is there a long range aligner that could make a statistics outlook listing how many SNP, indels etc are observed in the alignment itself? Thank you aligner alignment • 203 views BBTools’ callvariants.sh calls variants only from the alignments. So: callvariants.sh in=nxyxx.bam ref=ref.fa yields:…
checkstrand tool (from BBMap suite) question
checkstrand tool (from BBMap suite) question 0 Brian Bushnell : I was looking at checkstrand.sh application included in the latest version of BBMap. While running a test analysis using a human sample I noticed that the output for the tool was identical in following two scenarios using a single end…
Globally distributed Myxococcota with photosynthesis gene clusters illuminate the origin and evolution of a potentially chimeric lifestyle
Falkowski P. G., Raven J. A. Aquatic Photosynthesis (Princeton Univ. Press, 2013). Sanchez-Baracaldo, P., Bianchini, G., Wilson, J. D. & Knoll, A. H. Cyanobacteria and biogeochemical cycles through earth history. Trends Microbiol. 30, 143–157 (2022). Article CAS PubMed Google Scholar Blankenship, R. E. Early evolution of photosynthesis. Plant Physiol. 154,…
How to trim bases with bbduk.sh
How to trim bases with bbduk.sh 1 Hi, I am using BBMAP following command to trim adapter sequences from the fastq files. bbduk.sh -Xmx1g \ in1=1_R1_001.fastq.gz \ in2=1_R2_001.fastq.gz \ out1=1_R1_001-trimmed.fastq.gz \ out2=1_R2_001-trimmed.fastq.gz \ literal=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ qtrim=rl \ trimq=20 \ ktrim=r \ k=16 \ filterpolyg=5 \ tbo tpe Can anyone let…
MetaCC allows scalable and integrative analyses of both long-read and short-read metagenomic Hi-C data
Real metaHi-C datasets In this study, we leveraged several publicly available metagenomic Hi-C datasets, consisting of two short-read metaHi-C datasets and two long-read metaHi-C datasets. The specific sizes of raw datasets were shown in Supplementary Table 6. Two short-read metaHi-C datasets were generated from different microbial ecosystems, including human gut (BioProject:…
Average Coverage after Assembly (Spades)
Average Coverage after Assembly (Spades) 1 Hi, I would like to know to average coverage of my assemblies (gotten by spades). I ran bbmap to mapping my reads (the same ones I used to make the assembly) to the assembly. But I am not really sure that is the way…
Integrating chromatin conformation information in a self-supervised learning model improves metagenome binning [PeerJ]
Introduction The rapid proliferation of high-throughput sequencing in metagenomics, combined with the advancement of scalable computational tools, has allowed scientists to digitally isolate tens of thousands of microbial genomes from large collections of metagenomic datasets (Nayfach et al., 2021). Although these genomes are only the tip of the iceberg of…
A subset of viruses thrives following microbial resuscitation during rewetting of a seasonally dry California grassland soil
Field sample collection Topsoil samples (0–15 cm, roughly 0.5 m3) from replicate field plots were collected from the Hopland Research and Extension Center (HREC) in Northern California, which is unceded land of the Shóqowa and Hopland People, on August 28th, 2018 after experiencing mean annual precipitation during the rainy season, see our…
Quantify the number of sequences in common paired-end sequencing data
Quantify the number of sequences in common paired-end sequencing data 1 Hello, I have two fastq files with the forward(Read1) and reverse(Read2) paired reads. How could I count the number of sequences in common between Read1.fastq and Read2.fastq files? (I mean, since they have the same SeqID) And, how could…
Phage-microbe dynamics after sterile faecal filtrate transplantation in individuals with metabolic syndrome: a double-blind, randomised, placebo-controlled clinical trial assessing efficacy and safety
Study design We set up a prospective, double-blinded, randomised, placebo-controlled intervention study that was performed in our academic hospital, the Amsterdam University Medical Centres location AMC in the Netherlands. After passing screening, 24 subjects with MetSyn were randomised to receive a sterile FFT from a lean healthy donor or a…
Demultiplexing based on dual indices in headers while allowing 1 mismatch to each index
Demultiplexing based on dual indices in headers while allowing 1 mismatch to each index 1 Hey all, I am looking for a tool that will help me demultiplexe my Novaseq samples by two dual indices in the headers. Since I have designed my indices such that the minimum hamming distance…
Genome-wide DNA methylation patterns in bumble bee (Bombus vosnesenskii) populations from spatial-environmental range extremes
Orr, H. A. The genetic theory of adaptation: A brief history. Nat. Rev. Genet. 6, 119–127 (2005). Article CAS PubMed Google Scholar Dillon, M. E. & Lozier, J. D. Adaptation to the abiotic environment in insects: the influence of variability on ecophysiology and evolutionary genomics. Curr. Opin. Insect Sci. 36,…
How to install bbmap on Ubuntu 20.04 (Focal Fossa)?
