Tag: biomaRt

Deleting a column from data frame and then running DESeq2

Forgive me if this post is messy, I’m new to this! I’m analyzing RNA Seq data and found that one of my samples is an outlier (sample AV17). I’m trying to exclude it from my analysis, but whenever I do, using this code: dds = subset(countData, select = -c(AV17) ),…

Continue Reading Deleting a column from data frame and then running DESeq2

Characterization of runs of Homozygosity revealed genomic inbreeding and patterns of selection in indigenous sahiwal cattle

Almeida OAC, Moreira GCM, Rezende FM et al (2019) Identification of selection signatures involved in performance traits in a paternal broiler line. BMC Genomics 20:1–20. https://doi.org/10.1186/s12864-019-5811-1 Article  Google Scholar  Alshawi A, Essa A, Al-Bayatti S, Hanotte O (2019) Genome Analysis Reveals Genetic Admixture and Signature of Selection for Productivity and…

Continue Reading Characterization of runs of Homozygosity revealed genomic inbreeding and patterns of selection in indigenous sahiwal cattle

ORA with clusterProfiler

Hello everyone, I am trying to do an enrichment analysis of Arabidopsis data, however I am still wondering how to build it or what to use as a background (universe), could you guide me? I am working with this example. diff_genes <- read_delim(file = “differential_genes.tsv”, delim = “\t”) biomartr::organismBM(organism =…

Continue Reading ORA with clusterProfiler

ScRNAseq analysis scran :: quickcluster Error

ScRNAseq analysis scran :: quickcluster Error 1 @d4a334e3 Last seen 15 hours ago Germany Hello! I am having an error while doing normalization for my scRNAseq data, I would appreciate the help of anyone who countered the same problem the error is during quickcluster command as follow: clust <- quickCluster(sce)…

Continue Reading ScRNAseq analysis scran :: quickcluster Error

r – Copying host libraries in the image build from my Dockerfile

Is it possible to copy a local .Rprofile file from the host, during the building of the image with a Dockerfile ? I would like to copy this .Rprofile file in the following directory : /home/rstudio I had my Dockerfile as follow : FROM rocker/rstudio:4.2.0 as builder ARG bioc_ver=3.16 RUN…

Continue Reading r – Copying host libraries in the image build from my Dockerfile

How to do KEGG pathway analysis when I have a gene with multiple entrez IDs?

How to do KEGG pathway analysis when I have a gene with multiple entrez IDs? 0 Hello, I did DESeq2 on my samples and I have a list of DEGs that I would like to do kegg pathway analysis on. For DESeq2 I used biomart and tximport to assign external…

Continue Reading How to do KEGG pathway analysis when I have a gene with multiple entrez IDs?

Is there a way to query Ensembl to get all 3’UTRs from all species?

Is there a way to query Ensembl to get all 3’UTRs from all species? 1 I am trying to obtain stats on how many 3’UTRs are annotated in Ensembl. I would really like to download the as many annotated 3’UTRs as possible from as many species as possible and find…

Continue Reading Is there a way to query Ensembl to get all 3’UTRs from all species?

Gene Knockdown Market: Beating Growth Expectations

Gene Knockdown Market Latest Study on Industrial Growth of Gene Knockdown Market 2023-2029. A detailed study accumulated to offer the Latest insights about acute features of the Gene Knockdown market. The report contains different market predictions related to revenue size, production, CAGR, Consumption, gross margin, price, and other substantial factors….

Continue Reading Gene Knockdown Market: Beating Growth Expectations

How To Get Chromosome Position Given Rs Number?

How To Get Chromosome Position Given Rs Number? 3 I have a list of a few hundred SNPs given by rs number. I want to get the chromosome and position for each SNP. For example: input: rs4477212 output: chr1:82154 snp chromosome position • 29k views you can download this information…

Continue Reading How To Get Chromosome Position Given Rs Number?

Bioconductor – GenomicRanges

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see GenomicRanges. Representation and manipulation of genomic intervals Bioconductor version: 2.14 The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyze high-throughput sequencing…

Continue Reading Bioconductor – GenomicRanges

Bioconductor – TCGAbiolinks

DOI: 10.18129/B9.bioc.TCGAbiolinks     TCGAbiolinks: An R/Bioconductor package for integrative analysis with GDC data Bioconductor version: Release (3.5) The aim of TCGAbiolinks is : i) facilitate the GDC open-access data retrieval, ii) prepare the data using the appropriate pre-processing strategies, iii) provide the means to carry out different standard analyses…

Continue Reading Bioconductor – TCGAbiolinks

biomaRt Ensembl version 83 (mouse)

biomaRt Ensembl version 83 (mouse) 0 Hello, I’m looking for an old Ensemb release (83) for GRCm38 build: library(biomaRt) mouse <- useEnsembl(biomart = “genes”, dataset=”mmusculus_gene_ensembl”, version=83) Error: Specified Ensembl version is not available. Use listEnsemblArchives() to view available versions. Version 83 is not displayed in the list of Ensembl archives…

Continue Reading biomaRt Ensembl version 83 (mouse)

Genbank Protein accession numbers to gene name

Genbank Protein accession numbers to gene name 0 Hi, I have Genebank Protein accession numbers and trying to identify the genes that code for these proteins. I am working with Toxoplasma gondii RH and here are some of my accession numbers: TGRH88_000010 TGRH88_000020 TGRH88_000030 TGRH88_000040 TGRH88_000050 TGRH88_000060 TGRH88_000070 TGRH88_000080 I…

