Tag: Bioinformatics

Job Details Auckland, Auckland, New Zealand Netvalue Ltd Posted 1 day ago Want updates for this and similar Jobs? This advertiser has chosen not to accept applicants from your region. Full Job Description Bioinformatics Developer (Intermediate to Senior) Bioinformatics Developer (Intermediate to Senior) 15 openings But enough about us, what…

Details Posted: 09-Feb-24 Location: New York, New York Salary: Open Categories: Academic/Faculty Medical – Clinical Senior Bioinformatics Analyst Title: Senior Bioinformatics Analyst Location: Upper East Side Org Unit: Steven Josefowicz Lab Work Days: Monday-Friday Exemption Status: Exempt Salary Range: $108,600.00 – $126,600.00 *As required under NYC Human Rights Law Int…

Working with UsChallenging. Meaningful. Life-changing. Those aren’t words that are usually associated with a job. But working at Bristol Myers Squibb is anything but usual. Here, uniquely interesting work happens every day, in every department. From optimizing a production line to the latest breakthroughs in cell therapy, this is work…

Welcome to another blog post! ‍ Reference genomes are essential benchmarks of a species’ genome that facilitate the accurate comparison of individual genomes and are crucial tools for identifying genetic variants and diagnosing rare diseases. Here, we will explore the evolution of the human reference genome, focusing on the transition…

Join the HJF Team!The Henry M. Jackson Foundation for the Advancement of Military Medicine (HJF) is a nonprofit organization dedicated to advancing military medicine. We serve military, medical, academic and government clients by administering, managing and supporting preeminent scientific programs that benefit members of the armed forces and civilians alike….

TitleSenior Bioinformatics/Data Scientist BELONG. CONNECT. GROW. with KBR. At KBR, we define the future. We are a company of innovators, thinkers, creators, explorers, volunteers, and dreamers. But we all share one goal: to improve the world responsibly and safely. KBR is seeking a Senior Data Scientist with Bioinformatics experience. The…

About the q2-jobs category 0 664 July 5, 2018 MS/PhD/Postdoc position in the Department of Biomedical Informatics at the University of Arkansas for Medical Sciences 0 166 June 7, 2023 Research Software Engineer for microbiome bioinformatics at ETH Zurich 0 406 June 7, 2023 Microbial Ecology Postdoctoral Researcher at Smithsonian,…

(MENAFN– GlobeNewsWire – Nasdaq) The Global Bioinformatics Market was valued USD 10.23 Billion in 2023 and projected to reach USD 28.6 Billion by 2030, growing at a CAGR of 13.73% during the forecast period of 2023-2030 Richmond, Feb. 09, 2024 (GLOBE NEWSWIRE) — According to a research report ” Bioinformatics…

Database Of Space Life Science Investigations And Bioinformatics Of Microbiology In Extreme Environments Biological experiments performed in space crafts like space stations, space shuttles, and recoverable satellites has enabled extensive spaceflight life investigations (SLIs). In particular, SLIs have revealed distinguished space effects on microbial growth, survival, metabolite production, biofilm formation,…

Provided by: mothur_1.48.0-2_amd64 NAME mothur – sequence analysis suite for research on microbiota SYNOPSIS mothur [ batchfile ] DESCRIPTION This manual page documents briefly the mothur command. Mothur seeks to develop a single piece of open-source, expandable software to fill the bioinformatics needs of the microbial ecology community. It has…

Job Details LocalitiesAbiramapuram, MKB Nagar, MR Nagar, MRC Nagar, Madambakkam Job ID368762395 RoleNurse Hiring Company NameAchievers Spot Max Experience1 Min Experience0 Description Medical Coding JobsMedical Coding is the process of conversion of text information related to healthcare services intonumeric Diagnosis (Medical Problems) and Procedure (Treatments) Codes using ICD-10 CM andCPT…

Job DescriptionThis is a Pre-Fellowship for early career researchers wanting to establish a career in MND translational research and become MND research leaders of the future. The postholder will have a leading role in an exciting new project funded by Motor Neurone Disease Association and MND Scotland. The project is…