Quick installation of bbmap Architecture: all Version: 38.79+dfsg-1: Step 1: Update system: sudo apt-get update Step 2: Install: bbmap Architecture: all Version: 38.79+dfsg-1 Ater updaing the OS run following command to install the packae: sudo apt-get install bbmap Architecture: all Version: 38.79+dfsg-1 Package Details Package: bbmap Architecture: all Version: 38.79+dfsg-1 Version: 38.79+dfsg-1 Maintainer: Ubuntu Developers Home page: sourceforge.net/projects/bbmap/…
BAM file read stats (A/T/C/G/ins/del) for each base position
BAM file read stats (A/T/C/G/ins/del) for each base position 2 Hi all, I have a bunch of Oxford Nanopore reads with a reference fasta. Wondering if anyone knows of any software / packages that would create some kind of csv or txt file that takes each base position in the…
Insert size is so small, good or bad?
Insert size is so small, good or bad? 1 If you have the average insert size is ~158 estimated using BBMap . While the read length from the fastq file is 150. so we paired reads length (2*150) This means the paired end reads overlap by too much. Is this…
How to calculate GC content of reads that mapped to a specific gene?
How to calculate GC content of reads that mapped to a specific gene? 1 Hello, I aligned my data with STAR and I have the BAM files. I would like to calculate the GC content of reads that mapped to a specific gene. I have found this thread Gc Content…
phylogeny – Variation in 16S rRNA between assemblers – how do I know which is real?
I have a low-diversity metagenome (~11 bins > 80% completion). Out of the bins, 3 are of interest to me. None of the lower-completion bins that can be identified are from the group of interest. So let’s call the bins of interest 1, 2 and 3. The raw reads had…
The complete sequence of a human Y chromosome
Skaletsky, H. et al. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 825–837 (2003). Article ADS CAS PubMed Google Scholar Miga, K. H. et al. Centromere reference models for human chromosomes X and Y satellite arrays. Genome Res. 24, 697–707 (2014)….
Minimum length of reads
Minimum length of reads 1 I have used a trimmer to trim my reads, based on their qualities. My raw reads were 126- 150 bp. I did not set any minimum length to filter out short reads. Hence, I have reads as small as 0-4 bps in my processed file….
Metagenomes Assembles Genomes from cultivated freshwater bacterial communities
This dataset represents 122 Metagenomes-Assembled Genomes (MAGs) that were reconstructed from 20 individual microcosms in the context of understanding microbial community assembly processes. The cultivation media consisted in Artificial Lake Water (ALW) enriched with glucose and cellobiose (See details in Le Moigne et al., 2023, Ecology). The microcosms (200 mL)…
A genome catalogue of lake bacterial diversity and its drivers at continental scale
Newton, R. J., Jones, S. E., Eiler, A., McMahon, K. D. & Bertilsson, S. A guide to the natural history of freshwater lake bacteria. Microbiol. Mol. Biol. Rev. 75, 14–49 (2011). Article CAS PubMed PubMed Central Google Scholar Pernthaler, J. Competition and niche separation of pelagic bacteria in freshwater habitats….