Continue Reading Genbank Protein accession numbers to gene name

How to get just protein_coding genes using biomart in R

How to get just protein_coding genes using biomart in R 2 Dear all, I would like to have help with getting just protein_coding genes from gene expression file using biomart. What I have is a file of all genes expression for mouse (mm10) with ensemble gene_names, and I need to…

Continue Reading How to get just protein_coding genes using biomart in R

couldn’t find matching transcriptome, returning non-ranged SummarizedExperiment AND unable to find an inherited method for function ‘seqinfo’ for signature ‘”SummarizedExperiment”‘

Dear Michael, I have not been able to run tximeta properly. I have read #38 but could not get any clue. The quant.sf files were generated by the latest nf-core RNA-seq pipeline (3.12.0), as the pipeline did not save the Salmon index, I generated it myself. Salmon used by nf-core…

Continue Reading couldn’t find matching transcriptome, returning non-ranged SummarizedExperiment AND unable to find an inherited method for function ‘seqinfo’ for signature ‘”SummarizedExperiment”‘

Error in Gviz (actually, rtracklayer)

Error in Gviz (actually, rtracklayer) | IdeogramTrack 0 @25075190 Last seen 7 minutes ago South Korea When I run this code (below) iTrack <- IdeogramTrack(genome = “hg19”, chromosome = “chr2”, name = “”) then I get the error Error: failed to load external entity “http://genome.ucsc.edu/FAQ/FAQreleases” Did someone else encounter this…

Continue Reading Error in Gviz (actually, rtracklayer)

Annotation hub and clusterProfiler errors

Annotation hub and clusterProfiler errors 1 @33343537 Last seen 4 hours ago Norway How can I get AnnotationHub() run? Also, clusterProfiler is not working because I am unable to install HPO.db > ah <- AnnotationHub() **Error in `collect()`: ! Failed to collect lazy table. Caused by error in `db_collect()` >…

Continue Reading Annotation hub and clusterProfiler errors

Map genome positions onto protein coordinates?

I am looking for a way to do the following 1) reliably find a protein structure e.g. pdb file or pre-computed alphafold results that is associated with a particular gene/transcript isoform. I found a way to do this somewhat for human genes using biomart, but i’d like to be able…

Continue Reading Map genome positions onto protein coordinates?

Eukaryotic Genome Annotation | Genome Annotation Pipeline

PASAPASA was originally developed at The Institute for Genomic Research in 2002 as an effort to automatically improve gene structures in Arabidopsis thaliana. Since then, it has been applied to numerous Eukaryotic genome annotation projects including Rice, Aspergillus species, Plasmodium falciparum, Schistosoma mansoni, Aedes aegypti, mouse, human, among others. Functions of PASA…

Continue Reading Eukaryotic Genome Annotation | Genome Annotation Pipeline

Systematic differences in discovery of genetic effects on gene expression and complex traits

Claussnitzer, M. et al. A brief history of human disease genetics. Nature 577, 179–189 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  Maurano, M. T. et al. Systematic localization of common disease-associated variation in regulatory DNA. Science 337, 1190–1195 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  Gusev, A. et…

Continue Reading Systematic differences in discovery of genetic effects on gene expression and complex traits

Error creating SPIA data for KEGG Orthology (KO) Database KEGG xml files

Hi all, I’m trying to create a SPIA data file for all 483 xml files for the KEGG Orthology (KO) Database. I’m working with a non-model organism that is not supported by KEGG as it’s own organism, so I have to use the KEGG Orthology (KO) Database instead of a…

Continue Reading Error creating SPIA data for KEGG Orthology (KO) Database KEGG xml files

Bioconductor – dagLogo

DOI: 10.18129/B9.bioc.dagLogo     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see dagLogo. dagLogo: a Bioconductor package for visualizing conserved amino acid sequence pattern in groups based on probability theory Bioconductor version: 3.15 Visualize significant conserved amino acid sequence pattern in groups based…

Continue Reading Bioconductor – dagLogo

map Ensembl gene ID from hg19 to hg38

map Ensembl gene ID from hg19 to hg38 0 Hello! I would like to convert Ensembl gene ID from hg19 to hg38 with R. I tried with this code: ensembl <- useMart(“ensembl”, dataset = “hsapiens_gene_ensembl”, host= “grch37.ensembl.org”) ensembl_ids <- c(“ENSG00000183878”, “ENSG00000146083”) converted_ids <- getLDS(attributes = c(“ensembl_gene_id”), filters = “ensembl_gene_id”, values…

Continue Reading map Ensembl gene ID from hg19 to hg38

Gene Knockdown Market Analysis to 2029

Statsndata published a report on the process of collecting, analyzing and interpreting Gene Knockdown Market data. New published reports on companies to collect, analyze and interpret Gene Knockdown market data. This not only accelerates individual business growth but also contributes to the overall progress of entire service-industries Industry. Get a…

Continue Reading Gene Knockdown Market Analysis to 2029

Simulation of undiagnosed patients with novel genetic conditions

Simulated patient initialization We simulate patients for each of the 2134 diseases in Orphanet20 (orphadata.org, accessed October 29, 2019) that do not correspond to a group of clinically heterogeneous disorders (i.e., Orphanet’s “Category” classification31), have at least one associated phenotype, and have at least one causal gene. For Orphanet diseases…

Continue Reading Simulation of undiagnosed patients with novel genetic conditions

KEGG Pathway analysis for non-model organism using goseq

KEGG Pathway analysis for non-model organism using goseq 0 Dear all, I have to perform KEGG Pathway analysis of wheat DEGs (differentially expressed genes). I found goseq in R but wheat is not native organism. For GO term analysis of wheat I first retrieved GO term IDs from biomart and…

Continue Reading KEGG Pathway analysis for non-model organism using goseq

Bioconductor – MouseFM

DOI: 10.18129/B9.bioc.MouseFM   In-silico methods for genetic finemapping in inbred mice Bioconductor version: Release (3.17) This package provides methods for genetic finemapping in inbred mice by taking advantage of their very high homozygosity rate (>95%). Author: Matthias Munz [aut, cre] , Inken Wohlers [aut] , Hauke Busch [aut] Maintainer: Matthias…

Continue Reading Bioconductor – MouseFM

How to assign gene names after kallisto when I add GFP?