According to the vcftools manual, specifying the “–relatedness2” flag allows calculating relatedness statistics using the method by Manichaikul et al., BIOINFORMATICS 2010 (doi:10.1093/bioinformatics/btq559). That is, based on KING. According to the PLINK manual, PLINK uses the same method to calculate relatedness when specifying the flag “–make-king-table”. So, although both PLINK…

Introduction Short-read metagenomic sequencing is the technique most widely used to explore the natural habitat of millions of bacteria. In comparison with 16S rRNA sequencing, shotgun metagenomic sequencing (MGS) provides sequence information of the whole genomes, which can be used to identify different genes present in an individual bacterium and…

DOI: 10.18129/B9.bioc.genomation     Summary, annotation and visualization of genomic data Bioconductor version: Release (3.6) A package for summary and annotation of genomic intervals. Users can visualize and quantify genomic intervals over pre-defined functional regions, such as promoters, exons, introns, etc. The genomic intervals represent regions with a defined chromosome…

Mohammed VI Polytechnic University is an institution dedicated to research and innovation in Africa and aims to position itself among world-renowned universities in its fields The University is engaged in economic and human development and puts research and innovation at the forefront of African development. A mechanism that enables it…

The Department of Biomedicine at Faculty of Health at Aarhus University invites applications for a position as Professor in the field of Medical Bioinformatics and Statistical Genetics as per 1 July 2024 or as soon as possible thereafter. The position is a time-limited full-time position for 5 years with extension…

Both radiographic progression-free survival (rPFS) and clinical PFS (cPFS) appear to be valid surrogates for overall survival (OS) in phase 3 clinical trials evaluating testosterone suppression–based treatment strategies for patients with metastatic hormone-sensitive prostate cancer (mHSPC), according to findings from a study that were published in the Journal of Clinical…

Richmond, Feb. 09, 2024 (GLOBE NEWSWIRE) — According to a research report “Bioinformatics Market”, by tools Type (BLAST, BioPerl, InterMine, Others), Services (Genome Sequencing, RNA sequencing, Metagenomic Analysis, Epigenomic, Others), Application (Drug discovery, Personalized medicine, Preventive medicine, Transcriptions, Metabolomics, Gene therapy, Others) Sectors (Medical Biotechnology, Animal Biotechnology, Plant Biotechnology, Environmental…

JOB TITLE: Software Quality Engineer III – Bioinformatics LOCATION: Remote, USA PRIMARY RESPONSIBILITIES: Perform software verification, define and execute test cases and scenarios required for software quality assurance and regulatory compliance. Perform system analysis, assess risk, and develop strong test strategies by analyzing product design and technical specifications, and by…

At Cepheid, we are passionate about improving health care through fast, accurate diagnostic testing. Our mission drives us, every moment of every day, as we develop scalable, groundbreaking solutions to solve the world’s most complex health challenges. Our associates are involved in every stage of molecular diagnostics, from ideation to…

Provided by: fastqc_0.11.9+dfsg-5_all NAME FastQC – high throughput sequence QC analysis tool SYNOPSIS fastqc seqfile1 seqfile2 .. seqfileN fastqc [-o output dir] [–(no)extract] [-f fastq|bam|sam] [-c contaminant file] seqfile1 .. seqfileN DESCRIPTION FastQC reads a set of sequence files and produces from each one a quality control report consisting of…

Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article  CAS  PubMed  Google Scholar  Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article  CAS  PubMed  Google Scholar  Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….

Molecular Dynamics Software Market Global “Molecular Dynamics Software Market” Research report is an in-depth study of the market Analysis. Along with the most recent patterns and figures that uncovers a wide examination of the market offer. This report provides exhaustive coverage on geographical segmentation, latest demand scope, growth rate analysis…

Job Description: 1) Use Nextflow to build bioinformatics pipelines that take FASTQ or BAM files as input and process them using bioinformatic tools. 2) Write Python/R scripts to process, summarize, and visualize outputs created by other tools. 3) Ensure that the pipeline is modular and flexible, with the ability to…

Presented by: Ben Lengerich, Postdoc and Alana Fellow, MIT Comp Sci and AI Lab & the Broad Institute In biomedical data analysis, an emerging trend focuses on contextualizing observations within biological and real-world processes. This approach facilitates high-resolution, context-specific insights by integrating information across datasets, moving beyond analyzing datasets in…