Decreased left heart flow in fetal lambs causes left heart hypoplasia and pro-fibrotic tissue remodeling
Coil implantation in fetal lambs We have complied with all relevant ethical regulations for animal testing. All procedures followed the Canadian Council on Animal Care guidelines and were approved by the University of Western Ontario Council on Animal Care (protocol 2010-257). Time-dated pregnant Dorset × Rideau Arcott ewes (gestational age 76 days,…
Very low average coverage obtained
Dear All, I got the viral genome assembly using metaviral spade. Since this is a relatively new genome, I don’t have any closest proper reference. So I mapped my reads back to contigs to know the coverage using bbmap and got the following output: java -ea -Xmx21819m -Xms21819m -cp /Tools/bbmap/current/…
What could be the rage for Average Coverage after Assembly
Dear all, I performed viral genome assembly using metaviral spade and I wanted to map my reads back to contigs to know the coverage. I used bbmap for this purpose and got the following output: NOTE: Deleting contents of ref/genome/1 because reference is specified and overwrite=true NOTE: Deleting contents of…
bbsplit running slow or out of memory?
bbsplit running slow or out of memory? 1 Hello, I have Illumina fastq files from some RNA-seq, ATAC-seq and WES that originated as PDX samples. I am looking to filter out contaminating mouse reads from the human reads in these datasets. I have used Xenome before but wanted to try…
bbmap split paired-end reads back into separated fastq files?
bbmap split paired-end reads back into separated fastq files? 1 Hi, I am trying to remove human reads from my metagenomic sequences (skin samples). I have used the command recommended in the bbmap documentation: bbmap.sh minid=0.95 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/path/to/hg19masked/ qtrim=rl trimq=10 untrim -ea -Xmx100g in=reads.fq outu=clean.fq…
BBDuk Guide – DOE Joint Genome Institute
“Duk” stands to Decontamination Using Kmers. BBDuk was made to combine many common data-quality-related trimming, filtering, and masking actions into an single high-performance tool. It are capable of quality-trimming or filtering, adapter-trimming, contaminant-filtering via kmer matching, sequence masking, GC-filtering, length filtering, entropy-filtering, format conversion, histogram generation, subsampling, quality-score recalibration, kmer…
Use bbmap reformat.sh to convert from paired fq files to a bam file
Use bbmap reformat.sh to convert from paired fq files to a bam file 1 As outlined here I was able to create paired-end fastq files with the help of GenoMax . Now I wonder how I can use reformat.sh from bbmap to convert this files to a valid bam file…
Use bbmap reformat.sh to convert from paired fq files to a valid abam file
Use bbmap reformat.sh to convert from paired fq files to a valid abam file 1 As outlined here I was able to create paired-end fastq files with the help of GenoMax . Now I wonder how I can use reformat.sh from bbmap to convert this files to a valid bam…
randomreads.sh only produces reads for chr1 to chr7
randomreads.sh only produces reads for chr1 to chr7 0 I used randomreads.sh from bbmap to generate reads from a fasta file generated with FastaAlternateReferenceMaker from GATK. It seems no matter which options I choose the script stops generating reads and chromosome 7 despite the fasta file contains all contigs from…
Genomic screening of 16 UK native bat species through conservationist networks uncovers coronaviruses with zoonotic potential
Sample collection Sampling kits were sent out to various bat rehabilitators in the UK, as described previously56, for the collection of faeces from bats. These faecal samples (0.02–1 g) were immediately stored in 5 ml of RNAlater solution to prevent degradation of RNA. The geographical locations and collection dates for all samples…
RCAC – Knowledge Base: Biocontainers: bbtools
bbtools Link to section ‘Introduction’ of ‘bbtools’ Introduction BBTools is a suite of fast, multithreaded bioinformatics tools designed for analysis of DNA and RNA sequence data. Docker hub: hub.docker.com/r/staphb/bbtoolsHome page: jgi.doe.gov/data-and-tools/software-tools/bbtools/ Link to section ‘Versions’ of ‘bbtools’ Versions 39.00 Link to section ‘Commands’ of ‘bbtools’ Commands Xcalcmem.sh a_sample_mt.sh addadapters.sh addssu.sh…