How to assign gene names after kallisto when I add GFP? 1 Hello, I would like to generate a new reference for kallisto where I add GFP. I found this link: https://github.com/igordot/genomics/blob/master/workflows/ref-genome-gfp.md and it seems pretty straightforward to add the GFP for the alignment. However, I am not sure how…

Continue Reading How to assign gene names after kallisto when I add GFP?

biomaRT doesn’t report uniprot id

biomaRT doesn’t report uniprot id 1 Hi all, I’m working with UniProtKB and would like to get the genomic coordinates of list of proteins. To my knowledge, the first step is to retrieve the mapping between uniprot and ensemble via biomaRT: annotLookup <- getBM( mart = mart, attributes = c(…

Continue Reading biomaRT doesn’t report uniprot id

Dataset’s name in BioMart for S. pombe

Dataset’s name in BioMart for S. pombe 2 Can anybody help me to find the dataset for s. pombe on BioMart? And also some help on how to use makeTranscriptDbFromBiomart to create TranscriptDB? cheers, S.pombe BioMart dataset • 3.6k views Looks like you figured out another way of getting what…

Continue Reading Dataset’s name in BioMart for S. pombe

KCNQ potassium channels modulate Wnt activity in gastro-oesophageal adenocarcinomas

Introduction The KCNQ (potassium voltage-gated channel subfamily Q) family of ion channels encode potassium transporters (1). KCNQ proteins typically repolarise the plasma membrane of a cell after depolarisation by allowing the export of potassium ions, and are therefore involved in wide-ranging biological functions including cardiac action potentials (2), neural excitability…

Continue Reading KCNQ potassium channels modulate Wnt activity in gastro-oesophageal adenocarcinomas

Hugo_Symbol to Entrez ID

Hello, I have Myeloid-Acute Myeloid Leukemia (AML) RNAseq data file data_mrna_seq_rpkm.csv. This file has Hugo_Symbols for all 22,844 genes but not its Entrez IDs. I was able use to two methods in R programming 1) library(org.Hs.eg.db) mapIDs method and 2) biomaRT method to get the entrez_ID of only 16,569 genes…

Continue Reading Hugo_Symbol to Entrez ID

Gene Knockdown Market Size, Share 2023 To 2030

PRESS RELEASE Published September 18, 2023 The “Gene Knockdown” market research report provides a comprehensive analysis of the global market for Gene Knockdown Market. It offers insights into market trends, growth drivers, challenges, and key players. The report covers product types, applications, and regional segments, detailing market size, share, and…

Continue Reading Gene Knockdown Market Size, Share 2023 To 2030

Convert gene id’s to gene symbol preserving gene id’s in deseq2

Convert gene id’s to gene symbol preserving gene id’s in deseq2 0 Good evening, I have a dds object with gene id’s, and I need to convert them into gene symbols. The point is that some genes do not have a match and I don’t want to lose them in…

Continue Reading Convert gene id’s to gene symbol preserving gene id’s in deseq2

Global Gene Knockdown Market 2023-2030: COVID-19, Russia-Ukraine War, SWOT and Porter’s Analysis

Gene Knockdown Market 2023-2030 Latest Research Report provides [108 Pages Report] with a detailed analysis of qualitative and quantitative research such as interviews, focus groups, observations, content analysis, numerical data, and applying statistical methods for analysis. This research aims to quantify relationships, patterns, and trends within the data. Moreover, this…

Continue Reading Global Gene Knockdown Market 2023-2030: COVID-19, Russia-Ukraine War, SWOT and Porter’s Analysis

TCGAbiolinks not working anymore

TCGAbiolinks not working anymore 0 The script in this tutorial does not work anymore https://bioconductor.org/packages/devel/bioc/vignettes/TCGAbiolinks/inst/doc/analysis.html I get to GDCprepare stage and get error: Starting to add information to samples => Add clinical information to samples => Adding TCGA molecular information from marker papers => Information will have prefix paper_ brca…

Continue Reading TCGAbiolinks not working anymore

Bioconductor – SummarizedBenchmark

DOI: 10.18129/B9.bioc.SummarizedBenchmark   Classes and methods for performing benchmark comparisons Bioconductor version: Release (3.17) This package defines the BenchDesign and SummarizedBenchmark classes for building, executing, and evaluating benchmark experiments of computational methods. The SummarizedBenchmark class extends the RangedSummarizedExperiment object, and is designed to provide infrastructure to store and compare the…

Continue Reading Bioconductor – SummarizedBenchmark

Identifying transcription factors for a list of genes

Identifying transcription factors for a list of genes 1 Is there a way to find transcription factors for mouse genes if Ensemble IDs are known? In an article I’m trying to recreate, transcription factor features were retrieved from GTRD database, which is no longer in service. Here is the study…

Continue Reading Identifying transcription factors for a list of genes

DESeq2 results – Annotating and exporting results

Hi, I am working with isoforms.results from RSEM analysis. I am trying to annotate my deseq results with symbol and entrez IDs, following the vignette http://master.bioconductor.org/packages/release/workflows/vignettes/rnaseqGene/inst/doc/rnaseqGene.html#annotating-and-exporting-results Unfortunately, I cannot export them as a csv file because the 2 elements I am adding are list. do you have any idea how…

