Tag: BED

TDF to bed graph — IGV on command line

TDF to bed graph — IGV on command line 0 Hi all, I’m trying to convert some TDF files to bedgraph files so that I can do a genomic leftover on them (as far as I can tell, I can’t lift over TDF files). This google group answer here (groups.google.com/g/igv-help/c/RcZw5YB5SOQ)…

Continue Reading TDF to bed graph — IGV on command line

Genome Bioinformatics Analyst at UPMC

Description The Genome Bioinformatics Analyst works independently to curate disease, gene and variant knowledge including variant interpretation, reporting and consultation with laboratory staff, physicians and genetic counselors. The analyst participates in clinical test development, validation and maintenance of data analysis pipelines, monitoring of quality metrics and the analysis of large…

Continue Reading Genome Bioinformatics Analyst at UPMC

Acquisition of antibodies to Plasmodium falciparum and Plasmodium vivax antigens in pregnant women living in a low malaria transmission area of Brazil | Malaria Journal

WHO. World Malaria Report. Geneva: World Health Organization; 2019. Google Scholar  Rogerson SJ, Hviid L, Duffy PE, Leke RF, Taylor DW. Malaria in pregnancy: pathogenesis and immunity. Lancet Infect Dis. 2007;7:105–17. Article  CAS  PubMed  Google Scholar  Salanti A, Dahlback M, Turner L, Nielsen MA, Barfod L, Magistrado P, et al….

Continue Reading Acquisition of antibodies to Plasmodium falciparum and Plasmodium vivax antigens in pregnant women living in a low malaria transmission area of Brazil | Malaria Journal

Where to find vcf of dbsnp build 144 ?

Where to find vcf of dbsnp build 144 ? 0 Hi everyone, I have zipped vcf files that I would like to annotate using hg19 bsnp144. I have bed files for each chromosome but, based on other biostar answers (How to add rsIDs to VCF?), it seems it is easier…

Continue Reading Where to find vcf of dbsnp build 144 ?

IMUNON, INC. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS. (form 10-Q)

The following discussion and analysis of our financial condition and results of operations This discussion contains forward-looking statements that involve risks and uncertainties. Our actual results may differ materially from those discussed in forward-looking statements. Factors that might cause a difference include, but are not limited to, those discussed above…

Continue Reading IMUNON, INC. MANAGEMENT’S DISCUSSION AND ANALYSIS OF FINANCIAL CONDITION AND RESULTS OF OPERATIONS. (form 10-Q)

Converting Bam file to Fasta (Zipped)

Converting Bam file to Fasta (Zipped) 0 I would like to convert .bam files to fq.gz (zipped fasta files) for paired reads. bedtools bamtofastq seems to be a commonly recommended method, I have also seen samtools fastq as a possible alternative. bedtools bamtofastq -i inputfile.bam -fq outputR1.fq -fq2 outputR2.fq samtools…

Continue Reading Converting Bam file to Fasta (Zipped)

Bedtools Merge -s strandedness option

Bedtools Merge -s strandedness option 0 Hello, I am trying to combine features using bedtools merge. I have been using the -s option to enforce strandedness when combining the features. I’d like the final file to be a BED5 file so following coordinates I’d like to print the mean score,…

Continue Reading Bedtools Merge -s strandedness option

Changes in ped and map files in PLINK

Changes in ped and map files in PLINK 1 Hello all, I want to do QC with Plink but I want to have the changes of QC in my ped and map files after QC. I used the items below but received .bim, .fam, and .bed files. My ped and…

Continue Reading Changes in ped and map files in PLINK

Bedtools Bam To Bed With Code Examples

Bedtools Bam To Bed With Code Examples With this article, we’ll look at some examples of how to address the Bedtools Bam To Bed problem . bedtools bamtobed [OPTIONS] -i <BAM> As we have seen, a large number of examples were utilised in order to solve the Bedtools Bam To…

Continue Reading Bedtools Bam To Bed With Code Examples

As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html

NAME SYNOPSIS DESCRIPTION EXAMPLES BASIC OPTIONS SITE FILTERING OPTIONS INDIVIDUAL FILTERING OPTIONS GENOTYPE FILTERING OPTIONS OUTPUT OPTIONS COMPARISON OPTIONS AUTHOR NAME VCFtools v0.1.12a − Utilities for the variant call format (VCF) and binary variant call format (BCF) SYNOPSIS vcftools [ –vcf FILE | –gzvcf FILE | –bcf FILE]…

Continue Reading As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html

Job – Principal Biostistician/Bioinformatics job at Kenya Medical Research

Vacancy title: Principal Biostistician/Bioinformatics [ Type: FULL TIME , Industry: Research , Category: Research ] Jobs at: Kenya Medical Research – KEMRI Deadline of this Job: 06 October 2022   Duty Station: Within Kenya , Kisumu , East Africa SummaryDate Posted: Tuesday, September 20, 2022 , Base Salary: Not Disclosed…

Continue Reading Job – Principal Biostistician/Bioinformatics job at Kenya Medical Research

Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals

Screening of efficient mCherry-binding protein (MBP) pairs to design Cre recombinase dependent on RFPs First, we aimed to construct Cre recombinase dependent on RFPs based on the reported tool named Cre-DOG30. In this system, N-terminal and C-terminal split Cre recombinase fragments are fused with specific nanobodies for target proteins, and…

Continue Reading Nanobody-based RFP-dependent Cre recombinase for selective anterograde tracing in RFP-expressing transgenic animals