bbduk.sh trimmer with multiple input files
bbduk.sh trimmer with multiple input files 0 Hi all, I am using bbduk.sh and was wondering if there’s an efficient way to process multiple sets of reads with it? E.g. if you have read 1 as 4 separate files and read 2 as 4 separate files, typical mappers like bowtie2…
[Detailed Question] How to Normalize of Metagenomics Gene Abundances (with HMMs models)
Hi everyone, Me and my colleagues have been thinking about normalization for quite some time, and we have a hard time finding a consensus both within us, and within the literature, for this reason, this is going to be a long and detailed post. Talking with other researchers we feel…
Error with dada2 while running Parkinson’s Mouse Tutorial – Technical Support
Hi, everyone. I’m new to qiime2 and I have a technical issue. I have the same problem with forum.qiime2.org/t/plugin-error-from-dada2-an-error-was-encountered-while-running-dada2-in-r-return-code-255/21016 when I ran Parkinson’s Mouse Tutorial, but I noticed the problem didn’t solved in the website above.That’s my error info: Plugin error from dada2: An error was encountered while running DADA2…
Distribution and diversity of ‘Tectomicrobia’, a deep-branching uncultivated bacterial lineage harboring rich producers of bioactive metabolites
Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–69. CAS PubMed PubMed Central Google Scholar Konstantinidis K, Rosselló-Móra R, Amann R. Uncultivated microbes in need of their own taxonomy. ISME J. 2017;11:2399–406. PubMed PubMed Central Google Scholar Parks…
Pangenomics of the death cap mushroom Amanita phalloides, and of Agaricales, reveals dynamic evolution of toxin genes in an invasive range
Sakai AK, Allendorf FW, Holt JS, Lodge DM, Molofsky J, With KA, et al. The population biology of invasive species. Annu Rev Ecol Syst. 2001;32:305–32. Article Google Scholar Allendorf FW, Lundquist LL. Introduction: population biology, evolution, and control of invasive species. Conserv Biol. 2003;17:24–30. Article Google Scholar Erickson AB. The…
An unusual tandem kinase fusion protein confers leaf rust resistance in wheat
Plant material Bread wheat accessions Transfer (TA5524), WL711, TA5605, Ae. umbellulata accession TA1851 and Ae. triuncialis accession TA10438 were obtained from the Wheat Genetics Resource Center (WGRC). TcLr9 (Transfer/6*Thatcher) is a near-isogenic line carrying Lr9 from Transfer in the genetic background of the susceptible wheat line Thatcher. TcLr9 and TA5605…
BBduk reading fastq from S3 directly
BBduk reading fastq from S3 directly – Is it possibile? 0 Hello to all, I am not from Bioinf field but there is no issue for me running bbduk trimming command 🙂 I was wondering is it possibile to load paired fastq reads directly form S3 bucket? Even better, load…
BBmap params for accurate MAG relative abundance estimation?
hi folks, Recently, I’ve been working on developing molecular and computational methods to improve the accuracy of relative abundance estimation of metagenome assembled genomes (MAGs) from NGS datasets. Most of this work is focused on host-associated viral metagenomics, where quite a bit of nucleic acid manipulation and amplification is needed…
Normalizing before Metaphlan2
Normalizing before Metaphlan2 1 Hello, I am had run Metphlan2 to understand the relative abundance of some organisms in three of my samples. I have differences in the number of reads in the samples after Quality control. Do I need to normalizing the reads? Will normalizing the reads with depth…
Parallel sequencing of extrachromosomal circular DNAs and transcriptomes in single cancer cells
scEC&T sequencing A detailed, step-by-step protocol of scEC&T-seq is available on the Nature Protocol Exchange46 and is described below. The duration of the protocol is approximately 8 days per 96-well plate. Cell culture Human tumor cell lines were obtained from ATCC (CHP-212) or were provided by J. J. Molenaar (TR14; Princess…
BBduk log and stats appear to be inconsistent