Mohammed VI Polytechnic University is an institution dedicated to research and innovation in Africa and aims to position itself among world-renowned universities in its fields The University is engaged in economic and human development and puts research and innovation at the forefront of African development. A mechanism that enables it…

Starting from a list of gene IDs with optional expression values Starting from a single count table (RNAseq) or intensity table (microarray) Starting with several gene expression tables for meta-analysis Uploading raw RNAseq files (any species) for mapping & quantification Starting with a network file (sif, graphml, json) News &…

About the tool The FASTA format is a text-based format for representing nucleotide or peptide sequences. The FASTQ format additionally includes the corresponding quality scores. This tool allows you to convert FASTQ files to FASTA. The resulting FASTA file will contain only the sequence data from the input FASTQ file….

Podcast: Explain Podcast Erschienen: 09.02.2024Dauer: 01:10:43 Getting the most out of Machines Chapters: 04:30 PhiX 14:30 low complexity 19:30 UMIs 32:10 FastQC 43:00 MultiQC 56:40 PycoQC PhiX concentrations for loading a validation run: knowledge.illumina.com/instrumentation/general/instrumentation-general-reference_material-list/000001536 Dnatech on why UMIs are used: dnatech.genomecenter.ucdavis.edu/faqs/what-are-umis-and-why-are-they-used-in-high-throughput-sequencing/ BMH learning on UMIs: www.youtube.com/watch?v=sRPMsnhIBK0 FastQC for QC of…

CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated protein) genome editing enables precise, targeted genetic modification of plants. To date, the genomes of several crops, including rice, tomato, corn, wheat, soybean, barley, potato, sorghum, apple, grapefruit, and orange, have been edited using CRISPR-Cas-based genome editing technology. The CRISPR system cuts not…

How is genetics useful for conservation?5 answersGenetics is useful for conservation in several ways. It allows us to understand and address the loss of genetic diversity in natural populations, which can contribute to extinction risk. Conservation genetics helps investigate the diversity, distribution, and function of genetic variation in populations of…

AIIMS Kalyani Recruitment 2024: Monthly Salary Up to 56000, Check Post, Tenure, Age Limit and Interview Details AIIMS Kalyani Recruitment 2024: The All India Institute of Medical Sciences (AIIMS) Kalyani recruitment drive is being conducted to fill 03 vacancies of Project Research Scientist -I (Non-Medical) and Project Technical Support-I (Medical…

Review doi: 10.1111/1751-7915.14396. Online ahead of print. Affiliations Expand Affiliations 1 Quadram Institute Bioscience, Norwich, UK. 2 Earlham Institute, Norwich, UK. 3 Inria, University of Bordeaux, INRAE, Talence, France. 4 University of Bordeaux, CNRS, Bordeaux INP, LaBRI, UMR 5800, Talence, France. 5 INRAE STLO¸University of Rennes, Rennes, France. 6 INRAE,…

Findings published in open-access journal Genome Medicine. IRVINE, Calif., Jan. 18, 2024 /PRNewswire/ — Helio Genomics, an AI-driven healthcare company specializing in diagnostics technology and test development for cancer detection, today announced that results from an important new research study have been published in the peer-reviewed journal, Genome…

Job Portal Postdoc/assistant professor in molecular biology and bioinformatics: Structural variations associated to circular DNA in cancer Department of Biology, Faculty of Science at University of Copenhagen is offering a position in molecular biology and bioinformatics for a Postdoc/assistant professor for the analysis of extrachromosomal circular DNA in 1 April…

Jan. 19, 2024 — Over 18 million people worldwide are annually diagnosed with cancer, with each case hiding many mutations in its genome. Understanding these mutations furthers cancer research, while also providing a deeper understanding to create possible cures, therapies and prevention strategies. The Triton Shared Computer Cluster at the…