Continue Reading DESeq2 results – Annotating and exporting results

Creating Double The Columns Than There Are Samples: DEXseq

I am trying to use DEXseq and I was told that I could output normalized counts using the following method by my supervisor: library(“DEXSeq”) # Create the DEXSeqDataSet object dxd <- DEXSeqDataSetFromHTSeq( countsFiles, sampleData=sampleTable, design= ~ sample + exon + condition:exon, flattenedfile=flattenedFile ) #Normalize normFactors <- matrix(runif(nrow(dxd)*ncol(dxd),0.5,1.5), ncol=ncol(dxd),nrow=nrow(dxd), dimnames=list(1:nrow(dxd),1:ncol(dxd))) normFactors…

Continue Reading Creating Double The Columns Than There Are Samples: DEXseq

Getting CDS 5’/CDS3′ incomplete flags info from ENSEMBL using biomaRt

Getting CDS 5’/CDS3′ incomplete flags info from ENSEMBL using biomaRt 0 @alioghabian-8516 Last seen 10 hours ago Finland Hi ! I was wondering how I can get (In R) the ENSEMBL ID of all transcripts that have been flagged with “CDS 5′ incomplete”, “CDS3′ incomplete” and “CDS 5′ and CDS3′…

Continue Reading Getting CDS 5’/CDS3′ incomplete flags info from ENSEMBL using biomaRt

Bioconductor – cellTree

DOI: 10.18129/B9.bioc.cellTree     This package is for version 3.14 of Bioconductor; for the stable, up-to-date release version, see cellTree. Inference and visualisation of Single-Cell RNA-seq data as a hierarchical tree structure Bioconductor version: 3.14 This packages computes a Latent Dirichlet Allocation (LDA) model of single-cell RNA-seq data and builds…

Continue Reading Bioconductor – cellTree

How to assign gene names to ensembl IDs if species not in Biomart

How to assign gene names to ensembl IDs if species not in Biomart 0 Hello, I would like to align my data to bGalGal1.pat.whiteleghornlayer.GRCg7w. I found the link on ensembl so I already made my index for kallisto. After mapping I normally use biomart to assign gene names to the…

Continue Reading How to assign gene names to ensembl IDs if species not in Biomart

Gene Knockdown Market Financial Performance, Strategic Developments, and Key Trends 2023-2030 With Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

PRESS RELEASE Published August 9, 2023 A biological method called gene knockdown is used to lower the expression of a certain gene in an organism’s cells. This is often accomplished by introducing short RNA molecules that are complementary to the messenger RNA (mRNA) of the target gene, such as small…

Continue Reading Gene Knockdown Market Financial Performance, Strategic Developments, and Key Trends 2023-2030 With Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

Unsupervised clustering on gene expression data

Clustering is a data mining method to identify unknown possible groups of items solely based on intrinsic features and no external variables. Basically, clustering includes four steps: 1) Data preparation and Feature selection, 2) Dissimilarity matrix calculation, 3) applying clustering algorithms, 4) Assessing cluster assignment I use an RNA-seq dataset…

Continue Reading Unsupervised clustering on gene expression data

Gene Knockdown Market Trends and Opportunities and Forecast to 2030

PRESS RELEASE Published August 8, 2023 Latest Report: Trends and Top Manufacturers analysis of “Gene Knockdown Market” Forecast to 2028 shared by Infinitybusinessinsights.com. This report will help the viewer in Better Decision Making. At a CAGR of 31% over the period of forecasting (2023-2029), the Gene Knockdown Market is anticipated…

Continue Reading Gene Knockdown Market Trends and Opportunities and Forecast to 2030

Recombinant Rat Epcam protein, hFc-tagged Epcam-7481R

Home / Products / Recombinant Proteins / Recombinant Rat Epcam protein, hFc-tagged Recombinant Rat Epcam protein, hFc-tagged Online Inquiry Epcam Related Products By Species By Source By Tag Price Inquiry Welcome! For price inquiries, please feel free to contact us through the…

Continue Reading Recombinant Rat Epcam protein, hFc-tagged Epcam-7481R

multiple probe-ids matching to the same gene symbol but different ensembl_gene_id

Microarray – multiple probe-ids matching to the same gene symbol but different ensembl_gene_id 0 Hello all, Newbie in microarray analysis here – I am currently trying to do some differential analysis from some microarray data (Affymetrix). I know that the probe used in the experiment was HG U95A. I am…

Continue Reading multiple probe-ids matching to the same gene symbol but different ensembl_gene_id

Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification

Human study The study was approved by the institutional review boards (Ethics Commission of the Medical Faculty of Technical University Munich (protocol 193/17S) and Ethics Committee of the Medical Faculty of Heidelberg University (protocol S-206/2011)) and all patients provided written informed consent under these protocols. The study was conducted in…

Continue Reading Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification

Bioconductor – LACE

DOI: 10.18129/B9.bioc.LACE   Longitudinal Analysis of Cancer Evolution (LACE) Bioconductor version: Release (3.17) LACE is an algorithmic framework that processes single-cell somatic mutation profiles from cancer samples collected at different time points and in distinct experimental settings, to produce longitudinal models of cancer evolution. The approach solves a Boolean Matrix…

Continue Reading Bioconductor – LACE

Biomart doesnt work in R for big input data. How to run it in Python ?

Biomart doesnt work in R for big input data. How to run it in Python ? 0 I am trying to use Biomart for a list of variants (with rs ids) to retrieve the consequence_types for each variant but as because my file is too big (80621 entries) i am…

Continue Reading Biomart doesnt work in R for big input data. How to run it in Python ?