[SOLVED] Special .bed to .fa conversion (GenomicCoordinates/DNAsequence) ~ Linux Fixes

My aim is to create a custom protein sequence reference file (protein.fa) from genomic coordinates (origin.bed). (origin.bed; with Chromosome, start, end, TranscriptID, strand, GeneID) chr1 109202569 109202584 ENST00000370031.1_uORF_0 – ENSG00000162639.11 chr1 109203584 109203617 ENST00000370031.1_uORF_0 – ENSG00000162639.11 chr11 102188276 102188302 ENST00000263464.3_uORF_0 + ENSG00000023445.9 chr11 10830291 10830306 ENST00000530211.1_uORF_1 – ENSG00000110321.11 chr11 10830400…

Continue Reading [SOLVED] Special .bed to .fa conversion (GenomicCoordinates/DNAsequence) ~ Linux Fixes

How to rename first column of bedgraph file based on another reference table?

How to rename first column of bedgraph file based on another reference table? 1 I have a bedgraph file that looks like this: chr1 0 35 0 chr1 35 56 0.18636 chr3 56 73 0.37273 chr3 73 123 0.55909 chr4 123 142 0.37273 chr4 142 144 0.55909 chr5 144 161…

Continue Reading How to rename first column of bedgraph file based on another reference table?

Bioinformatics Scientist in Pittsburgh, PA

Description Purpose:The scientist works independently using a robust math toolbox to discover solutions for a diverse portfolio of interesting and challenging problems. The scientist develops, implements, and monitors advanced analytic, medical informatics, and predictive modeling tools for health care programs at the UPMC. The scientist normally works Monday through Friday…

Continue Reading Bioinformatics Scientist in Pittsburgh, PA

Updating hg 18 .bim file with lifted .map and .bed file

Updating hg 18 .bim file with lifted .map and .bed file 0 Hello, I am trying to update rsids in an hg18 .bim file with an hg38.bed and hg38.map file. I’ve tried the following: system(“./plink –file plink_hg38 –make-just-bim –out newBim –allow-extra-chr”) but got the error: Error: Failed to open plink_hg38.ped….

Continue Reading Updating hg 18 .bim file with lifted .map and .bed file

The genus Serratia revisited by genomics

Merlino, C. P. Bartolomeo Bizio’s letter to the most eminent priest, Angelo Bellani, concerning the phenomenon of the red-colored polenta [translated from the Italian]. J. Bacteriol. 9, 527–543 (1924). Grimont, P. A. D. & Dulong de Rosnay, H. L. C. Numerical study of 60 strains of Serratia. J. Gen. Microbiol….

Continue Reading The genus Serratia revisited by genomics

Using a phenotype file with several phenotype columns- PLINK2

Using a phenotype file with several phenotype columns- PLINK2 1 Hi all, I have created a tsv file ( phenotypes.tsv ) that includes phenotypes that I am using for a plink command with the –phenom flag. The first column is the #IID col with sample names that match the names…

Continue Reading Using a phenotype file with several phenotype columns- PLINK2

mapping – STAR error in snakemake pipeline: “EXITING because of FATAL ERROR: could not open genome file”

I’m trying to use a 2 pass STAR mapping strategy (also explained here informatics.fas.harvard.edu/rsem-example-on-odyssey.html), but I’m getting an error. I’ve read through this page [https://github.com/alexdobin/STAR/issues/181] and I have a similar issue, but the discussed solutions don’t seem to help. Perhaps this is more a snakemake issue rather than a STAR…

Continue Reading mapping – STAR error in snakemake pipeline: “EXITING because of FATAL ERROR: could not open genome file”

Genomic architecture of adaptive radiation and hybridization in Alpine whitefish

Sampling the radiation To understand the phylogenetic relationships between Alpine whitefish, we carried out whole-genome resequencing on 96 previously collected whitefish (with associated phenotypic measurements including standard length and gill-raker counts; collected in accordance with permits issued by the cantons of Zurich (ZH128/15), Bern (BE68/15), and Lucerne (LU04/14); these fish…

Continue Reading Genomic architecture of adaptive radiation and hybridization in Alpine whitefish

Freebayes-parallel with large bam file – individual threads running for >6 days

Context: I’m trying to call variants on a sequencing project using pooled genotyping-by-sequencing. Pools consist of 94 samples each, alongside a number of individuals. Sequence data was demultiplexed and then aligned to a reference genome using hisat2, and the resultant bams were merged with samtools merge. The problem bam is…

Continue Reading Freebayes-parallel with large bam file – individual threads running for >6 days

Samtools Htslib Issues

Issue Title State Comments Created Date Updated Date How to get a specific chromosome open 1 2022-07-14 2022-07-18 tabix returns row from VCF file multiple times open 4 2022-07-11 2022-07-18 Modified base parsing failure failure closed 0 2022-07-01 2022-07-18 extract genotype information open 1 2022-06-24 2022-07-18 sam_hdr_remove_lines is inefficient if…

Continue Reading Samtools Htslib Issues

Researchers Suspect New Variants of Rapidly-Progressing Brain Degenerating Diseases from COVID-19 Vaccines

Things have not been the same since June 2021 for 53-year-old Douglas Howey from Colorado. Around a year after he received the second dose of the Moderna COVID-19 vaccine, the 6 foot 4 and a half inch paraplegic man who once weighed 262 pounds lost over 100 pounds after the…

Continue Reading Researchers Suspect New Variants of Rapidly-Progressing Brain Degenerating Diseases from COVID-19 Vaccines

The necessity of ultrapure water in cell culture

Sponsored Content by SartoriusJun 30 2022Reviewed by Alex Smith When experimenting with cell cultures, contaminants in water can come in a number of different types, such as yeasts, molds or bacteria. Typically, these contaminants can be observed using optical microscopy or by the eye. Contamination from alternative biological agents or…

Continue Reading The necessity of ultrapure water in cell culture

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Beam Therapeutics Stock: A Leader in Gene Editing Tech?