BBduk log and stats appear to be inconsistent 0 Hi All, I’m using BBduk to filter out reads where there is a kmer match to a specific set of contaminant sequences. Here is an example command: bbduk.sh \ in1=${FQ1} \ in2=${FQ2} \ ref=${contaminant_fasta} \ k=21 \ hdist=1 \ stats=${OUTPUT}/${SAMPLE}_stats.txt \…
Question on removing duplicates with ATAC-Seq and ChIP-Seq
Question on removing duplicates with ATAC-Seq and ChIP-Seq 0 Hi I am new to ATAC-Seq and ChIP-Seq and I have a question on removing duplicates when it comes to paired-end ATAC-Seq and paired-end ChIP-Seq pipelines. I have seen some papers where clumpify is used in the first step to remove…
NGS demultiplexing
NGS demultiplexing 1 Hello everyone, I am working on a linkage project for Sars COV-2. I used Illumina iseq1000 for sequencing. The indexes I use for the study are designed as 10bp, but they were entered as 8bp during the operation of the device. When I demultiplex with bcl2fastq, all…
Results and lessons learned from the sbv IMPROVER metagenomics diagnostics for inflammatory bowel disease challenge
Baumgart, D. C. & Sandborn, W. J. Inflammatory bowel disease: Clinical aspects and established and evolving therapies. Lancet 369(9573), 1641–1657 (2007). Article CAS PubMed Google Scholar Baumgart, D. C. The diagnosis and treatment of Crohn’s disease and ulcerative colitis. Deutsches Aerzteblatt Online 106(8), 123–133 (2009). Google Scholar Conrad, K., Roggenbuck,…
Biogeographic patterns of biosynthetic potential and specialized metabolites in marine sediments
Martiny JBH, Bohannan BJM, Brown JH, Colwell RK, Fuhrman JA, Green JL, et al. Microbial biogeography: putting microorganisms on the map. Nat Rev Microbiol. 2006;4:102–12. Article CAS PubMed Google Scholar Hanson CA, Fuhrman JA, Horner-Devine MC, Martiny JBH. Beyond biogeographic patterns: processes shaping the microbial landscape. Nat Rev Microbiol. 2012;10:497–506….
Supported Tools – MultiQC
Tool Tool Name Description Removes adapter sequences and trims low quality bases from the 3′ end of reads. Overlapping paired-ended reads can be merged into consensus sequences and adapter sequence can be found for paired-ended data if not known. Automatic Filtering, Trimming, Error Removing and Quality Control for fastq data….
Anaerobic thiosulfate oxidation by the Roseobacter group is prevalent in marine biofilms
Novel Roseobacter strains isolated from marine biofilms We isolated and cultured bacterial strains from biofilms on natural rocks immersed in coastal waters. After preliminary analyses of 16S rRNA gene sequences generated by Sanger sequencing, more than 500 non-redundant strains were identified, including 54 distant strains affiliated with Roseobacter (hereafter referred…
Genomic insights into the coupling of a Chlorella-like microeukaryote and sulfur bacteria in the chemocline of permanently stratified Lake Cadagno
Philippi M, Kitzinger K, Berg JS, Tschitschko B, Kidane AT, Littmann S, et al. Purple sulfur bacteria fix N2 via molybdenum-nitrogenase in a low molybdenum Proterozoic ocean analogue. Nat Commun. 2021;12:4774. Article CAS PubMed PubMed Central Google Scholar Xiong Y, Guilbaud R, Peacock CL, Cox RP, Canfield DE, Krom MD,…
The persistence and stabilization of auxiliary genes in the human skin virome | Virology Journal
Breitbart M, Bonnain C, Malki K, Sawaya NA. Phage puppet masters of the marine microbial realm. Nat Microbiol. 2018;3:754–66. Article CAS PubMed Google Scholar Suttle CA. Marine viruses—major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–12. Article CAS PubMed Google Scholar Breitbart M. Marine viruses: truth or dare. Ann…
Hard clip fastq
Hard clip fastq 2 I hope this is not a silly question. I have 2x 200bp fastqs generated from MGI G400 sequencer. I would like to do a comparison with Illumina but these only come as 2x 150bp fastqs. Is it possible to hard clip the 2x 200bp fastqs down…
error bbduk
error bbduk 0 Can anyone help me, I try to run the command and it gives this error, how can I adjust? java -ea -Xmx-78m -Xms-78m -cp /home/qiime2/Documents/bbmap/current/ jgi.BBDuk in= /Home/Desktop/Documents/limpeza/S2500_1.fastq out= /Home/Desktop/Documents/limpeza/S2500_1.fastq.clean.fastq trimq=20 minlen=75 Invalid maximum heap size: -Xmx-78m Error: Could not create the Java Virtual Machine. Error: A…
Tool To Find Out If Fastq Is In Sanger Or Phred64 Encoding?