Retrieve only protein coding esnsemble gene ids and gene symbols

Retrieve only protein coding esnsemble gene ids and gene symbols 1 I tried without success different ways to retrieve the current list of ensemble gene ids including the gene symbol for only protein coding genes by using the R library Biomart. Here is the code: library(biomaRt) ensembl = useMart(biomart=”ensembl”, dataset=”hsapiens_gene_ensembl”)…

Continue Reading Retrieve only protein coding esnsemble gene ids and gene symbols

reference annotation for the human and mouse genomes in 2023

D942–D949 Nucleic Acids Research, 2023, Vol. 51, Database issue Published online 24 November 2022 https://doi.org/10.1093/nar/gkac1071 GENCODE: reference annotation for the human and mouse genomes in 2023 Adam Frankish 1,* , Sı́lvia Carbonell-Sala2 , Mark Diekhans 3 , Irwin Jungreis 4,5 , Jane E. Loveland 1 , Jonathan M. Mudge1 ,…

Continue Reading reference annotation for the human and mouse genomes in 2023

Mapping Ensembl Gene IDs with dot suffix

Here’s an example of doing the conversion using biomaRt. You can use the versioned IDs you’ve got, but you’ll see it’s better the remove the version numbers. First, we’ll load biomaRt and use your example IDs. library(biomaRt) mart <- useMart(biomart = “ensembl”, dataset = “hsapiens_gene_ensembl”) gene_ids_version <- c(“ENSG00000236246.1”, “ENSG00000281088.1”, “ENSG00000254526.1”,…

Continue Reading Mapping Ensembl Gene IDs with dot suffix

Decreased left heart flow in fetal lambs causes left heart hypoplasia and pro-fibrotic tissue remodeling

Coil implantation in fetal lambs We have complied with all relevant ethical regulations for animal testing. All procedures followed the Canadian Council on Animal Care guidelines and were approved by the University of Western Ontario Council on Animal Care (protocol 2010-257). Time-dated pregnant Dorset × Rideau Arcott ewes (gestational age 76 days,…

Continue Reading Decreased left heart flow in fetal lambs causes left heart hypoplasia and pro-fibrotic tissue remodeling

Retrieve rs IDs from chromossome location info on hg19 build

Retrieve rs IDs from chromossome location info on hg19 build 0 Hello, community! I am wondering if it is possible to obtain rs IDs of variants when the information I have are like this: chr1:123456 123456 123456 A G The column names are “variant_id”, “start_hg19”, “end_hg19” “ref”, “alt”, respectively. I…

Continue Reading Retrieve rs IDs from chromossome location info on hg19 build

biomaRt vs Org.hs.eg.db for Gene Annotation After Differential Expression

biomaRt vs Org.hs.eg.db for Gene Annotation After Differential Expression 0 I completed a differential gene expression analysis and I essentially have close to 3000 genes that pass all filters (adj p-value and log2FC). I want to run some sort of downstream analysis (GSEA or something else) on these genes so…

Continue Reading biomaRt vs Org.hs.eg.db for Gene Annotation After Differential Expression

Gene Knockdown Market 2023 Growth Drivers and Future Outlook 2030| Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

The gene knockdown market refers to the global market for technologies, products, and services related to gene knockdown, a technique used to decrease or suppress the expression of specific genes in living organisms. Gene knockdown involves reducing the activity or presence of a target gene’s protein product, typically through the…

Continue Reading Gene Knockdown Market 2023 Growth Drivers and Future Outlook 2030| Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

Gene Knockdown Market 2023 Growth Drivers and Future Outlook

Recently updated research study “Gene Knockdown Industry 2023-2031 Key Trends and Projection” available with OrbisResearch.com Numerous businesses are vying for a sizeable market position in the highly competitive global Gene Knockdown market. The market is characterized by fierce rivalry and ongoing innovation as businesses strive to provide distinctive Gene Knockdown solutions…

Continue Reading Gene Knockdown Market 2023 Growth Drivers and Future Outlook

Convert Human to Mouse Symbols

I’m trying to create a working function that takes a column of human gene symbols as input and outputs a vector of mouse gene symbols that is the same length. (I’m trying to use the function to replace the human genes in a dataframe with mouse genes) I have tried…

Continue Reading Convert Human to Mouse Symbols

IsoformSwitchAnalyzeR Error in reading GTF file

IsoformSwitchAnalyzeR Error in reading GTF file 0 Hi, I am using IsoformSwitchAnalyzeR v1.21.0 in R 4.3.0 environment using RStudio (2023.06.0+421 “Mountain Hydrangea” Release). When I try to import GTF file (obtained from Ensembl Plants) I get the following error ; Step 1 of 7: Checking data… Step 2 of 7:…

Continue Reading IsoformSwitchAnalyzeR Error in reading GTF file

VariantFiltering error

VariantFiltering error 0 @andrew-beggs-5579 Last seen 15 hours ago United Kingdom Hi Trying to run VariantFilter, manage to import fine, PED file is pretty standard: FAM001 SAMPLE_C SAMPLE_P1 SAMPLE_P2 1 2 FAM001 SAMPLE_P1 0 0 0 1 FAM001 SAMPLE_P2 0 0 0 1 > vfpar VariantFiltering parameter object VCF file(s):…

Continue Reading VariantFiltering error

DESeq2 with nbinomGLM issues

DESeq2 with nbinomGLM issues 0 @andrebolerbarros-16788 Last seen 6 hours ago Portugal Hi everyone, I was performing some DEGs and got this message: Warning messages: 1: In nbinomGLM(x = x, Y = YNZ, size = size, weights = weightsNZ, … : the line search routine failed, possibly due to insufficient…