Don’t invest in stories. Don’t invest in a company before they have meaningful revenues. Don’t invest in drug developers that have a great deal of regulatory risk. These are all rules we need to break if we want exposure to a technology that allows mankind to start playing with the…

Continue Reading Beam Therapeutics Stock: A Leader in Gene Editing Tech?

Genome-wide association study of musical beat synchronization demonstrates high polygenicity

Savage, P. E., Brown, S., Sakai, E. & Currie, T. E. Statistical universals reveal the structures and functions of human music. Proc. Natl Acad. Sci. USA 112, 8987–8992 (2015). CAS  PubMed  PubMed Central  Article  Google Scholar  Ravignani, A., Delgado, T. & Kirby, S. Musical evolution in the lab exhibits rhythmic…

Continue Reading Genome-wide association study of musical beat synchronization demonstrates high polygenicity

SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Clapier, C. R., Iwasa, J., Cairns, B. R. & Peterson, C. L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 18, 407–422 (2017). CAS  PubMed  PubMed Central  Article  Google Scholar  Mashtalir, N. et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes….

Continue Reading SMARCE1 deficiency generates a targetable mSWI/SNF dependency in clear cell meningioma

Genome hg19**not found in homer config

I want to use the Homer to do annotation. After I input “annotatePeaks.pl 31512_TH0_D0.bed hg19 > 31512_TH0_D0.ann.txt” , it shows “!!!!Genome hg19 not found in /home/jenny/NGStools/homer/.//config.txt” I used the command “perl /home/jenny/NGStools/homer/configureHomer.pl -install hg19” to install it, and I am sure I installed the hg19 for the homer Then input…

Continue Reading Genome hg19**not found in homer config

a strange pattern of repetitive summits

Problem with the output of Deeptools PlotProfile: a strange pattern of repetitive summits 0 Hi! I am trying to plot DNA binding profiles of my ChIP-seq bw files using Deeptools plotProfile. I generated the matrix using the computeMatrix reference-point. I used some publicly available bed files as my regions of…

Continue Reading a strange pattern of repetitive summits

Standard for aligning smallRNA to a reference human rRNA?

Standard for aligning smallRNA to a reference human rRNA? 0 Hi, I need to label some smallRNA sequences that I know are rRNA fragments. I know that for mRNA these are discarded by aligning to the human genome and filtering out multimapped reads, but I need to try to pin…

Continue Reading Standard for aligning smallRNA to a reference human rRNA?

Bcftools equivalent of vcftools conversion to ped & map

Bcftools equivalent of vcftools conversion to ped & map 1 I am converting a VCF to ped & map thus in vcftools vcftools –gzvcf ZZZZZTYT.vcf.gz –plink –out ZZZZZTYT which works fine. However, I have been searching and searching, can bcftools do the same with a bcf? bcftools • 103 views…

Continue Reading Bcftools equivalent of vcftools conversion to ped & map

bedtools interset doesn’t return a VCF file?

bedtools interset doesn’t return a VCF file? 1 I am filtering a VCF file with a bed file using Bedtools. I have carried out this successfully with bedtools intersect -wb -a myVCF.vcf -b myBEDfile.bed > output.txt However, what I want is to get a VCF file with the metadata and…

Continue Reading bedtools interset doesn’t return a VCF file?

Why so much variability in RNA-seq technical replicates?

Why so much variability in RNA-seq technical replicates? 1 Hi all, I download an RNA seq data for gene expression analysis from NCBI. When I did counts with bedtools for my gene of interest, the variability was too much. Does that mean this data is unreliable? What could have caused…

Continue Reading Why so much variability in RNA-seq technical replicates?

Extact SNPs ID’s and their Values with IID, Additive and dominance components

Extact SNPs ID’s and their Values with IID, Additive and dominance components 0 I’m dealing with GWAS data and I have 2M records of the .bed file, I’m New to P-link, Can anyone please help me with the Plink command which can Extract all SNPs Id’s and their Values with…

Continue Reading Extact SNPs ID’s and their Values with IID, Additive and dominance components

Calculate scores using certain method by comparing a bedGraph file from treatment and a file from control representing local bias

bdgcmp(1) Calculate scores using certain method by comparing a bedGraph file from treatment and a file from control representing local bias SYNOPSIS bdgcmp <-t TREATMENT.BEDGRAPH> <-c CONTROL.BEDGRAPH> <-o OUTPUT.BEDGRAPH> [-m METHOD] DESCRIPTION Calculate scores using certain method by comparing a bedGraph file from treatment and a file from control representing…

Continue Reading Calculate scores using certain method by comparing a bedGraph file from treatment and a file from control representing local bias

Building custom hg38 – alt contigs

I am exploring modifications of hg38 like these: github.com/mebbert/Dark_and_Camouflaged_genes Starting from the regular bcbio hg38 data installation Masking hg38.fa using bedtools maskfasta Generating indexes using bcbio_setup_genome.py for seq and bwa as described in the manual The bwa directory then contains ├── bwa │   ├── hg38_masked.fa.amb │   ├── hg38_masked.fa.ann │   ├──…