Hamblin MT, Di Rienzo A. Detection of the signature of natural selection in humans: evidence from the Duffy blood group locus. Am J Hum Genet. 2000;66:1669–79. Article  CAS  PubMed  PubMed Central  Google Scholar  Hamblin MT, Thompson EE, Di Rienzo A. Complex signatures of natural selection at the Duffy blood group…

komal (Komalk) January 19, 2024, 12:02pm 1 Hi this is regarding DESeq2. I first created a phyloseq object from qiime2 artifacts and then subjected it to Deseq2. At one step I got a errorError in estimateSizeFactorsForMatrix(counts(object), locfunc = locfunc, :every gene contains at least one zero, cannot compute log geometric…

DescriptionGritstone bio is a public, next-generation personalized cancer and infectious immunotherapy company. Gritstone brings together distinguished scientific founders, an experienced and diverse management team, a seasoned and successful board of directors and deep financial backing to tackle fundamental challenges at the intersection of cancer genomics, immunology, and immunotherapy design. The…

Category Research / Academic Location Wageningen Do you want to use your passion to study the possible risks of exposure to nano and microplastics for human health as a Post Doctoral researcher? Are you motivated to work in an team of scientists in an ambitious Dutch research program? Do you…

We are seeking a talented, highly motivated Senior Bioinformatics Research Scientist to lead our bioinformatics pipeline and develop innovative solutions for analyzing and visualizing omics data related to innate immune signaling projects. The candidate will work both collaboratively and independently on projects within the Kanneganti lab in the Department of…

Animals and samples The study included 10 pigs, 8 pigs were bred at the INRAE experimental farm (doi.org/doi.org/10.15454/1.5572415481185847E12) and 2 pigs come from breeding organizations in accordance with the French and European legislation on animal welfare. The animals belong to the same family, except for one LW animal. Animals were…

All jobs > Research > International Centre of Insect Physiology and Ecology (icipe) – Postdoctoral Research Fellow (Bioinformatics) International Centre of Insect Physiology and Ecology (icipe) Get a free C.V. review by sending your C.V. to submitcv@careerassociated.com or click the following link. Submit C.V.! use the subject heading REVIEW. IMPORTANT: Read the…

Description: The Computational Biology & Gene Regulation group led by Anthony Mathelier at the NCMM, a part of the Nordic EMBL Partnership for Molecular Medicine, is seeking a highly motivated Researcher or Postdoctoral Fellow for a two-year position, starting as soon as possible in 2024. The selected candidate will play…

Voluntary Self-Identification For government reporting purposes, we ask candidates to respond to the below self-identification survey. Completion of the form is entirely voluntary. Whatever your decision, it will not be considered in the hiring process or thereafter. Any information that you do provide will be recorded and maintained in a…

As part of the Nordic EMBL Partnership for Molecular Medicine, the Institute for Molecular Medicine Finland (FIMM) invites applications for the positions of Doctoral Researchers in Molecular Medicine and Life Sciences We currently have 2-4 openings for doctoral researchers as part of the FIMM-EMBL international PhD programme starting in August 2024. In this interdisciplinary…

Hu T, Chitnis N, Monos D, Dinh A. Next-generation sequencing technologies: an overview. Hum Immunol. 2021;82(11):801–11. Article  CAS  Google Scholar  Jeon SA, Park JL, Park SJ, Kim JH, Goh SH, Han JY, Kim SY. Comparison between MGI and Illumina sequencing platforms for whole genome sequencing. Genes Genomics. 2021;43(7):713–24. Article  CAS …

 The people of Memorial Sloan Kettering Cancer Center (MSK) are united by a singular mission: ending cancer for life. Our specialized care teams provide personalized, compassionate, expert care to patients of all ages. Informed by basic research done at our Sloan Kettering Institute, scientists across MSK collaborate to conduct innovative…

Post-Doctoral and PhD positions: Join our vibrant team! We are currently hiring for various positions – Curators, Post-Docs, PhD, and Master Students. If you are passionate about Bioinformatics and Computational Biology, with a keen interest in Systems Biology, Network-Based, Multi-omic Integration, and deep learning, we want to hear from you!…

CDC. (ed CDC) (U.S. Department of Health and Human Services, CDC; 2019, Atlanta, GA, 2019). Krismer, B., Weidenmaier, C., Zipperer, A. & Peschel, A. The commensal lifestyle of Staphylococcus aureus and its interactions with the nasal microbiota. Nat. Rev. Microbiol. 15, 675–687 (2017). Article  CAS  PubMed  Google Scholar  Somerville, G….