Continue Reading DESeq2 with nbinomGLM issues

Adipogenic and SWAT cells separate from a common progenitor in human brown and white adipose depots

Human samples Human adipogenic progenitor cells were isolated from the stromal vascular fraction of adipose tissue samples on the day they were obtained (surgery or biopsy) from four regions: (1) visceral adipose tissue (obtained during gallbladder surgery); (2) perirenal adipose tissue (obtained during nephrectomy surgery); (3) abdominal subcutaneous adipose tissue…

Continue Reading Adipogenic and SWAT cells separate from a common progenitor in human brown and white adipose depots

Profitable Strategic Report on Mammalian Cell Expression System Market With Included Analysis of New Trends, Updates, and Forecast to 2030

The latest competent intelligence report published by WMR with the title “An Increase in Demand and Opportunities for Global Mammalian Cell Expression System Market 2023″ provides a sorted image of the Mammalian Cell Expression System industry by analysis of research and information collected from various sources that have the ability…

Continue Reading Profitable Strategic Report on Mammalian Cell Expression System Market With Included Analysis of New Trends, Updates, and Forecast to 2030

Bioconductor – chromPlot

DOI: 10.18129/B9.bioc.chromPlot     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see chromPlot. Global visualization tool of genomic data Bioconductor version: 3.13 Package designed to visualize genomic data along the chromosomes, where the vertical chromosomes are sorted by number, with sex chromosomes at…

Continue Reading Bioconductor – chromPlot

Bioconductor Unevensamplesizes

Answer: multiple filters in biomaRt by RuBBiT0 &utrif; 10 First, yes, one gene could be related to several GO ID, and the result is based on the annotation package you use. Second, could you pro… Comment: Diffbind “No genome detected” by kyliecode • 0 Hi Dr. Stark, Thanks very…

Continue Reading Bioconductor Unevensamplesizes

Epigenetic dysregulation from chromosomal transit in micronuclei

Cell culture Cell lines (MDA-MB-231, 4T1 and RPE-1) were purchased from the American Type Culture Collection (ATCC). TP53-knockout MCF10A, TP53-knockout RPE-1 and Trex1 knockout 4T1 cells were gifts from the Maciejowski laboratory at the Memorial Sloan Kettering Cancer Center (MSKCC). OVCAR-3 cells were a gift from J. D. Gonzales. All…

Continue Reading Epigenetic dysregulation from chromosomal transit in micronuclei

Genetic studies of paired metabolomes reveal enzymatic and transport processes at the interface of plasma and urine

Study design and participants The GCKD study is an ongoing prospective observational study that enrolled 5,217 adult persons with CKD between 2010 and 2012. Patients regularly seen by nephrologists with eGFR between 30 and 60 ml min−1 per 1.73 m2 or eGFR >60 ml min−1 per 1.73 m2 with UACR > 300 mg per g (or urinary protein/creatinine ratio > 500 mg…

Continue Reading Genetic studies of paired metabolomes reveal enzymatic and transport processes at the interface of plasma and urine

Bioconductor – trackViewer

DOI: 10.18129/B9.bioc.trackViewer   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see trackViewer. A R/Bioconductor package with web interface for drawing elegant interactive tracks or lollipop plot to facilitate integrated analysis of multi-omics data Bioconductor version: 3.16 Visualize mapped reads along with annotation as…

Continue Reading Bioconductor – trackViewer

Handling NA’s in Deseq2

Hi everyone First of all thank you for making rna-seq data much more accessible to an average clinical doctor through the DEseq2 packages and vignettes. I am though running into some trouble: I have a dataset of Nanostring mRNA-data from clinical study, which later was followed up. I therefore have…

Continue Reading Handling NA’s in Deseq2

Bioconductor Relativeabundance

Comment: Use with_go along with other filters in getBM function by RuBBiT0 &utrif; 10 Hi @mike-smith , you are correct. I was trying to select the ones that have some GO annotations by using the `with_go` filter. I was confus… Answer: Can VST-transformed community composition data be expressed as relative…

Continue Reading Bioconductor Relativeabundance

Bioconductor – gpart

DOI: 10.18129/B9.bioc.gpart     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see gpart. Human genome partitioning of dense sequencing data by identifying haplotype blocks Bioconductor version: 3.13 we provide a new SNP sequence partitioning method which partitions the whole SNP sequence based on…

Continue Reading Bioconductor – gpart

Active Recombinant Human FGFR2 protein, GST-tagged FGFR2-18H

Home / Products / Recombinant Proteins / Active Recombinant Human FGFR2 protein, GST-tagged Active Recombinant Human FGFR2 protein, GST-tagged Online Inquiry FGFR2 Related Products By Species By Source By Tag Price Inquiry Welcome! For price inquiries, please feel free to contact us…

Continue Reading Active Recombinant Human FGFR2 protein, GST-tagged FGFR2-18H

How to process (seems) Agilent microarrry data?

Edit September 5, 2019 NB – this original answer is for 1-colour (channel) Agilent data. Another generic pipeline for 2-colour Agilent is here: A: build the expression matrix step by step from GEO raw data ————— Limma can be used to process Agilent microarray data. Assuming that your data is…

Continue Reading How to process (seems) Agilent microarrry data?