Continue Reading Building custom hg38 – alt contigs

Keep IUC Galaxy bedtools tool wrappers in sync with the command line bedtools releases

For example, as of the time of the writing, IUC Galaxy bedtools still uses only the command line options available in the release v2.28.0 (Mar 23, 2019): github.com/galaxyproject/tools-iuc/commit/2962180c31dea5883b2ee529fe26b51c4dbc4d36 But the main (this) bedtools repo has already the release v2.29.2 (Dec 17, 2019): github.com/arq5x/bedtools2/releases/tag/v2.29.2 IUC Galaxy bedtools are widely used. It…

Continue Reading Keep IUC Galaxy bedtools tool wrappers in sync with the command line bedtools releases

Voxel Printing Anatomy: Design and Fabrication of Realistic, Presurgical Planning Models through Bitmap Printing

This method demonstrates a voxel-based 3D printing workflow, which prints directly from medical images with exact spatial fidelity and spatial/contrast resolution. This enables the precise, graduated control of material distributions through morphologically complex, graduated materials correlated to radiodensity without loss or alteration of data. Bitmap printing allows for the direct…

Continue Reading Voxel Printing Anatomy: Design and Fabrication of Realistic, Presurgical Planning Models through Bitmap Printing

deeptools plotHeatMap – Convert bed files to gene list?

I might suggest limiting your search to genes: gtf2bed < Mus_musculus.GRCm38.102.gtf | grep -w “gene” > sorted-mm10.genes.bed But that’s up to you. Otherwise, I think you may also get transcripts/exons, which may be more than you want. Again, up to you. If hnf4a-ko-downreg-clusters.bed is the file containing peaks, as described…

Continue Reading deeptools plotHeatMap – Convert bed files to gene list?

Convert bedGraph to Homer tag directory?

Convert bedGraph to Homer tag directory? 0 Hi, I am new to ChIP-seq analysis. When taking published data in .bedGraph format (generated by Homer), is there any way to convert back to Homer tag directory? (other than aligning from the raw .fasta). I suppose extracting columns into .bed format and…

Continue Reading Convert bedGraph to Homer tag directory?

Merge only bim files with plink

Merge only bim files with plink 0 Hello For the same dataset they provide a single BED and FAM files for all the chromosomes. However, the BIM files are split in chromosomes. I would like to generate the VCF file with the genotyping calls of all chromosomes but I need…

Continue Reading Merge only bim files with plink

Measurement of Protein Import Capacity of Skeletal Muscle Mitochondria

Mitochondria are key metabolic organelles that exhibit a high level of phenotypic plasticity in skeletal muscle. The import of proteins from the cytosol is a critical pathway for organelle biogenesis, essential for the expansion of the reticulum and the maintenance of mitochondrial function. Therefore, protein import serves as a barometer…

Continue Reading Measurement of Protein Import Capacity of Skeletal Muscle Mitochondria

A genome-scale screen for synthetic drivers of T cell proliferation

Abramson, J. S. et al. Transcend NHL 001: immunotherapy with the CD19-directed CAR T-cell product JCAR017 results in high complete response rates in relapsed or refractory B-cell non-Hodgkin lymphoma. Blood 128, 4192–4192 (2016). Google Scholar  Shifrut, E. et al. Genome-wide CRISPR screens in primary human T cells reveal key regulators…

Continue Reading A genome-scale screen for synthetic drivers of T cell proliferation

Elite sleepers: are you one of the people genetically programmed to need less sleep? | Sleep

Name: Elite sleepers. Age: As old as humanity. Appearance: Currently even smugger than usual. Oh God, what now? This is a time for wild celebration! Science has just proved that so-called “elite sleepers” are less likely to develop dementia. I’m an elite sleeper, in that I never get out of…

Continue Reading Elite sleepers: are you one of the people genetically programmed to need less sleep? | Sleep

Ubuntu Manpage: sambamba-view – tool for extracting information from SAM/BAM files

Provided by: sambamba_0.8.2+dfsg-2_amd64 NAME sambamba-view – tool for extracting information from SAM/BAM files SYNOPSIS sambamba view OPTIONS <input.bam | input.sam> [region1 […]] DESCRIPTION sambamba view allows to efficiently filter SAM/BAM files for alignments satisfying various conditions, as well as access its SAM header and information about reference sequences. In order…

Continue Reading Ubuntu Manpage: sambamba-view – tool for extracting information from SAM/BAM files

bedtools -u not giving unique files

bedtools -u not giving unique files 1 The following are the steps Im following: First step to extract sample using bed file is this (here the bedfile is input bedfile converted to Hg38): tabix -h -R Hg19_to_Hg38_sorted.bed.gz gnomad.genomes.v{g_version}.hgdp_tgp.chr{chr}.vcf.bgz | perl {vcftools} -c {sample_name} > {sample_name}_out.vcf’ output({sample_name}_out.vcf’) chr2 113982416 rs56177103 TATAAAATAAAATAAA…

Continue Reading bedtools -u not giving unique files

Does anyone know how to get the headers for a bam.tdf file converted to a bedgraph file?

Does anyone know how to get the headers for a bam.tdf file converted to a bedgraph file? 0 I followed this thread: Conversion from tdf to bed format Converted like this: igvtools tdftobedgraph file.tdf file.bedgraph Now I have a bedgraph without headers but I have no idea what the last…

Continue Reading Does anyone know how to get the headers for a bam.tdf file converted to a bedgraph file?

bam – Detect mutation context in a read of a sam file

That kind of custom fiddling with reads and variants is very cumbersome, non-standard and also error-prone. Do a standard variant callign pipeline and then filter for the mutations that you want. Then extract the variant position (so the coordinates) and get the variant context from the reference genome. Using individual…

Continue Reading bam – Detect mutation context in a read of a sam file

split gtex genotype data by chromosomes.