Government of Gujarat has established Gujarat State Biotechnology Mission (GSBTM) as a nodal agency to develop overall development of biotechnology in the state in 2004. Major activities of GSBTM is promoting research and development in the field of biotechnology and supporting the development of biotechnology industries in the state. Besides…

Find Legal Bioinformatics Jobs in New York | Hiring Now var googletag = googletag || {}; googletag.cmd = googletag.cmd || []; googletag.cmd.push(function() { googletag.pubads().disableInitialLoad(); }); device = device.default; //this function refreshes [adhesion] ad slot every 60 second and makes prebid bid on it every 60 seconds // Set timer to…

!*!SUBFUNCTION DEFINITION: Bioinformatics applies biology, computer science, data science, and statistics to analyze and interpret biological and clinical data.REPRESENTATIVE RESPONSIBILITIES ·InformaticsCurates, annotates and organizes various types of biomedical data (e.g., genomic, clinical, imaging, sequencing) in various formats (e.g., flat files, relational and non-relational databases). Collects and records appropriate metadata. Ensures…

Bhabha Atomic Research Centre Recruitment 2024: Check Posts, Qualification, Age, Application Fee, Mode of Selection and Process to Apply Bhabha Atomic Research Centre Recruitment 2024: The Bhabha Atomic Research Centre (BARC) recruitment drive is being conducted to fill a vacancy of Scientific Officer (Group-A post of Government of India) through…

Hi,Is it possible to convert fastq.gz.fastsanger.gz to fastq.gz in Galaxy?The data is in fastq.gz.fastsanger.gz format and was generated by the NextSeq 2000. I downloaded the data from Galaxy and want to convert fastq.gz.fastsanger.gz to fastq.gz using Galaxy. I uploaded the dataset, clicked the pencil icon, and went into the Edit…

Are you passionate about significantly improving the future of medicine? Do you believe that people are the most important asset of any company? If so, join AmplifyBio! AmplifyBio is a company dedicated to building an integrated environment where clients can access technologies, platforms, capabilities and safety testing for the scale…

Srinagar, Dec 31: A three-day workshop on ‘Advanced Microbial Diagnosis and Bioinformatics’ concluded at Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, Shuhama campus today. The training was organised by the SKUAST-K’s Division of Veterinary Microbiology & Immunology, Faculty of Veterinary Sciences, under the World Bank-ICAR funded National Agricultural…

Assistant Professor of Biology – BioinformaticsGeorgia Southern University – Statesboro, GAAbout Us Join Our Team at Georgia Southern! Georgia Southern is a dynamic university with three vibrant campuses in Hinesville, Savannah and Statesboro serving the communities in Southeast Georgia. As a Carnegie Doctoral/R2 institution, our world-class scholars…

Job Category Any CategoryJobInternshipWork from Home Job Type Any Job TypesFull-timePart-timeContractVolunteer Location Any CountryUKCanadaAustraliaPakistanIrelandGermanyUSASwedenNew ZealandMalaysiaRussiaNetherlandDubaiSwitzerlandJapanVietnamItalyDenmarkOnlineGeorgiaLatviaSingaporeChinaNetherlandsIndiaFranceBelgiumBrazilColombiaEuropeEstoniaThailandNorwayNigeriaQatarCambodiaUAESouth KoreaAustriaTurkeyworldwideADB CountriesIndonesiaSaudi Arabia Industry Any Industry athletic apparel and footwear Refugee AgencyAccredited registrarAeronauticsAerospaceAirlineappliance manufacturerArtificial Intelligencearts, entertainment, and recreation sectorAstronomical ResearchAutomationAutomativeAviationBankingBioinformaticsBroadcastingBusiness Administrationcar manufacturingchemicalCivic and Social OrganizationsCivil EngineeringConsumer goodsCreativity and Innovation DevelopmentCyber SecurityDairyingData analyticsDevelopmentDigitale-commerceEducationEducationElectric Power GenerationEnergyEngineeringEngineering Professional…

