Tag: biomaRt

Answer: multiple filters in biomaRt by RuBBiT0 ▴ 10 First, yes, one gene could be related to several GO ID, and the result is based on the annotation package you use. Second, could you pro… Comment: Diffbind “No genome detected” by kyliecode • 0 Hi Dr. Stark, Thanks very…

Cell culture Cell lines (MDA-MB-231, 4T1 and RPE-1) were purchased from the American Type Culture Collection (ATCC). TP53-knockout MCF10A, TP53-knockout RPE-1 and Trex1 knockout 4T1 cells were gifts from the Maciejowski laboratory at the Memorial Sloan Kettering Cancer Center (MSKCC). OVCAR-3 cells were a gift from J. D. Gonzales. All…

Study design and participants The GCKD study is an ongoing prospective observational study that enrolled 5,217 adult persons with CKD between 2010 and 2012. Patients regularly seen by nephrologists with eGFR between 30 and 60 ml min−1 per 1.73 m2 or eGFR >60 ml min−1 per 1.73 m2 with UACR > 300 mg per g (or urinary protein/creatinine ratio > 500 mg…

DOI: 10.18129/B9.bioc.trackViewer   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see trackViewer. A R/Bioconductor package with web interface for drawing elegant interactive tracks or lollipop plot to facilitate integrated analysis of multi-omics data Bioconductor version: 3.16 Visualize mapped reads along with annotation as…

Hi everyone First of all thank you for making rna-seq data much more accessible to an average clinical doctor through the DEseq2 packages and vignettes. I am though running into some trouble: I have a dataset of Nanostring mRNA-data from clinical study, which later was followed up. I therefore have…

Comment: Use with_go along with other filters in getBM function by RuBBiT0 ▴ 10 Hi @mike-smith , you are correct. I was trying to select the ones that have some GO annotations by using the `with_go` filter. I was confus… Answer: Can VST-transformed community composition data be expressed as relative…

DOI: 10.18129/B9.bioc.gpart     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see gpart. Human genome partitioning of dense sequencing data by identifying haplotype blocks Bioconductor version: 3.13 we provide a new SNP sequence partitioning method which partitions the whole SNP sequence based on…

Home / Products / Recombinant Proteins / Active Recombinant Human FGFR2 protein, GST-tagged Active Recombinant Human FGFR2 protein, GST-tagged Online Inquiry FGFR2 Related Products By Species By Source By Tag Price Inquiry Welcome! For price inquiries, please feel free to contact us…

Edit September 5, 2019 NB – this original answer is for 1-colour (channel) Agilent data. Another generic pipeline for 2-colour Agilent is here: A: build the expression matrix step by step from GEO raw data ————— Limma can be used to process Agilent microarray data. Assuming that your data is…

Answer: How to update a package at Bioconductor by shepherl 3.4k Is it possible to have the original maintainer email at bioc-devel@r-project.org saying they allow the maintainer update cc’ing the new mai… Comment: Error: biomaRt has encountered an unexpected server error. by swbarnes2 ★ 1.2k Always worth checking in the…

DOI: 10.18129/B9.bioc.phenoTest     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see phenoTest. Tools to test association between gene expression and phenotype in a way that is efficient, structured, fast and scalable. We also provide tools to do GSEA (Gene set enrichment analysis)…

Hello, I want to compare (with a PCA) gene expression against copy number variation at gene level in a TCGA project.When I retrieve the gene expression every value is mapped by sample and gene. But for the copy number variation, I get only chromosomal locations.To do the PCA, I want…

Q7. Load the following 3 packages: BSGenome, preprocessCore, biomaRt ## if they arent available under your packages in rstudio cloud, please use: install.packages(BiocManager) BiocManager::install(“biomaRt”) #Q8. Create a DNAString with the following sequence: **CATCACACAGCATGACCCCCATGACGATAAACGTC** and save it in a variable of your choosing. #Q9. From the sequence you created, extract the…

Global Mammalian Cell Expression System Market Overview: The Mammalian Cell Expression System market refers to the market for quick-acting packaging solutions. These types of packaging solutions are designed to offer convenient and efficient ways of storing, transporting, and dispensing a variety of products. The Mammalian Cell Expression System market includes…

Hi, I’m download some datasets from Geo Database (www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE155960) I found the names are in ENSEMBL nomenclature and I need to convert into Gene symbol in order to do the QC metrics in the Seurat pipeline. I’m using this code to convert the ENSEMBL to gene symbol: library(Seurat) library(patchwork) library…