Hello, I used and edited the command line to use –vcf to import vcf file. I used these commands: for chr in $(seq 1 22); do      plink –vcf /dbGAP/GTEx_Analysis_2017-06-05_v8_WholeExomeSeq_979Indiv_VEP_annot.vcf.gz            –chr $chr            –recode            –out…

Continue Reading split gtex genotype data by chromosomes.

Prediction of histone post-translational modification patterns based on nascent transcription data

Allfrey, V. G., Faulkner, R. & Mirsky, A. E. Acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. Proc. Natl Acad. Sci. USA 51, 786–794 (1964). CAS  PubMed  PubMed Central  Google Scholar  Ho, J. W. K. et al. Comparative analysis of metazoan chromatin organization….

Continue Reading Prediction of histone post-translational modification patterns based on nascent transcription data

Understanding the number of intersection in bedtools jaccard

Understanding the number of intersection in bedtools jaccard 1 Hello, I am using bedtools jaccard to compare two vcf files, as: bedtools jaccard -a ancestors.calls.norm.snp.vcf.gz -b GC078310.calls.norm.snp.vcf.gz intersection union-intersection jaccard n_intersections 1606899 1806667 0.889427 1536700 What I do not get is why n_intersections is equal to 1536700. Especially, the difference…

Continue Reading Understanding the number of intersection in bedtools jaccard

Identification of Hub Genes Associated with COPD Through Integrated Bi

Introduction Chronic obstructive pulmonary disease (COPD) will become the third leading cause of death worldwide.1,2 The incidence of COPD worldwide is 13.1%3 and is 13.7% in the Chinese population over 40 years of age.4 Emphysema is one of the most common phenotypes.1 Over the past few decades, we have conducted…

Continue Reading Identification of Hub Genes Associated with COPD Through Integrated Bi

bedtools sample with fastq input and fewer input records than requested

I’m using bedtools sample to sample reads from fastq files. I’d like to submit two feature requests: If the number of requested records is larger than the input I get ERROR: Input file has fewer records than the requested number of output records. I guess this is intentional and not…

Continue Reading bedtools sample with fastq input and fewer input records than requested

Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

Vamosi, J. C., Magallon, S., Mayrose, I., Otto, S. P. & Sauquet, H. Macroevolutionary patterns of flowering plant speciation and extinction. Annu. Rev. Plant Biol. 69, 685–706 (2018). CAS  PubMed  Google Scholar  Rhymer, J. M. & Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27, 83–109 (1996)….

Continue Reading Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

nf-core/circrna

circRNA quantification, differential expression analysis and miRNA target prediction of RNA-Seq data Introduction nf-core/circrna is a best-practice analysis pipeline for the quantification, miRNA target prediction and differential expression analysis of circular RNAs in paired-end RNA sequencing data. The pipeline is built using Nextflow, a workflow tool to run tasks across…

Continue Reading nf-core/circrna

Butterfly eyespots evolved via cooption of an ancestral gene-regulatory network that also patterns antennae, legs, and wings

Although the hypothesis of gene-regulatory network (GRN) cooption is a plausible model to explain the origin of morphological novelties (1), there has been limited empirical evidence to show that this mechanism led to the origin of any novel trait. Several hypotheses have been proposed for the origin of butterfly eyespots,…

Continue Reading Butterfly eyespots evolved via cooption of an ancestral gene-regulatory network that also patterns antennae, legs, and wings

Genomic analysis on Galaxy using Azure CycleCloud

Cloud computing and digital transformation have been powerful enablers for genomics. Genomics is expected to be an exabase-scale big data domain by 2025, posing data acquisition and storage challenges on par with other major generators of big data. Embracing digital transformation offers a practically limitless ability to meet the genomic…

Continue Reading Genomic analysis on Galaxy using Azure CycleCloud

Trouble with bedtools getfasta

Trouble with bedtools getfasta 0 I am trying to extract sequences from a .fasta file based on a bed file using bedtools getfasta and I am getting the following error. The command run was the following: bedtools getfasta -fi genomic.fasta -bed bedfile.bed -fo output.fasta WARNING. chromosome (chr1) was not found…

Continue Reading Trouble with bedtools getfasta

Find Transposon Element insertions using long reads (nanopore), by alignment directly. (minimap2)

find_te_ins is designed to find Transposon Element (TE) insertions using long reads (nanopore), by alignment directly. (minimap2) Install $ git clone github.com/bakerwm/find_te_ins.git&#13; $ cd find_te_ins Change the following variables upon your condition: genome_fa and te_fa in line-10 and line-11; $ bash run_pipe.sh run_pipe.sh Prerequisite minimap2 – 2.17-r974-dirty, align long…

Continue Reading Find Transposon Element insertions using long reads (nanopore), by alignment directly. (minimap2)

Bioconductor on Microsoft Azure – Microsoft Tech Community

Co-authored by: Nitesh Turaga – Scientist at Dana Farber/Harvard, Bioconductor Core Team Erdal Cosgun – Sr. Data Scientist at Microsoft Biomedical Platforms and Genomics team Vincent Carey – Professor at Harvard Medical School, Bioconductor Core Team   Introduction   The Bioconductor project promotes the statistical analysis and comprehension of current and emerging…