Tool To Find Out If Fastq Is In Sanger Or Phred64 Encoding? 9 Is there a simple tool I can use to quickly find out if a FASTQ file is in Sanger or Phred64 encoding? Ideally something that tells me ‘Encoding XX’ somewhere the terminal output. fastq tools • 46k…
A hydrogenotrophic Sulfurimonas is globally abundant in deep-sea oxygen-saturated hydrothermal plumes
Inagaki, F., Takai, K., Kobayashi, H., Nealson, K. H. & Horikoshi, K. Sulfurimonas autotrophica gen. nov., sp. nov., a novel sulfur-oxidizing e-proteobacterium isolated from hydrothermal sediments in the Mid-Okinawa Trough. Int. J. Syst. Evol. Microbiol. 53, 1801–1805 (2003). Article CAS PubMed Google Scholar Timmer-Ten Hoor, A. A new type of…
ATAC-seq fragment size distribution – huge spike at 150 bp
HI, I am working on some ATAC-seq data. We have performed paired-end sequencing with read length of 150 bp on a total of 24 samples (8 conditions in triplicates) To begin with, I will just briefly describe some of the main analysis steps. I have trimmed the read to remove…
Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete Mutorquevirus genome
Manzin, A., Mallus, F., Macera, L., Maggi, F. & Blois, S. Global impact of Torque teno virus infection in wild and domesticated animals. J. Infect. Dev. Countries 9, 562–570 (2015). Article CAS Google Scholar Biagini, P. et al. Family Anelloviridae. In Virus Taxonomy: Ninth Report of the International Committee on…
RNA-Seq analysis using STAR and Salmon
RNA-Seq analysis using STAR and Salmon 2 Hello! I am having some trouble figuring out how to use Salmon. I have around 30 different samples which I trimmed using bbmap then aligned them using STAR. I have all of the BAM files from this alignment. Should I merge them all…
BBMap’s repair.sh swaps sequences between input files
This is a bit of an XY problem but please go with it just for now. I have 10X scRNAseq I1, I2, R1 and R2 files. From these, I have extracted a subset of R2 reads into a subset.R2 file. I’ve also used filterbyname.sh to extract the same named subset…
BBMap/sh/repair.sh not finding pairs
BBMap/sh/repair.sh not finding pairs 0 Hi, I am a beginner bioinformatician, I have paired-end fastq.gz files (file1 for R1 and file2 for R2) from illumina. I want to use these files for downstream analysis but I cannot because they don’t have the same number of reads. (the difference between read…
How To Install bbmap on Ubuntu 20.04
In this tutorial we learn how to install bbmap on Ubuntu 20.04. bbmap is short read aligner and other bioinformatic tools b5833726e45421cf74f3885c83040a6f Introduction In this tutorial we learn how to install bbmap on Ubuntu 20.04. What is bbmap bbmap is: BBMap: Short read aligner for DNA and RNA-seq data. Capable…
rRNA decontamination of RNA-Seq reads (tool choice, introns etc)
Greetings! I need some help with performing my rRNA decontamination step properly, which is part of pre-processing pipeline for my Illumina RNA-Seq reads, before mapping to the reference genome (a plant species). SOME RELEVANT LINKS AND MY CRUDE INFERENCES: Download Rrna Sequences – SILVA database is useful for human research,…
Question about RNA-Seq data alignment
Question about RNA-Seq data alignment 3 Hi, I have a question about genome alignment. I am working with RNA-Seq dataset to study the impact of Liquid Culture in response to virus of different doses in Human. I was exploring what could be the good strategy or best in practice method…
Mapping with bbmap.sh
Mapping with bbmap.sh 1 Hello everyone Todat I’m trying to do a mapping with bbmap but I have a problem because in the results I have NaN% in everything, this is normal? I’m using Ictalurus punctatus genome reference but my sample is pimelodus grosskopfii. In the picture you can see…
calctruequality in bbmap