DOI: 10.18129/B9.bioc.GenomicOZone   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see GenomicOZone. Delineate outstanding genomic zones of differential gene activity Bioconductor version: 3.16 The package clusters gene activity along chromosome into zones, detects differential zones as outstanding, and visualizes maps of outstanding zones…

How to convert chromosome locations to gene symbols? 0 Hi. I wonder how to convert chromosome locations to gene symbols. An example of chromosome locations name is ‘chr1: 44959708-45072070’. There are many chromosome locations. I want the chromosome location names to gene symbols. Should I use ‘biomaRt’ package? If I…

get allele frequency (MAF) value from snp 0 Hi all! 🙂 I have a list of snp ids, to which I need their correspodning MAF (minor allele frequency) values. I tried to do it in R using biomaRt but it seems that it is not possible- correct me if I…

PRESS RELEASE Published May 5, 2023 New Jersey, N.J, May. 05, 2023 (Digital Journal) Gene knockdown is a technique used in molecular biology to decrease the expression of a gene of interest. This can be accomplished using RNA interference (RNAi), a technique that uses short strands of RNA to specifically…

I have an excel file, which contains columns chrom, pos, id, ref and alt. I want to add a new column, which will have the name of the genes for the corresponding rows. For that I am using getBM() function in biomaRt, but it takes too much time to finish….

I’ve downloaded the CEL files from GSE154619 and want to run a DE test for multiple contrasts. In essence, this data has two treatments(drug vs control) in two tissues. Here’s my code: suppressPackageStartupMessages({ library(affy) library(oligo) library(limma) library(pd.clariom.s.mouse) library(clariomsmousetranscriptcluster.db) library(biomaRt) }) data_dir <- ‘./data/DpQ/GSE154619/’ metadata <- data.frame( treatment = factor(ifelse(grepl(‘DQ’, all_files),…

Home Bioconductor 3.17 Released April 26, 2023 Bioconductors: We are pleased to announce Bioconductor 3.17, consisting of 2230 software packages, 419 experiment data packages, 912 annotation packages, 27 workflows and 3 books. There are 79 new software packages, 7 new data experiment packages, no new annotation packages, 2 new workflows,…

Hello, I have upgraded my MacOs to Ventura 13.3.1, then Xquartz, before installing R v4.3 (Intel) and associated Rstudio from the posit website. After package installation through the BiocManager tool, it looks that a few packages can’t load including GenomicFeaturesLoading required package: GenomicFeaturesLoading required package: GenomicRangesError: package or namespace load…

Hey, There are two approaches here. 1, org.At.tair.db You can use the annotation DB packages from Bioconductor, specifically org.At.tair.db. Copying my own answer from here: A: Biomart query returns NA when searching for entrez_id, while manual search works library(org.At.tair.db) genes <- c(“AT2G14610″,”AT4G23700″,”AT3G26830”, “AT3G15950″,”AT3G54830″,”AT5G24105”) keytypes(org.At.tair.db) mapIds(org.At.tair.db, keys = genes, column =…

Struggling with protein context of Annovar output 0 Hi, Im having some troubles extracting the protein sequences of missense mutations from annovar output files. I would like to create all of the possible neopeptides arising from missense mutations of TCGA tumor samples. For this I used Annovar to get the…

Missing Gene Symbols From Mgi With Biomart (Mouse) 1 I’m trying to use biomaRt to get attributes for a bunch of genes. When I try it, I notice that there are some missing values. Can someone tell me why? Ex.: library(biomaRt) mart <- useMart(biomart=”ensembl”, dataset=”mmusculus_gene_ensembl”) results <- getBM(attributes = c(“gene_biotype”,…

budgerigar conversion id from gene names to ensembl ids 1 Hello! I am writing to you as I am trying to solve the following problem: I have a list of gene names from the species Budgerigar (Melopsittacus undulatus) and my ultimate aim is to find the human orthologs in gene…

This is the development version of GenomicRanges; for the stable release version, see GenomicRanges. The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyzing high-throughput sequencing data (a.k.a. NGS data). The GenomicRanges package defines general purpose containers for storing…

Finding Pdb File For Specific Transcript 1 I would like to find the PDB file (or whatever 3d structure file for proteins that is appropriate) for a specific transcript. I had several problems with that. For example when using ensembl/biomart. When querying its database, lets say for the transcript BRCA1-001,…

hg38 Ig regions 3 Hi, I’m looking for the Immunoglobulin regions coordinates in hg38 assembly. I want to exclude them from my CNV analysis. I know the hg19 regions but I do not want just to liftover them. Many thanks assembly sequence • 2.0k views You can use Ensembl’s BioMart…

How Can I Compare Differential Expression Data From Mouse And Human? 3 Hello, I have run differential expression analyses for mouse and human using transcriptome data. I now have a list of genes (Ensembl IDs) differentially expressed in the mouse and a list of genes differentially expressed in the human….