Continue Reading Bioconductor on Microsoft Azure – Microsoft Tech Community

Surgical Techniques to Optimize Ovarian Reserve during Laparoscopic Cystectomy for Ovarian Endometrioma

This protocol presents techniques to laparoscopically excise ovarian endometrioma, to perform adhesiolysis with sparing electrosurgical application, and to employ intraoperative chromopertubation to assess for genital tract patency. This systematic approach will facilitate optimal endometriosis management, guide concomitant adnexal surgeries, and enhance post-surgical fertility outcomes. Surgical techniques to optimize ovarian reserve…

Continue Reading Surgical Techniques to Optimize Ovarian Reserve during Laparoscopic Cystectomy for Ovarian Endometrioma

Efficiently merge two BAM files while retaining reads from only one file in overlapping regions

Efficiently merge two BAM files while retaining reads from only one file in overlapping regions 1 I have a WGS BAM file that is fairly large (>150GB) and a smaller BAM file (<5GB) with reads in a small 10Mbp region. I want to (efficiently) merge the two BAM files while…

Continue Reading Efficiently merge two BAM files while retaining reads from only one file in overlapping regions

organizing a Bed file for bedtools getfasta

organizing a Bed file for bedtools getfasta 0 I am trying to use bedtools getfasta on some bed files, but the issue is that the peaks bed file columns are mixed up such that the first column with the chromosome names contains the peak location as well for some of…

Continue Reading organizing a Bed file for bedtools getfasta

Plotting date intervals in ggplot2

I have a dataset which has a bunch of date intervals (i.e. POSIXct format start dates and end dates). In the example provided, let’s say it’s each period is associated to when someone was in school or out of school. I’m interested in plotting the data in ggplot2, each row…

Continue Reading Plotting date intervals in ggplot2

Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

I have a bed file which contains DNA sequences information as follow: ** track name=”194″ description=”194 methylation (sites)” color=0,60,120 useScore=1 chr1 15864 15866 FALSE 894 + chr1 534241 534243 FALSE 921 – chr1 710096 710098 FALSE 729 + chr1 714176 714178 FALSE 12 – chr1 720864 720866 FALSE 988 -…

Continue Reading Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

Failure to detect mutations in U2AF1 due to changes in the GRCh38 reference sequence

Materials and Methods Genomic data was collected as part of the MDS National History Study or The Cancer Genome Atlas project and consented appropriately under those protocols 8 Sekeres M.A. Gore S.D. Stablein D.M. DiFronzo N. Abel G.A. DeZern A.E. Troy J.D. Rollison D.E. Thomas J.W. Waclawiw M.A. Liu J.J….

Continue Reading Failure to detect mutations in U2AF1 due to changes in the GRCh38 reference sequence

Bioconda faststructure – gitmetadata

I am using the conda env of faststructure from bioconda channel. Got this error messages. Could it be that the bioconda package needs to be updated? Best regards: python structure.py structure.py:3: RuntimeWarning: numpy.dtype size changed, may indicate binary incompatibility. Expected 96, got 88 import fastStructure structure.py:4: RuntimeWarning: numpy.dtype size changed,…

Continue Reading Bioconda faststructure – gitmetadata

processing in strelka2 with multiples bam file in directory

processing in strelka2 with multiples bam file in directory 0 If I manually tell strelka2 to use these three bam files below, then I get the desired results of 3 individually genome files in results/variants. xxx_00.bam yyy_01.bam zzz_02.bam ${path_to_strelka}/bin/configureStrelkaGermlineWorkflow.py –bam xxx_00.bam –bam yyy_01.bam –bam zzz_02 –referenceFasta <fasta> –callRegions <.bed.gz> –runDir…

Continue Reading processing in strelka2 with multiples bam file in directory

Getting peak heights from TF chIP-seq data (wig file)

Getting peak heights from TF chIP-seq data (wig file) 1 Hello everyone, I have TF ChIP seq data from NCBI GEO in wig format. I converted wig to bedgraph and then used MACS peak caller to get bed narrowpeak files.I further uploaded file on genome browser to get graphical map…

Continue Reading Getting peak heights from TF chIP-seq data (wig file)

Regions File Format – ANGSD-wrapper/angsd-wrapper Wiki

ANGSD-wrapper prefers the regions file to be formatted as chr_name:start_position-end_position. Below, we will create a toy BED file as an example and show how we can go from BED file format to ANGSD-wrapper’s regions file format. Create toy BED file Let’s create an example BED file. You can run the…

Continue Reading Regions File Format – ANGSD-wrapper/angsd-wrapper Wiki

bedtools intersect error: Invalid record in file

Hello to all I am trying to run bedtools intersect with vcf file and a bed file (my goal is to add the depth data to my VCF) I get an error running this command: bedtools intersect -a depth.bed -b fish.vcf -wa -wb > $out The error: “Error: Invalid record…

Continue Reading bedtools intersect error: Invalid record in file

What is RNAcentral? | RNAcentral

RNAcentral is a database of non-coding RNA sequences that aggregates ncRNA data from over 40 member resources known as Expert Databases.1 Non-coding RNAs Similar to mRNAs, non-coding RNAs (ncRNAs) are transcribed from DNA but are not translated into proteins. NcRNAs are found in all organisms and have a broad range…

Continue Reading What is RNAcentral? | RNAcentral

bedtools genomecov problem with merged bam

Hi, I was using puge haplotig, and in that work flow the first step was to use bedtools genomecov so I moved here. I have three paired end dataset, illumina wgs reads, HiC reads, and Chicago sequencing reads. I aligned the paired end reads of illumina wgs to the genome,…

Continue Reading bedtools genomecov problem with merged bam

How to convert bedgraph file with bins into GRanges object?