How to trim miRNA reads? 1 Hi there, I am new to bioinformatics. I am trying to prepare fasta.gz files for uploading onto CPSS, a websever for miRNA-seq datasets. My data is from Gene Omnibus db. Basically the sample fasta file appears like this: ;>SRR1658346.1 HISEQ1:187:D0NWFACXX:3:1101:2565:2050 length=51 ATCATACAAGGACAATTTCTTTTAACGTCGTATGCCGTCTTCTGCTTGNAA >SRR1658346.2 HISEQ1:187:D0NWFACXX:3:1101:2654:2232…

What are the limitations of using 16S sequencing for taxonomic identification?4 answers16S sequencing for taxonomic identification has several limitations. The most commonly used bioinformatics tools, such as Qiime 2 and Mothur, may underestimate the accuracy of species-level taxonomic assignments. Additionally, current analytical approaches lack the ability to formalize syntheses of…

Introduction: DNA sequence alignment is a fundamental technique in bioinformatics used to compare and analyze genetic sequences. In this article, we’ll explore a C++ implementation of a basic DNA sequence alignment algorithm, shedding light on its significance and applications in biological research. Background: DNA sequencing is a technique used to…

Pulmonary Fibrosis Biomarkers Market With a projected market size of US$ 4.1 billion in 2023 and an expected CAGR of 4.2% over the forecast period, the global pulmonary fibrosis biomarkers market size is expected to develop significantly, reaching a worth of US$ 6.2 billion by 2033. Key to this growth…

Download: pdf | pdf ClinVar RCV Page Survey 2022 Start of Block: Default Question Block OMB Approval Info OMB Control Number: 0925-0648 Expiration Date: 06/30/2024 Public reporting burden for this collection of information is estimated to average 5 minutes per response, including the time for reviewing instructions, searching existing data…

Guangzhou Geneseed Biotech. Co.,Ltd. founded in June 2010,is a high-tech enterprise focusing on circRNA technology research and industrialization development.Since 2014, Geneseed has been focusing on the circRNA segment, and continuously cultivating for nearly a decade, with a profound accumulation of original technologies. Our team has professionals in microbiology, molecular biology, bioinformatics,…

Jobs in Pakistan, Official Govt Jobs, Dubai Career, Today Newspapers Jobs Pakistan, Paper PK 30 December 2023, Work Home, Earn Money Online 2024 Hire bioinformatics developers in Wah Cantt for freelance work, online projects or office jobs in 2023. Find best Bioinformatics freelancers in Wah Cantt for expert & professional…

 The Bioinformatics Technician will use sophisticated measurement tools and programs to gather, analyze, and record biological characteristic data, and then to interpret, visualize, and/or manipulate the data for further study. Duties/Responsibilities: Collects and documents large amounts of scientific data. Analyzes collected data using statistics, computer programs, and other sophisticated…

I completed my Bachelor’s in Economics in 2021 but haven’t done anything relevant to put on a resume: no jobs or internships. How can I cover this gap? I want to try for the UPSC but what if I don’t clear it? I am thinking of higher studies (preferably abroad…

Staphylococcus aureus sepsis and mitochondrial accrual of the 8-oxoguanine DNA glycosylase DNA repair enzyme in mice. Publication ,  Journal Article Bartz, RR; Suliman, HB; Fu, P; Welty-Wolf, K; Carraway, MS; MacGarvey, NC; Withers, CM; Sweeney, TE; Piantadosi, CA Published in: Am J Respir Crit Care Med RATIONALE: Damage to mitochondrial DNA…

Academic Job Category Faculty Non Bargaining Job Title Research Associate – Bioinformatics, Cancer Proteomics & Personalized Medicine Department Lange Laboratory | Department of Pathology and Laboratory Medicine | Faculty of Medicine (Philipp Lange) Posting End Date January 31, 2024 Note: Applications will be accepted until 11:59 PM on the day…

Distant quasars — massive celestial objects that emit large amounts of energy — make the brightest light in the universe. Using quasar light data, the National Science Foundation-funded Frontera supercomputer at the Texas Advanced Computing Center, or TACC, helped UC Riverside astronomer Simeon Bird develop PRIYA, the largest suite of hydrodynamic…

For 75 years, Charles River employees have worked together to assist in the discovery, development and safe manufacture of new drug therapies. When you join our family, you will have a significant impact on the health and well-being of people across the globe. Whether your background is in life sciences, finance,…

Brent, G. A. Mechanisms of thyroid hormone action. J. Clin. Invest. 9, 3035–3043 (2012). Article  Google Scholar  Iwen, K. A., Oelkrug, R. & Brabant, G. Effects of thyroid hormones on thermogenesis and energy partitioning. J. Mol. Endocrinol. 60, R157–R170 (2018). Article  PubMed  CAS  Google Scholar  Biondi, B. & Wartofsky, L….