Bioconductor IlluminaHumanv3.db

Answer: How to update a package at Bioconductor by shepherl 3.4k Is it possible to have the original maintainer email at bioc-devel@r-project.org saying they allow the maintainer update cc’ing the new mai… Comment: Error: biomaRt has encountered an unexpected server error. by swbarnes2 &starf; 1.2k Always worth checking in the…

Continue Reading Bioconductor IlluminaHumanv3.db

Bioconductor – phenoTest

DOI: 10.18129/B9.bioc.phenoTest     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see phenoTest. Tools to test association between gene expression and phenotype in a way that is efficient, structured, fast and scalable. We also provide tools to do GSEA (Gene set enrichment analysis)…

Continue Reading Bioconductor – phenoTest

Comparing gene expression with copy number variation in TCGA

Hello, I want to compare (with a PCA) gene expression against copy number variation at gene level in a TCGA project.When I retrieve the gene expression every value is mapped by sample and gene. But for the copy number variation, I get only chromosomal locations.To do the PCA, I want…

Continue Reading Comparing gene expression with copy number variation in TCGA

Solved Q7. Load the following 3 packages: BSGenome,

Q7. Load the following 3 packages: BSGenome, preprocessCore, biomaRt ## if they arent available under your packages in rstudio cloud, please use: install.packages(BiocManager) BiocManager::install(“biomaRt”) #Q8. Create a DNAString with the following sequence: **CATCACACAGCATGACCCCCATGACGATAAACGTC** and save it in a variable of your choosing. #Q9. From the sequence you created, extract the…

Continue Reading Solved Q7. Load the following 3 packages: BSGenome,

Mammalian Cell Expression System Market Driven by the Increasing Need for Complex Protein Expression

Global Mammalian Cell Expression System Market Overview: The Mammalian Cell Expression System market refers to the market for quick-acting packaging solutions. These types of packaging solutions are designed to offer convenient and efficient ways of storing, transporting, and dispensing a variety of products. The Mammalian Cell Expression System market includes…

Continue Reading Mammalian Cell Expression System Market Driven by the Increasing Need for Complex Protein Expression

Seurat scRNA convert Ensembl ID to gene symbol

Hi, I’m download some datasets from Geo Database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE155960) I found the names are in ENSEMBL nomenclature and I need to convert into Gene symbol in order to do the QC metrics in the Seurat pipeline. I’m using this code to convert the ENSEMBL to gene symbol: library(Seurat) library(patchwork) library…

Continue Reading Seurat scRNA convert Ensembl ID to gene symbol

Bioconductor – GenomicOZone

DOI: 10.18129/B9.bioc.GenomicOZone   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see GenomicOZone. Delineate outstanding genomic zones of differential gene activity Bioconductor version: 3.16 The package clusters gene activity along chromosome into zones, detects differential zones as outstanding, and visualizes maps of outstanding zones…

Continue Reading Bioconductor – GenomicOZone

How to convert chromosome locations to gene symbols?

How to convert chromosome locations to gene symbols? 0 Hi. I wonder how to convert chromosome locations to gene symbols. An example of chromosome locations name is ‘chr1: 44959708-45072070’. There are many chromosome locations. I want the chromosome location names to gene symbols. Should I use ‘biomaRt’ package? If I…

Continue Reading How to convert chromosome locations to gene symbols?

get allele frequency (MAF) value from snp

get allele frequency (MAF) value from snp 0 Hi all! 🙂 I have a list of snp ids, to which I need their correspodning MAF (minor allele frequency) values. I tried to do it in R using biomaRt but it seems that it is not possible- correct me if I…

Continue Reading get allele frequency (MAF) value from snp

Gene Knockdown Market Booming at a CAGR of +20% by 2030 |Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

PRESS RELEASE Published May 5, 2023 New Jersey, N.J, May. 05, 2023 (Digital Journal) Gene knockdown is a technique used in molecular biology to decrease the expression of a gene of interest. This can be accomplished using RNA interference (RNAi), a technique that uses short strands of RNA to specifically…

Continue Reading Gene Knockdown Market Booming at a CAGR of +20% by 2030 |Santa Cruz Biotechnology (US), OriGene (US), Sigma-Aldrich (US)

trouble getting gene names from biomaRt

I have an excel file, which contains columns chrom, pos, id, ref and alt. I want to add a new column, which will have the name of the genes for the corresponding rows. For that I am using getBM() function in biomaRt, but it takes too much time to finish….

Continue Reading trouble getting gene names from biomaRt

Why do I get zero results when doing DE on microarray data with lemma?

I’ve downloaded the CEL files from GSE154619 and want to run a DE test for multiple contrasts. In essence, this data has two treatments(drug vs control) in two tissues. Here’s my code: suppressPackageStartupMessages({ library(affy) library(oligo) library(limma) library(pd.clariom.s.mouse) library(clariomsmousetranscriptcluster.db) library(biomaRt) }) data_dir <- ‘./data/DpQ/GSE154619/’ metadata <- data.frame( treatment = factor(ifelse(grepl(‘DQ’, all_files),…

Continue Reading Why do I get zero results when doing DE on microarray data with lemma?

Bioconductor – Bioconductor 3.17 Released

Home Bioconductor 3.17 Released April 26, 2023 Bioconductors: We are pleased to announce Bioconductor 3.17, consisting of 2230 software packages, 419 experiment data packages, 912 annotation packages, 27 workflows and 3 books. There are 79 new software packages, 7 new data experiment packages, no new annotation packages, 2 new workflows,…

Continue Reading Bioconductor – Bioconductor 3.17 Released

Package won’t load in Rstudio (but does in R console) – RStudio IDE

Hello, I have upgraded my MacOs to Ventura 13.3.1, then Xquartz, before installing R v4.3 (Intel) and associated Rstudio from the posit website. After package installation through the BiocManager tool, it looks that a few packages can’t load including GenomicFeaturesLoading required package: GenomicFeaturesLoading required package: GenomicRangesError: package or namespace load…

Continue Reading Package won’t load in Rstudio (but does in R console) – RStudio IDE