You could convert your bedGraph bins from hg18 to hg19 using liftover, so you can overlap them with your peaks. You would read them into a GRanges object, then hand this to the liftover function to translate from hg18 to hg19, then unlist the results to get back a regular…

Continue Reading How to convert bedgraph file with bins into GRanges object?

Systems biology analysis of human genomes points to key pathways conferring spina bifida risk

Significance Genetic investigations of most structural birth defects, including spina bifida (SB), congenital heart disease, and craniofacial anomalies, have been underpowered for genome-wide association studies because of their rarity, genetic heterogeneity, incomplete penetrance, and environmental influences. Our systems biology strategy to investigate SB predisposition controls for population stratification and avoids…

Continue Reading Systems biology analysis of human genomes points to key pathways conferring spina bifida risk

P-value cut-off to identify SNPs at ChIP-seq peaks? [BedTools]

P-value cut-off to identify SNPs at ChIP-seq peaks? [BedTools] 0 Hi all, I have a bed file of SNPs and also H3K27ac ChIP-seq .broadpeak file from Roadmap epigenome… I want to find the SNPs in my list that intersects a H3K27ac peak using BedTools intersect However, should I filter the…

Continue Reading P-value cut-off to identify SNPs at ChIP-seq peaks? [BedTools]

Reference panel data to be used for GCTA-COJO

Reference panel data to be used for GCTA-COJO 0 I performed a genome-wide meta-analysis based on summary statistics from the four cohorts to identify significant loci. Next, I would like to perform a conditional analysis using GCTA-COJO to search for SNPs independent of significant lead SNPs. I know that GCTA…

Continue Reading Reference panel data to be used for GCTA-COJO

Arrange the size of subplots in plotHeatmap deeptools figure

Arrange the size of subplots in plotHeatmap deeptools figure 1 Hi all, I am trying to generate a 10×10 (10 bw files + 10 bed files) figure using deeptools but I am having trouble arranging the size of subfigures. I want the subfigures in the same size but if I…

Continue Reading Arrange the size of subplots in plotHeatmap deeptools figure

computeMatrix in deeptool is Running with no result

computeMatrix in deeptool is Running with no result 0 Hi All, I wonder if someone can help me in explaining what to input on the -R <bed file> argument of the code below? computeMatrix scale-regions -S <bigwig file(s)> -R <bed file> -b 1000 what I did for example, I download…

Continue Reading computeMatrix in deeptool is Running with no result

A matrix sample for Profile plots and heatmaps of Computematrix, deepTools

A matrix sample for Profile plots and heatmaps of Computematrix, deepTools 0 Hi everyone, I have a count matrix from feature counts and of course, couple of peak (.bed) files. I want to visualize the peaks all together to show the coverage and overall comparing. I was going to use…

Continue Reading A matrix sample for Profile plots and heatmaps of Computematrix, deepTools

Using STAR SJ.out.tab file to identify novel ncRNAs

Using STAR SJ.out.tab file to identify novel ncRNAs 0 Hi All, I am attempting to identify novel ncRNAs from a circadian RNAseq dataset. Specifically I have a ribo-depleted RNAseq timecourse with 31 samples (sample every 2 hours for 60hrs). I have run STAR (code below). I am trying to follow…

Continue Reading Using STAR SJ.out.tab file to identify novel ncRNAs

Piranha Peak-Calling with multiple replicates

Piranha Peak-Calling with multiple replicates 0 I am trying to call RNA-Protein interation peaks by using Piranha software. I have multiple replicates for each experiment and the control data, and I can’t seem to understand how to combine them into one Piranha query. For example, if I was to call…

Continue Reading Piranha Peak-Calling with multiple replicates

PLINK sanity check – Bioinformatics Stack Exchange

I am a new user of PLINK and am analysing some SNP data for the first time. After creating a .bim file with $ plink –file my_data –make-bed I notice that for several SNPs my data is different from dbSNP e.g. rs145496306: BIM file: A G dbSNP: G>A,T rs3813199: BIM…

Continue Reading PLINK sanity check – Bioinformatics Stack Exchange

Genome Bioinformatics Analyst – Pittsburgh

**Description** UPMC Presbyterian is hiring a Genome Bioinformatics Analyst to join the Molecular and Genomic Pathology Laboratory (MGP) team! This role will work a daylight schedule Monday through Friday. No weekends or holidays are required! The Molecular and Genomic Pathology Laboratory (MGP) is a dynamic state-of-the-art clinical laboratory that prides…

Continue Reading Genome Bioinformatics Analyst – Pittsburgh

how to add reference alleles to VCF?

how to add reference alleles to VCF? 1 I’m converting gVCFs to VCF, but the reference alleles are missing. An example below: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 180525_FD02929177 1 97547947 . T . . . DP=31 GT:DP:RGQ 0/0:31:81 1 97915614 . C . . . DP=40…

Continue Reading how to add reference alleles to VCF?

