Tag: BiocGenerics

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

Bioconductor – SNPRelate

DOI: 10.18129/B9.bioc.SNPRelate     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see SNPRelate. Parallel Computing Toolset for Relatedness and Principal Component Analysis of SNP Data Bioconductor version: 3.12 Genome-wide association studies (GWAS) are widely used to investigate the genetic basis of diseases and…

Continue Reading Bioconductor – SNPRelate

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

DESeq2 and high prefiltering cutoff

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

Continue Reading DESeq2 and high prefiltering cutoff

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – atena

DOI: 10.18129/B9.bioc.atena     Analysis of Transposable Elements Bioconductor version: Release (3.14) Quantify expression of transposable elements (TEs) from RNA-seq data through different methods, including ERVmap, TEtranscripts and Telescope. A common interface is provided to use each of these methods, which consists of building a parameter object, calling the quantification…

Continue Reading Bioconductor – atena

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

Bioconductor – STATegRa (development version)

DOI: 10.18129/B9.bioc.STATegRa     This is the development version of STATegRa; for the stable release version, see STATegRa. Classes and methods for multi-omics data integration Bioconductor version: Development (3.15) Classes and tools for multi-omics data integration. Author: STATegra Consortia Maintainer: David Gomez-Cabrero <david.gomezcabrero at ki.se>, Núria Planell <nuria.planell.picola at navarra.es>…

Continue Reading Bioconductor – STATegRa (development version)

Bioconductor – RiboCrypt

DOI: 10.18129/B9.bioc.RiboCrypt     Interactive visualization in genomics Bioconductor version: Release (3.14) R Package for interactive visualization and browsing NGS data. It contains a browser for both transcript and genomic coordinate view. In addition a QC and general metaplots are included, among others differential translation plots and gene expression plots….

Continue Reading Bioconductor – RiboCrypt

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

Bioconductor – TBSignatureProfiler (development version)

DOI: 10.18129/B9.bioc.TBSignatureProfiler     This is the development version of TBSignatureProfiler; for the stable release version, see TBSignatureProfiler. Profile RNA-Seq Data Using TB Pathway Signatures Bioconductor version: Development (3.15) Gene signatures of TB progression, TB disease, and other TB disease states have been validated and published previously. This package aggregates…

Continue Reading Bioconductor – TBSignatureProfiler (development version)

Bioconductor – bnem (development version)

DOI: 10.18129/B9.bioc.bnem     This is the development version of bnem; for the stable release version, see bnem. Training of logical models from indirect measurements of perturbation experiments Bioconductor version: Development (3.15) bnem combines the use of indirect measurements of Nested Effects Models (package mnem) with the Boolean networks of…

Continue Reading Bioconductor – bnem (development version)

Bioconductor – ChIPQC

    This package is for version 3.1 of Bioconductor; for the stable, up-to-date release version, see ChIPQC. Quality metrics for ChIPseq data Bioconductor version: 3.1 Quality metrics for ChIPseq data Author: Tom Carroll, Wei Liu, Ines de Santiago, Rory Stark Maintainer: Tom Carroll <tc.infomatics at gmail.com>, Rory Stark <rory.stark…

Continue Reading Bioconductor – ChIPQC

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – monaLisa

DOI: 10.18129/B9.bioc.monaLisa     Binned Motif Enrichment Analysis and Visualization Bioconductor version: Release (3.14) Useful functions to work with sequence motifs in the analysis of genomics data. These include methods to annotate genomic regions or sequences with predicted motif hits and to identify motifs that drive observed changes in accessibility…

Continue Reading Bioconductor – monaLisa

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

Bioconductor – MLInterfaces

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see MLInterfaces. Uniform interfaces to R machine learning procedures for data in Bioconductor containers Bioconductor version: 3.3 This package provides uniform interfaces to machine learning code for data in R and Bioconductor containers. Author:…

Continue Reading Bioconductor – MLInterfaces

Design formula in DESeq2

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

Continue Reading Design formula in DESeq2

Bioconductor – interactiveDisplay

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see interactiveDisplay. Package for enabling powerful shiny web displays of Bioconductor objects Bioconductor version: 3.2 The interactiveDisplay package contains the methods needed to generate interactive Shiny based display methods for Bioconductor objects. Author: Shawn…

Continue Reading Bioconductor – interactiveDisplay

Bioconductor – rgsepd

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see rgsepd. Gene Set Enrichment / Projection Displays Bioconductor version: 3.4 R/GSEPD is a bioinformatics package for R to help disambiguate transcriptome samples (a matrix of RNA-Seq counts at RefSeq IDs) by automating differential…

Continue Reading Bioconductor – rgsepd

Bioconductor – girafe

DOI: 10.18129/B9.bioc.girafe     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see girafe. Genome Intervals and Read Alignments for Functional Exploration Bioconductor version: 3.9 The package ‘girafe’ deals with the genome-level representation of aligned reads from next-generation sequencing data. It contains an object…

Continue Reading Bioconductor – girafe

Bioconductor – Harman

DOI: 10.18129/B9.bioc.Harman     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see Harman. The removal of batch effects from datasets using a PCA and constrained optimisation based technique Bioconductor version: 3.12 Harman is a PCA and constrained optimisation based technique that maximises the…

Continue Reading Bioconductor – Harman

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Bioconductor – FunciSNP

DOI: 10.18129/B9.bioc.FunciSNP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see FunciSNP. Integrating Functional Non-coding Datasets with Genetic Association Studies to Identify Candidate Regulatory SNPs Bioconductor version: 3.11 FunciSNP integrates information from GWAS, 1000genomes and chromatin feature to identify functional SNP in…