In that case let us consider your dataframe: “` data = c(“ENST00000003583.12”, “ENST00000003912.7”, “ENST00000008440.9”, “ENST00000009105.5”, “ENST00000010299.10”, “ENST00000011700.10”, “ENST00000037502.11”, “ENST00000040877.2”, “ENST00000054650.8”, “ENST00000054666.11”, “ENST00000054668.5”, “ENST00000060969.5”, “ENST00000072644.7”, “ENST00000078527.8”, “ENST00000164247.5”, “ENST00000166244.8”, “ENST00000167825.5”, “ENST00000194214.9”, “ENST00000196061.5”, “ENST00000207157.7”) “` Remove the numbers after . “` enst <- gsub("\\.[0-9]*$", "", data) “` then follow the command “` library(biomaRt)…

You can use bioMart to solve this problem: Let your data be as follows: “` data = c(“ENST00000234590″,”ENST00000295688″,”ENST00000319248″,”ENST00000436427”, “ENST00000458748”, “ENST00000384384”, “ENST00000524851”, “ENST00000530019”, “ENST00000532872”, “ENST00000610851”, “ENST00000618227”, “ENST00000229239”) “` then, “` library(biomaRt) mart <- useMart("ensembl","hsapiens_gene_ensembl") genes <- getBM(attributes=c("ensembl_transcript_id","external_gene_name","ensembl_gene_id"), filters = "ensembl_transcript_id", values = data, mart = mart) rownames(genes) <- genes$ensembl_transcript_id names(genes) =…

DOI: 10.18129/B9.bioc.Sushi     This package is for version 3.14 of Bioconductor; for the stable, up-to-date release version, see Sushi. Tools for visualizing genomics data Bioconductor version: 3.14 Flexible, quantitative, and integrative genomic visualizations for publication-quality multi-panel figures Author: Douglas H Phanstiel <dphansti at stanford.edu> Maintainer: Douglas H Phanstiel <dphansti…

Hi everyone, I am trying to see chromosome coordinates (.bed file) are in a gene in the same direction, opposite direction, or not overlapping a gene. I downloaded the genome file from biomart. Here is the command for i in *_sorted_removed.bed; bedtools intersect -wa -S -a $i -b biomart_mm39.bed >…

“Stratagem Market Insights offers a 70% discount on Gene Silencing And Knockdown Market Reports on Single User Access and Unlimited User Access“ The Gene Silencing And Knockdown Market research study is a professional report with premium insights into the size of the business, current patterns, drivers, risks, potential outcomes, and…

BiomaRt: problems annotating a list of DEGs from DESeq2 0 @alanghudson-16729 Last seen 11 hours ago United States Hi, I am trying to annotate a list of differentially expressed genes output by DESeq2, with ensembl IDs, gene symbols and gene descriptions. I originally aligned and mapped the reads using a…

The Gene Knockdown Market research report is an intelligence report that has been compiled after meticulous efforts to gather valuable information. The report covers both the existing top players and upcoming competitors in the market. It provides a detailed analysis of the business strategies of key players and emerging market…

The Gene Knockdown Market is expanding at a faster pace and is estimated to have considerable potential for expansion between 2023 and 2030. Report Description: The Latest research by Worldwide Market Reports provides a thorough analysis of the “Global Gene Knockdown Market Forecast 2023.” The Gene Knockdown industry is covered in…

PRESS RELEASE Published April 4, 2023 Creative BioMart GMP proteins, a sub-brand of Creative BioMart that provides comprehensive GMP proteins and peptides with defined identity, quality and purity, recently released new recombinant GMP proteins for in vitro diagnostics, therapeutic drug development, cosmetics, and the food industry. GMP grade protein is…