SNP extraction

SNP extraction 0 I want to extract specific SNPs of interest i have in a text file into an additive genetics model so that each SNP can be in a 0/1/2 format for each subject using genetics info in from PLINK (.bed, .bim, and .fam files). How can i do…

Continue Reading SNP extraction

Senior Bioinformatics Scientist II/ Staff Bioinformatics Scientist

Inscripta was founded in 2015 and recently launched the world’s first benchtop Digital Genome Engineering platform. The company is growing aggressively, investing in its leadership, team, and technology with a recent $150mm financing round led by Fidelity and TRowe price. The company’s advanced CRISPR-based platform, consisting of an instrument, reagents,…

Continue Reading Senior Bioinformatics Scientist II/ Staff Bioinformatics Scientist

bedops bedmap operation in python

bedops bedmap operation in python 1 I noticed there is a conda version of bedops bedmap function available. I’ve been struggling to use it though. Could someone refer me to any documentation of it’s usage in a python script please. Have a great day. Thanks in advance. python bedops bedmap…

Continue Reading bedops bedmap operation in python

How to call LOH with FreeC

How to call LOH with FreeC 0 Good morning, I am try to infer loss of heterozygosity (LOH) from WGS data using Freec. For this purpose, I am using these parameters in the “[BAF]” section of the configuration file: [BAF] makePileup = My_somaticVCF.vcf.gz fastaFile = hg19.fa SNPfile = hg19_snp142.SingleDiNucl.1based.txt.gz When…

Continue Reading How to call LOH with FreeC

How To Write Data In A Granges Object To A Bed File.

Given a GRanges object: gr <- GRanges(seqnames = Rle(c(“chr1”, “chr2”, “chr1”, “chr3”), c(1, 3, 2, 4)), ranges = IRanges(1:10, end = 7:16, names = head(letters, 10)), strand = Rle(strand(c(“-“, “+”, “*”, “+”, “-“)), c(1, 2, 2, 3, 2))) You can simply: df <- data.frame(seqnames=seqnames(gr), starts=start(gr)-1, ends=end(gr), names=c(rep(“.”, length(gr))), scores=c(rep(“.”, length(gr))),…

Continue Reading How To Write Data In A Granges Object To A Bed File.

Intersecting Roadmap’s Histone ChIP-seq data using BedTools?!?!??!

Intersecting Roadmap’s Histone ChIP-seq data using BedTools?!?!??! 0 Hi all, I want to prioritise my list of 112 SNPs by looking at those that lie within open chromatin regions and/or active promoter/enhancer histone marks In order to do that I have downloaded several Histone modification ChIP-seq data from Roadmap epigenomics…

Continue Reading Intersecting Roadmap’s Histone ChIP-seq data using BedTools?!?!??!

Create junctions from Bed file for IGV visualization

Create junctions from Bed file for IGV visualization 0 Any advice for creating junctions file from a bed-like file? My bed file looks like this: chr start end chr star end I have tried to copy the format used in TopHat (junctions file). But I can’t see the junctions in…

Continue Reading Create junctions from Bed file for IGV visualization

Merging genotyping array VCFs and then running kinship analysis

Merging genotyping array VCFs and then running kinship analysis 0 Hello, I have about 4200 array genotyping VCFs (from the Illumina Infinium CoreExome-24 Kit) and I have merged them using bcftools merge. The chip has 500K exonic SNPs. These are trio data – which means 1700 of them are probands,…

Continue Reading Merging genotyping array VCFs and then running kinship analysis

One-hot encoding for PLINK or VCF

One-hot encoding for PLINK or VCF 0 I want to write an autoencoder for SNP data. Is there an established way to one-hot-encode binary PLINK or VCF input? I believe that can be done by manipulating PLINK’s bed file but am afraid to do something wrong. By one-hot encoding I…

Continue Reading One-hot encoding for PLINK or VCF

find positions of a short sequence in a genome

Here’s a demo Python script you can modify for your use, which suggests the rough principle: #!/usr/bin/env python import sys import re bed = “””chr1t0t10tABCDEFGHIJ chr1t5t15tFGHIJABCDO chr1t10t20tABCDOPABCD””” string_to_match = sys.argv[1] pattern = re.compile(string_to_match) for line in bed.split(“n”): (chr, start, stop, id) = line.split(“t”) for match in pattern.finditer(id): sys.stdout.write(“t”.join([chr, str(int(start) +…

Continue Reading find positions of a short sequence in a genome

Interpretting phastConsElements from USCS Table Browser

Interpretting phastConsElements from USCS Table Browser 0 I am trying to understand the information present in PhastCons elements bed files from USCS Table Browser. Following the information I found here I managed to get a description of the column names, but not a description of what they are measuring. I…

Continue Reading Interpretting phastConsElements from USCS Table Browser

Plink –merge-list only outputting fam

Plink –merge-list only outputting fam 0 I am attempting to merge Plink files towards an algorithm I am using (CookHLA). I have already made the bed/bim/fam files for my vcf files. Now, I want to merge them into a single file so I can progress with the algorithm. To do…

Continue Reading Plink –merge-list only outputting fam

Count 5’End Mapped To A Specific Genomic Position

Count 5’End Mapped To A Specific Genomic Position 7 I got several SAM/BAM files, and I am interested in 5’ends of the mapped reads. Is there any tools or scripts to count how many 5’ends are mapped at a specific genomic position? N.B. I am not try to count the…

Continue Reading Count 5’End Mapped To A Specific Genomic Position

P-values far too high for quantitative regenie phenotype

P-values far too high for quantitative regenie phenotype 0 Hi all, I’m having some trouble running regenie (v2.2.4) on a quantitative phenotype for a large cohort. I’m testing a standard height GWAS with heights rounded to the nearest integer. I’ve tried a few different tests to see where the issue…

Continue Reading P-values far too high for quantitative regenie phenotype