Job Description Data Scientist Specialist/Bioinformatics Specialist, 3M Company, St. Paul, Minnesota: Develop advanced data analysis toolkits to explore and enable the invention of new products related to the identification, testing, and validation of biological information in Wound Healing and Biopharma Purification. Lead technical research related to infection prevention, microbial detection…

Broaden your search Bioinformatics, Full Time, $50,000 – $74,999, Colorado 1 Life Sciences, Full Time, $50,000 – $74,999, Postdoc, Colorado 1 Bioinformatics, Full Time, $50,000 – $74,999, Postdoc, United States 5 Refine your search Sign up for job alerts …

Team Leader Bioinformatics – Ryvu Therapeutics, Krakow Team Leader Bioinformatics Ryvu Therapeutics Krakow, Poland As Bioinformatics Team Leader you will be responsible for development of this area within Data Science department which includes managing and growing the team, setting and executing short and long term plans, propagating collaboration with other…

30 PhD Positions and 2 Postdoc positions: The CRC 1644 Projects at the University of Potsdam are offering scholarship positions for individuals with a keen interest in Biology, Bioinformatics, Computer Science, Mathematics, or (Bio)physics. These positions, available in clusters A, B, and Z, provide an excellent opportunity for aspiring scholars…

PA in Director’s Office EMBL-EBI – European Bioinformatics Institute Hinxton, United Kingdom Organisation data: Directors OfficeJob Number: EBI02200Contract Type: Staff MemberAdvertised Grade-Grading: Grade 5 – 6 (depending on experience) Monthly salary from £3,090 – £3,456 after tax – other benefits based on family circumstancesContract Duration-Length of Time (years/months): 3 years…

EPFL, the Swiss Federal Institute of Technology in Lausanne, is one of the most dynamic university campuses in Europe and ranks among the top 20 universities worldwide. The EPFL employs more than 6,500 people supporting the three main missions of the institution: education, research and innovation. The EPFL campus offers…

Pharmaceutical cell biology Uppsala University Bioinformatics computer lab Student name: 1. Sequence alignment using BLAST You are provided with a file named ‘sequences.txt‘, containing a sequence named ‘Sequence1’, extracted from a viral sample. Your task is to identify the type of virus from which this sequence originates. Visit the NCBI…

Share Tweet Share Share Email Biotechnology stands out as a revolutionary force with the power to reshape industries and drive innovation. Within this exciting realm, biotech startups play a pivotal role in not only pushing the boundaries of scientific discovery but also in…

Trying to understand STAR fastqLog.final.out File 0 Hello, I am analyzing ribo-seq data and am trying to understand if my interpretation of star’s log file is correct. I do not have extensive bioinformatics/computational experience, so it’s been a bit difficult trying to understand how to proceed (the guides online are…

Let’s shape the future – University of Antwerp The University of Antwerp is a dynamic, forward-thinking, European university. We offer an innovative academic education to more than 20000 students, conduct pioneering scientific research and play an important service-providing role in society. We are one of the largest, most international and most innovative…

Hello, Galaxy Community! Firstly, the Galaxy team would like to extend our warmest wishes to you and all your loved ones this holiday season! With the New Year rapidly approaching, we wanted to thank you all for being a part of the Galaxy Community in 2023; we couldn’t do it…

The Collaborative Research Centre 1381 “Dynamic organization of cellular protein machineries: From biogenesis and modular assembly to function” is looking for a Postdoctoral Scientist (f/m/d) in Bioinformatics / Computational Proteomics Bewerbungsfrist: 15.01.2024 Veröffentlicht: 19.12.2023 Start-date: At the earliest possible date. Fulltime position Kennziffer: 00003485 Beschreibung The position is embedded in…