TAIR Gene Symbols

Hey, There are two approaches here. 1, org.At.tair.db You can use the annotation DB packages from Bioconductor, specifically org.At.tair.db. Copying my own answer from here: A: Biomart query returns NA when searching for entrez_id, while manual search works library(org.At.tair.db) genes <- c(“AT2G14610″,”AT4G23700″,”AT3G26830”, “AT3G15950″,”AT3G54830″,”AT5G24105”) keytypes(org.At.tair.db) mapIds(org.At.tair.db, keys = genes, column =…

Continue Reading TAIR Gene Symbols

Struggling with protein context of Annovar output

Struggling with protein context of Annovar output 0 Hi, Im having some troubles extracting the protein sequences of missense mutations from annovar output files. I would like to create all of the possible neopeptides arising from missense mutations of TCGA tumor samples. For this I used Annovar to get the…

Continue Reading Struggling with protein context of Annovar output

Missing Gene Symbols From Mgi With Biomart (Mouse)

Missing Gene Symbols From Mgi With Biomart (Mouse) 1 I’m trying to use biomaRt to get attributes for a bunch of genes. When I try it, I notice that there are some missing values. Can someone tell me why? Ex.: library(biomaRt) mart <- useMart(biomart=”ensembl”, dataset=”mmusculus_gene_ensembl”) results <- getBM(attributes = c(“gene_biotype”,…

Continue Reading Missing Gene Symbols From Mgi With Biomart (Mouse)

budgerigar conversion id from gene names to ensembl ids

budgerigar conversion id from gene names to ensembl ids 1 Hello! I am writing to you as I am trying to solve the following problem: I have a list of gene names from the species Budgerigar (Melopsittacus undulatus) and my ultimate aim is to find the human orthologs in gene…

Continue Reading budgerigar conversion id from gene names to ensembl ids

Bioconductor – GenomicRanges (development version)

This is the development version of GenomicRanges; for the stable release version, see GenomicRanges. The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyzing high-throughput sequencing data (a.k.a. NGS data). The GenomicRanges package defines general purpose containers for storing…

Continue Reading Bioconductor – GenomicRanges (development version)

Finding Pdb File For Specific Transcript

Finding Pdb File For Specific Transcript 1 I would like to find the PDB file (or whatever 3d structure file for proteins that is appropriate) for a specific transcript. I had several problems with that. For example when using ensembl/biomart. When querying its database, lets say for the transcript BRCA1-001,…

Continue Reading Finding Pdb File For Specific Transcript

hg38 Ig regions

hg38 Ig regions 3 Hi, I’m looking for the Immunoglobulin regions coordinates in hg38 assembly. I want to exclude them from my CNV analysis. I know the hg19 regions but I do not want just to liftover them. Many thanks assembly sequence • 2.0k views You can use Ensembl’s BioMart…

Continue Reading hg38 Ig regions

How Can I Compare Differential Expression Data From Mouse And Human?

How Can I Compare Differential Expression Data From Mouse And Human? 3 Hello, I have run differential expression analyses for mouse and human using transcriptome data. I now have a list of genes (Ensembl IDs) differentially expressed in the mouse and a list of genes differentially expressed in the human….

Continue Reading How Can I Compare Differential Expression Data From Mouse And Human?

Comment: None of the keys entered are valid keys for 'ENSEMBL'. Please use the keys metho

In that case let us consider your dataframe: “` data = c(“ENST00000003583.12”, “ENST00000003912.7”, “ENST00000008440.9”, “ENST00000009105.5”, “ENST00000010299.10”, “ENST00000011700.10”, “ENST00000037502.11”, “ENST00000040877.2”, “ENST00000054650.8”, “ENST00000054666.11”, “ENST00000054668.5”, “ENST00000060969.5”, “ENST00000072644.7”, “ENST00000078527.8”, “ENST00000164247.5”, “ENST00000166244.8”, “ENST00000167825.5”, “ENST00000194214.9”, “ENST00000196061.5”, “ENST00000207157.7”) “` Remove the numbers after . “` enst <- gsub("\\.[0-9]*$", "", data) “` then follow the command “` library(biomaRt)…

Continue Reading Comment: None of the keys entered are valid keys for 'ENSEMBL'. Please use the keys metho

Answer: None of the keys entered are valid keys for 'ENSEMBL'. Please use the keys metho

You can use bioMart to solve this problem: Let your data be as follows: “` data = c(“ENST00000234590″,”ENST00000295688″,”ENST00000319248″,”ENST00000436427”, “ENST00000458748”, “ENST00000384384”, “ENST00000524851”, “ENST00000530019”, “ENST00000532872”, “ENST00000610851”, “ENST00000618227”, “ENST00000229239”) “` then, “` library(biomaRt) mart <- useMart("ensembl","hsapiens_gene_ensembl") genes <- getBM(attributes=c("ensembl_transcript_id","external_gene_name","ensembl_gene_id"), filters = "ensembl_transcript_id", values = data, mart = mart) rownames(genes) <- genes$ensembl_transcript_id names(genes) =…

Continue Reading Answer: None of the keys entered are valid keys for 'ENSEMBL'. Please use the keys metho

Bioconductor – Sushi

DOI: 10.18129/B9.bioc.Sushi     This package is for version 3.14 of Bioconductor; for the stable, up-to-date release version, see Sushi. Tools for visualizing genomics data Bioconductor version: 3.14 Flexible, quantitative, and integrative genomic visualizations for publication-quality multi-panel figures Author: Douglas H Phanstiel <dphansti at stanford.edu> Maintainer: Douglas H Phanstiel <dphansti…

Continue Reading Bioconductor – Sushi