How to extract the DNA sequence 1000 bp around the Transcription start site (TSS) of a gene symbol in NCBI gene with R? 0 I am trying to extract the DNA sequence 1000 bp around the Transcription start site (TSS) of a gene, and I get a code as follows:…

Getting chromosome of unusual chromosome names e.g. ‘CHR_HSCHR8_8_CTG1’ 0 I made a biomaRt query: library(biomaRt) mart = useMart(‘ensembl’, dataset=”hsapiens_gene_ensembl”) genes = getBM(attributes = c(“chromosome_name”,”start_position”, “hgnc_symbol”, “uniprot_gn_symbol”, “uniprot_gn_id”), mart = mart, values = list(“protein_coding”,c(1:22))) Most of the chromosome_name values are regular numbers 1 to 22. However, some are unusual, such as…

DOI: 10.18129/B9.bioc.TxDb.Athaliana.BioMart.plantsmart51   This is the development version of TxDb.Athaliana.BioMart.plantsmart51; for the stable release version, see TxDb.Athaliana.BioMart.plantsmart51. Annotation package for TxDb object(s) Bioconductor version: Development (3.17) Exposes an annotation databases generated from BioMart by exposing these as TxDb objects. This package is for Arabidopsis thaliana (taxID: 3702). The BioMart plantsmart…

Retrieve hgnc_symbol from XM_ refseqs using BiomaRt 1 I have some predicted RefSeqs, such as XM_005261067 or XM_005255527 and would like to retrieve the hgnc_symbol using BiomaRt like this: refseqids_XM = c(“XM_005261067″,”XM_005255527”) gene_XM <- getBM(attributes=c(“refseq_mrna_predicted”,”hgnc_symbol”), filters=”refseq_mrna_predicted”, values=refseqids_XM, mart=ensembl) gene_XM However, this gives me no result: [1] refseq_mrna_predicted refseq_mrna <0 Zeilen>…

GetBM – GERP conservation score for GRCm39 2 Hi all, Ensembl has GERP scores for each of their mus musculus SNPs (for example: rs31948051 has a GERP score of -0.4). I’m trying to see if biomaRt (the getBM function) to get these scores, but it doesn’t seem to have any…

Differences between BioMart and Ensembl site 1 Hi, I have observed different transcripts correspondence between BioMart and the Ensemble site. If we observe the transcripts table at Ensembl site for A2ML1 gene, the ENST00000299698.7 is only related to NM_144670.4 transcript: However, if we retrieve BioMart data, ENST00000299698.7 is related to…

Hi, I am attempting to work through the workflow described in “Swimming downstream: statistical analysis of differential transcript usage following Salmon quantification.” I am running into an error message when I try to make the counts dataframe for DRIMseq: Error in data.frame(gene_id = txdf$GENEID, feature_id = txdf$TXNAME, cts) : arguments…

I am trying to annotate a list of SNPs using the hg38 genome (knownGene) and locateVariants(). The program is able to successfully run and provide “GeneIDs” for several of the loci. However, some GeneIDs are applied to SNPs in completely different regions and on completely different chromosomes. When I cross…

DOI: 10.18129/B9.bioc.crisprDesign   This is the development version of crisprDesign; for the stable release version, see crisprDesign. Comprehensive design of CRISPR gRNAs for nucleases and base editors Bioconductor version: Development (3.17) Provides a comprehensive suite of functions to design and annotate CRISPR guide RNA (gRNAs) sequences. This includes on- and…

Get Exon Sequence from biomaRt given ENST transcript ID and exon number. 0 Hello, I have been trying to use biomart to extract the sequence given the Ensembl ENST transcript ID and a particular exon number. I also have the start and end position. If I look up the given…

The report on the global Gene Knockdown market focuses on important facts and intelligence of the industry by keeping in contact with the ongoing and future market trends throughout the forecast period. Detailed research has been done on price, current geographical zones, technology, and demand-supply of the ‘keyword’ market. It also…

Hi, I am running the HTSeqGenie on both MacOS and Linux with the test TP53 samples. They both gave me error in reading the fastq files. It seems having problems reading the fastq.gz files in each parallel process. Could anyone help me with this please? Error are at below: checkConfig.R/checkConfig.template:…

how to download 3′ UTR sequences of Anas platyrhynchos? 1 I would like to download 3’UTR sequences of Anas platyrhynchos for target prediction Please help me by sharing terminal code or R scripts or browser-based download links ThanksKAMAL miRNA gene target-prediction • 76 views You can obtain those from Ensembl,…