calctruequality in bbmap 1 I’m trying to recalibrate Q scores of a NextSeq run using MiSeq contigs assembled with Tadpole. The commands I used to map the reads to the reference were as follows: bbmap.sh in=concatABC.fastq.gz outm=mapped.sam ref=./Lpe09_06TdpAssemblies/contigs09_06.fa ignorequality maxindel=100 minratio=0.4 ambig=toss qahist=qahist_raw.txt qhist=qhist_raw.txt mhist=mhist_raw.txt The command I used to…
command line – how to change name of multiple files at the same time
command line – how to change name of multiple files at the same time 2 Hi everyone, in a directory, I have several files named something like: Ricxxx_genomic.fna_0.97_bbmap_stats.txt Ricxxx_genomic.fna_0.97_bs.sh Ricxxx_genomic.fna_0.97_mapped.sam Ricxxx_genomic.fna_0.97_mapped_sorted.bam Ricxxx_genomic.fna_0.97_mapped_sorted.bam.bai and i would like to change their names to: p100e_Ricxxx_genomic.fna_0.97_bbmap_stats.txt p100e_Ricxxx_genomic.fna_0.97_bs.sh p100e_Ricxxx_genomic.fna_0.97_mapped.sam p100e_Ricxxx_genomic.fna_0.97_mapped_sorted.bam p100e_Ricxxx_genomic.fna_0.97_mapped_sorted.bam.bai What command line can…
nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs | BMC Bioinformatics
Sanger HL, Klotz G, Riesner D, Gross HJ, Kleinschmidt AK. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci. 1976;73(11):3852–6. doi.org/10.1073/pnas.73.11.3852. Article CAS Google Scholar Arnberg AC, Van Ommen G-JB, Grivell LA, Van Bruggen EFJ, Borst P. Some yeast mitochondrial RNAs…
new module: bbmap/filterbyname – PullAnswer
new module: bbmap/filterbyname – PullAnswer Is there an existing module for this? [X] I have searched for the existing module Is there an open PR for this? [X] I have searched for existing PRs Is there an open issue for this? [X] I have searched for existing issues Are you…
BBmap bbduk.sh for filtering reads
I’m looking to filter reads that contain a stretch of A’s, I found these posts looking for polyA tails, meaning this should work all the same (Identify RNA-seq reads containing polyA sequence, Identifying RNA-seq reads containing polyA stretch). However, I cannot get it to work. Given just these two reads,…
Genetic characterization of two G8P[8] rotavirus strains isolated in Guangzhou, China, in 2020/21: evidence of genome reassortment | BMC Infectious Diseases
Mokomane M, Kasvosve I, Melo Ed, Pernica JM, Goldfarb DM. The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. Ther Adv Infect Dis. 2018;5(1):29–43. PubMed Google Scholar Organization WH. Rotavirus vaccines: WHO position paper–July 2021. Weekly Epidemiol Rec. 2021;96(28):301–219. Google Scholar Bucardo F, Reyes Y, Svensson…
bgzf_read_block] EOF marker is absent reformat.sh
BBMap/BBTools reformat.sh : real error or spurious message? [W::bgzf_read_block] EOF marker is absent reformat.sh 1 When subsampling paired-end .fastq.gz files using reformat.sh from BBMap/BBTools, I get this error message: [W::bgzf_read_block] EOF marker is absent reformat.sh I’ve checked the input files with gunzip -t, no error. The input files are a…
BBMap 38.90-GCC-10.2.0 (for BlueBEAR, BEARCloud VMs, and CaStLeS VMs)
BBMap 38.90-GCC-10.2.0 Unsupported: Use of this version of BBMap is not supported. More information on our Applications Support and Retention Policy. BBMap short read aligner, and other bioinformatic tools. Accessing BBMap 38.90-GCC-10.2.0 To load the module for BBMap 38.90-GCC-10.2.0 please use this command on the BEAR systems (BlueBEAR, BEARCloud VMs,…
[W::bgzf_read_block] EOF marker is absent in BBMAP
[W::bgzf_read_block] EOF marker is absent in BBMAP 0 Hello, I’m asking an issue encountered in bbmap. I was using bbmap to remove host contaminants from my microbiome data. The commands are simple as below (ref folder already generated in the last step) bbmap.sh -Xmx42g in=R1.fastq.gz in2=R2.fastq.gz outu=cleaned.interleaved.fastq.gz threads=12 overwrite=t unpigz=t…