Key Points Question  What is the association of PIK3CA mutations, response to therapy, and outcome by hormone receptor (HR) status and intrinsic subtype among patients with ERBB2/HER2-positive early breast cancer (EBC) treated in a clinical trial? Findings  In this cohort study of 184 patients enrolled in the phase 3 trial…

Roche PhD Student – Bioinformatics approaches for understanding patient response to immunotherapy (temporary contract) The Position In Roche’s Pharmaceutical Research and Early Development organisation (pRED), we are united by our mission to transform science into medicines. We develop transformative therapies for patients in order to tackle some of the world’s…

Job Description Who we are Genomines is a young biotechnology company based in Paris and Saclay, specialized in sustainable extraction of Nickel from plants. The mission of Genomines is to usher in a new era of sustainable mining by using genetically enhanced plants to extract metals from soil (agromining). Through…

Posting InformationPosting Information Department Renaissance Computing Inst-637100 Career Area Information Technology Posting Open Date 09/14/2023 Application Deadline 01/02/2024 Open Until Filled No Position Type Permanent Staff (EHRA NF) Working Title Bioinformatics Data Scientist Appointment Type EHRA Non-Faculty Position Number 20059390, 20061324 Vacancy ID NF0007337 Full Time/Part Time Full-Time Permanent FTE…

As a Research Bioinformatician II, you will join the research team at the Center for Cardiac Arrest Prevention directed by Dr. Sumeet Chugh and located within the Cedars-Sinai Smidt Heart Institute. The overall goal of this Center is to predict and prevent sudden cardiac arrest, a mostly lethal condition. You…

Job Description 6000! This is the number of associates in the Novartis Institutes for BioMedical Research (NIBR). This division is the innovation engine of Novartis, focusing on new technologies that have the potential to help produce therapeutic breakthroughs for patients. The Biologics Center (NBC) is accommodated within the Novartis Institutes…

Since the idea of genetic regulation was first postulated back in the 1950s, our scientific understanding of the transcriptome has deepened greatly.1 Looking into the transcriptome of cells and tissues has helped scientists to understand the biological processes that drive both health and disease; however, the complex and occasionally mysterious…

About Relay Therapeutics Relay Therapeutics is a clinical-stage precision medicines company transforming the drug discovery process. Built on unparalleled insights into protein motion and how this dynamic behavior relates to protein function, our approach combines unprecedented computational power with leading-edge experimental approaches across the fields of structural biology, biophysics, chemistry…

Department: RECETOX – Faculty of Science Deadline: 15 Jan 2024 Start date: upon agreement Job type: full-time Job field Science and research Bursar of the Faculty of Science, Masaryk University announces an open competition for the position Postdoc in the field of Integrative Bioinformatics and Biostatistics Workplace: RECETOX, Faculty of Science, Masaryk University in…

DNA sequencing I. Goal II. Methodology A. Sanger DNA sequencing ● Up to 900 base pairs ● Primer extension with labeled ddNTPs (radioactive or fluorescent) ● Prior knowledge on target needed ● Difficult to detect variation in mixtures ● High accuracy + still in use for genotyping When it is…

Introduction Brucellosis is a zoonotic disease caused by Brucella spp., a gram-negative facultative intracellular coccobacillus.1 These microorganisms can infect livestock, wildlife, and humans, causing significant public concern and substantial agricultural economic loss. Currently, at least six novel Brucella species have been identified: Brucella pinnipedialis, Brucella ceti,2 Brucella papionis,3 Brucella microti,4…

Job Title: Sr. Software Engineer in Test (Bioinformatics or Data Sciences) Location: Mississauga, CAD Pay Rate: DOE   Requirements: B.S. or M.S. in Computer Science, Data Sciences, Bioinformatics, Biomedical engineering or equivalent field 5+ years of experience in software development or software test engineering or data engineering Proficiency in Python,…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Mensur Dlakic, Istvan Albert, and was edited…

Introduction The incidence and mortality rates of AF are continuously increasing, leading to serious complications such as heart failure and stroke (Fig. 1) (Sagris et al., 2021). The occurrence and development of AF involve different mechanisms and interactions (Kornej et al., 2020). AF often progresses from paroxysmal to persistent (Nattel…