Downloading 3′ UTR sequences for miRNA Target Prediction 2 Hello, I am trying to download all the 3′ UTR sequences of the differentially expressed genes through Ensembl (BioMart). It went well as well as the interrogation of the miRNA seed and got some results. My question is, ensembl gave me…

biomaRt crashes R studio 0 Hey everyone, I just wanted to execute a script that worked before. However, everytime I try to run it now RStudio gets unresponsive. I didn’t change anything. Does anyone else experience this? This is an extract from my script: library(biomaRt) … mart <- useMart(“ENSEMBL_MART_ENSEMBL”) mart…

I’m working on an R script that downloads gene expression data from GEO, through Bioconductor and the getGEO() function. These commands download all the 436 samples of the repository, but I’m only interested in 157 of them. Precisely, I’m interested in handling only the “samples collection:ch1” column with values “”on…

I have counts data (processed already) and I want to get the lengths of the genes from Biomart, in order to normalize the data to TPM. I’ve done this already many times in the past, and now I have new data, with 50K genes. This is the code, and it…

Finding dbSNP 129 rsIDs for lifting over hg18 sumstats to hg38 0 Hi all, I’m currently working on lifting a summary statistics file from the genome build hg18 to hg38. The file format for the sumstats is as follows: marker Allele1 Allele2 beta1 SE pValue chr Bp chr10:100004799 a c…

Hello, I aligned my samples with kallisto to a transcriptome for plasmodium falciparum. The file I used to make the reference is Plasmodium_falciparum.ASM276v2.cdna.all.fa.gz which I downloaded from here ftp.ensemblgenomes.org/pub/protists/release55/fasta/plasmodium_falciparum/cdna/Plasmodium_falciparum.ASM276v2.cdna.all.fa.gz. However, I am having issues with tximport. The error that I get is: Error in .local(object, …) : None of the…

How to map and annotate gene symbols to gene type? 1 Hi, I am working with total RNA-Seq dataset and aligned fastq files against hg38 using STAR and quantified using salmon. Now I am interested in annotating each gene symbol with gene type annotations (for instance; whether the gene is…

Cat.No. : SMAD4-31193TH Optional Service: Optional requirements on this protein Product Overview : Recombinant full length human Smad4 with N-terminal proprietary tag; amino acids 1-552, 95kDa. Description : This gene encodes a member of the Smad family of…

Database with gene family annotations 1 Hello, I have a list of genes, and I am looking for a database which will provide me with general gene family annotations, such as whether a gene is a cytokine, chemokine, ribosomal, etc. I’ve queried the Panther database, but unfortunately it does not…

DOI: 10.18129/B9.bioc.metaseqR2     An R package for the analysis and result reporting of RNA-Seq data by combining multiple statistical algorithms Bioconductor version: Release (3.11) Provides an interface to several normalization and statistical testing packages for RNA-Seq gene expression data. Additionally, it creates several diagnostic plots, performs meta-analysis by combinining…

Annotating snps with gene information 0 Hi, I am trying to annotate a list of snps with the ENSG gene number using biomaRt. I need to use ensemble version 91. I have built the following query: snps = c(“rs201327123” “rs141149254” “rs114420996” “rs62637817″) ensembl.snp = useEnsembl(biomart=”snps”, version=91) mart.snp <- useMart(biomart =…

HI everyone. I have a set of mouse SNPs (~974) from GRCm39 that I’m trying to get either GERP or UCSC Conservation scores on. To do this, I’m using rtracklayer to try to query the ranges of the SNP and return the multiz35way conservation score. However, when I do this,…

I want to add gene name information to my expression file, I use Biomart for this, but actually i did not get any result from getBM, my codes in R: upregul<-read.csv(file.choose()) View(upregul) library(biomaRt) listEnsembl() ensembl <- useEnsembl(biomart = “genes”) ensembl_ids<-(upregul) View(ensembl_ids) datasets <- listDatasets(ensembl) head(datasets) ensembl_con<-useEnsembl(“ensembl”,dataset=”hsapiens_gene_ensembl” ) attr<-listAttributes(ensembl_con) filters<-listFilters(ensembl_con) theBm<-getBM(attributes…

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see MEDIPS. DNA IP-seq data analysis Bioconductor version: 3.2 MEDIPS was developed for analyzing data derived from methylated DNA immunoprecipitation (MeDIP) experiments followed by sequencing (MeDIP-seq). However, MEDIPS provides functionalities for the analysis of…