Feature count is very low using htseq-count
Feature count is very low using htseq-count 0 Hello all, I performed bbmap on my RNA-seq paired sequence data using following cmd bbmap.sh in1=J2_R1.fastq in2=J2_R2.fastq out=output_J2.sam ref=im4.fasta nodisk The header of generated sam file is @HD VN:1.4 SO:unsorted @SQ SN:k141_1006 LN:2503 @SQ SN:k141_5512 LN:5393 @SQ SN:k141_4772 LN:4387 @SQ SN:k141_3267 LN:4531…
BBTools – BioGrids Consortium – Supported Software
AllHigh-Throughput SequencingGenomicsProteomicsVisualizationOther BBTools Description a suite of fast, multithreaded bioinformatics tools designed for analysis of DNA and RNA sequence data. BBTools can handle common sequencing file formats such as fastq, fasta, sam, scarf, fasta+qual, compressed or raw, with autodetection of quality encoding and interleaving. Installation Use the following command to…
Role of mobile genetic elements in the global dissemination of the carbapenem resistance gene blaNDM
Wu, W. et al. NDM metallo-β-lactamases and their bacterial producers in health care settings. Clin. Microbiol. Rev. 32, e00115–18 (2019). Yong, D. et al. Characterization of a new metallo-β-lactamase gene, bla NDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14…
nf-core/circrna
circRNA quantification, differential expression analysis and miRNA target prediction of RNA-Seq data Introduction nf-core/circrna is a best-practice analysis pipeline for the quantification, miRNA target prediction and differential expression analysis of circular RNAs in paired-end RNA sequencing data. The pipeline is built using Nextflow, a workflow tool to run tasks across…
Butterfly eyespots evolved via cooption of an ancestral gene-regulatory network that also patterns antennae, legs, and wings
Although the hypothesis of gene-regulatory network (GRN) cooption is a plausible model to explain the origin of morphological novelties (1), there has been limited empirical evidence to show that this mechanism led to the origin of any novel trait. Several hypotheses have been proposed for the origin of butterfly eyespots,…
Mapping to multiple references using bbmap
So my question comes in two parts: First of all is what I’m trying to do within reason given the tools I am using? I am investigating the shuffling effects of a recombinase on a known reporter sequence which subsequently generates libraries of unique sequences. By simulating all of the…
Time-course RNASeq of Camponotus floridanus forager and nurse ant brains indicate links between plasticity in the biological clock and behavioral division of labor | BMC Genomics
1. Sharma VK. Adaptive significance of circadian clocks. Chronobiol Int. 2003;20(6):901–19. PubMed Google Scholar 2. Paranjpe DA, Sharma VK. Evolution of temporal order in living organisms. J Circadian Rhythms. 2005;3(1):7. PubMed PubMed Central Google Scholar 3. Yerushalmi S, Green RM. Evidence for the adaptive significance of circadian rhythms. Ecol Lett….
Any alternatives to BBMap’s clumpify.sh program to optimize gzip compression?
Any alternatives to BBMap’s clumpify.sh program to optimize gzip compression? 1 I’ve had some difficulties implementing this in pipelines because it randomly fails sometimes. Are there any other programs that can be used in its stead? fastq genomics rnaseq • 201 views • link updated 7 hours ago by GenoMax…
Secret BBMAP helper page – HRGV/Marmics_Metagenomics Wiki
#How to map to the assembled scaffolds.fasta bbmap is a powerful and highly flexible read mapper jgi.doe.gov/data-and-tools/bbtools/bb-tools-user-guide/bbmap-guide/. For the upcoming analysis you are not interested in the typical mapping output but in statistics on the coverage on every scaffold, you can get them with scaffstats. We want to be specific…