Continue Reading Bioconductor – FunciSNP

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Bioconductor – chipseq

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see chipseq. chipseq: A package for analyzing chipseq data Bioconductor version: 3.4 Tools for helping process short read data for chipseq experiments Author: Deepayan Sarkar, Robert Gentleman, Michael Lawrence, Zizhen Yao Maintainer: Bioconductor Package…

Continue Reading Bioconductor – chipseq

Bioconductor – MotIV

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see MotIV. Motif Identification and Validation Bioconductor version: 3.4 This package makes use of STAMP for comparing a set of motifs to a given database (e.g. JASPAR). It can also be used to visualize…

Continue Reading Bioconductor – MotIV

Bioconductor – Ringo

DOI: 10.18129/B9.bioc.Ringo     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see Ringo. R Investigation of ChIP-chip Oligoarrays Bioconductor version: 3.9 The package Ringo facilitates the primary analysis of ChIP-chip data. The main functionalities of the package are data read-in, quality assessment, data…

Continue Reading Bioconductor – Ringo

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

Bioconductor – systemPipeRdata

DOI: 10.18129/B9.bioc.systemPipeRdata     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see systemPipeRdata. systemPipeRdata: NGS workflow templates and sample data Bioconductor version: 3.9 systemPipeRdata is a helper package to generate with a single command NGS workflow templates that are intended to be used…

Continue Reading Bioconductor – systemPipeRdata

Bioconductor – ramr

DOI: 10.18129/B9.bioc.ramr     Detection of Rare Aberrantly Methylated Regions in Array and NGS Data Bioconductor version: Release (3.13) ramr is an R package for detection of low-frequency aberrant methylation events in large data sets obtained by methylation profiling using array or high-throughput bisulfite sequencing. In addition, package provides functions…

Continue Reading Bioconductor – ramr

Outliers on DESEq2 Results

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

Continue Reading Outliers on DESEq2 Results

Bioconductor – fcScan

DOI: 10.18129/B9.bioc.fcScan     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see fcScan. fcScan for detecting clusters of coordinates with user defined options Bioconductor version: 3.12 This package is used to detect combination of genomic coordinates falling within a user defined window size…

Continue Reading Bioconductor – fcScan

Bioconductor – tRNAdbImport

DOI: 10.18129/B9.bioc.tRNAdbImport     Importing from tRNAdb and mitotRNAdb as GRanges objects Bioconductor version: Release (3.13) tRNAdbImport imports the entries of the tRNAdb and mtRNAdb (trna.bioinf.uni-leipzig.de) as GRanges object. Author: Felix G.M. Ernst [aut, cre] Maintainer: Felix G.M. Ernst <felix.gm.ernst at outlook.com> Citation (from within R, enter citation(“tRNAdbImport”)): Installation To…

Continue Reading Bioconductor – tRNAdbImport

Bioconductor – netbenchmark

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see netbenchmark. Benchmarking of several gene network inference methods Bioconductor version: 3.4 This package implements a benchmarking of several gene network inference algorithms from gene expression data. Author: Pau Bellot, Catharina Olsen, Patrick Meyer,…

Continue Reading Bioconductor – netbenchmark

List of all packages in BioConductor transition dependency level 1 failing due issue with either RUnit or testthat

Hi Andreas, On 02-09-2021 13:12, Andreas Tille wrote: > I did added an info about all those packages of level 1 that are failing > either due to RUnit or testthat issues and here is a manually edited > `grep -A8 ‘/jobs/’ r-bioc-*/debian/changelog` on my local disk: > > r-bioc-biocparallel/debian/changelog:…

Continue Reading List of all packages in BioConductor transition dependency level 1 failing due issue with either RUnit or testthat

Bioconductor – PICS

DOI: 10.18129/B9.bioc.PICS     Probabilistic inference of ChIP-seq Bioconductor version: Release (3.5) Probabilistic inference of ChIP-Seq using an empirical Bayes mixture model approach. Author: Xuekui Zhang <xzhang at stat.ubc.ca>, Raphael Gottardo <rgottard at fhcrc.org> Maintainer: Renan Sauteraud <rsautera at fhcrc.org> Citation (from within R, enter citation(“PICS”)): Installation To install this…

Continue Reading Bioconductor – PICS

Bioconductor – scRNAseq

DOI: 10.18129/B9.bioc.scRNAseq     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see scRNAseq. Collection of Public Single-Cell RNA-Seq Datasets Bioconductor version: 3.11 Gene-level counts for a collection of public scRNA-seq datasets, provided as SingleCellExperiment objects with cell- and gene-level metadata. Author: Davide Risso…

Continue Reading Bioconductor – scRNAseq

Bioconductor – DESeq2

DOI: 10.18129/B9.bioc.DESeq2     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see DESeq2. Differential gene expression analysis based on the negative binomial distribution Bioconductor version: 3.10 Estimate variance-mean dependence in count data from high-throughput sequencing assays and test for differential expression based on…

Continue Reading Bioconductor – DESeq2

Bioconductor – unifiedWMWqPCR

DOI: 10.18129/B9.bioc.unifiedWMWqPCR     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see unifiedWMWqPCR. Unified Wilcoxon-Mann Whitney Test for testing differential expression in qPCR data Bioconductor version: 3.11 This packages implements the unified Wilcoxon-Mann-Whitney Test for qPCR data. This modified test allows for testing…

Continue Reading Bioconductor – unifiedWMWqPCR

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

weird MAplot or volcano plot of DESeq2 diff result

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

Continue Reading weird MAplot or volcano plot of DESeq2 diff result