What should I do if the gene IDs in my reference dataset and test dataset are different 1 Hi everyone, I am trying to annotate my single cell dataset (integrated dataset) using singleR. However, I am getting the error “no common genes between ‘test’ and ‘ref’”. I realized that the…

get build 37 positions from dbSNP rsIDs 4 $ mysql –user=genome –host=genome-mysql.cse.ucsc.edu -A -D hg19 -e ‘select chrom,chromStart,chromEnd,name from snp147 where name in (“rs371194064″,”rs779258992″,”rs26″,”rs25”)’ +——-+————+———-+————-+ | chrom | chromStart | chromEnd | name | +——-+————+———-+————-+ | chr7 | 11584141 | 11584142 | rs25 | | chr7 | 11583470 | 11583471…

Ensembl ID to Gene Symbol Converter 0 I’m trying to convert ensembl gene IDs to gene symbols. The ensembl gene IDs come from human reference file: Homo_sapiens.GRCh38.dna.primary_assembly.fa. I’ve tried using the BioMart tool from ensembl and the BioTools Converter (www.biotools.fr/human/ensembl_symbol_converter), but both tools still give me a lot of blank…

The global Gene Knockdown market research study covers the specific market opportunities, drivers, and industry-specific systems. The complete analyses of historical, present, and future global economic trends, regulations, laws, and micro- and macroeconomic indicators are commonly included in in-depth surveys. The potential appeal of wide categories is taken into account in…

chromosome start & end for genes in biomart R not showing 1 I have a list of genes which i want to get their cordinates and ref-seq ids but “start” & “end” attributes in biomart keeps throwing error. could you please take a look? library(biomart) #define which database to use…

I’m trying to annotate some data from a Bisulphite experiment, from which I have a GRanges object without any annotation: GRanges object with 872900 ranges and 0 metadata columns: seqnames ranges strand <Rle> <IRanges> <Rle> [1] chr10 48196 * [2] chr10 48486 * [3] chr10 49247 * [4] chr10 49258…

Having a lot of trouble converting Gene Ranges to GeneID. 0 I’m having trouble converting gene ranges to gene ids for mm10. For example I have a dataframe of “chromosome”, “start”, “end”, and I want the associated “GENE SYMBOL” for each row. I was looking online, which brought me to…

Add microRNA annotation to DEseq2 0 Hello, I am trying to perform micro-RNA analysis and convert ENSEMBL IDs to microRNA I tried using Biomart and results are attached. It doesn’t produce any micro-RNA. Why is this happening and is there any other way to annotate micro-RNA into the pipeline like…

Doubt on annotation of ensembl ids in biomart using R 0 Hi All 🙂 I have a large list of unique ENSEMBL IDs (48,432) representing mouse genes, my goal only is to get attributes like gene name and ncbi id to build a dataset with expression data. However when using…

Hello! I am working on analyzing a dataset I created with the 10x Chromium Single Cell Multiome kit. In order to add gene annotation to the ATAC data, I am trying to install and use the “EnsDb.Mmusculus.v79” and “BSgenome.Mmusculus.UCSC.mm10” packages with bioconductor. The same ERROR has come up repeatedly whenever…

Sample preparation and sequencing The method of sample collection and processing is described in a companion article (ref. 23). Sequencing and basic bioinformatic processing of DNA-, RNA- and ATAC-seq data are included there as well. Gene expression normalization and filtering The number of non-ribosomal protein-coding genes on the 23 canonical chromosome pairs…

“ Gene Knockdown Market” 2020 analysis reports provide a significant wellspring of fast information for business strategists and based examination. It provides the Gene Knockdown business inspection with advancement analysis and the peak value, the income, petition and supply info. Real makers Evaluation of Gene Knockdown Market. Request Sample Copy…

Toggle navigation Menu Gene data Gene symbol reports Gene group reports Tools BioMart HCOP Multi-symbol checker Search Downloads BioMart Complete set archive Custom downloads REST service Statistics and download files GitHub (code) VGNC VGNC homepage About the VGNC Contact us Contact details Feedback form More About About the HGNC Guidelines…

I tried several R packages (mygene, org.Hs.eg.db, biomaRt, EnsDb.Hsapiens.v79) to convert Ensembl.gene to gene.symbol, and found that the EnsDb.Hsapiens.v79 package / gene database provides the best conversion quality (in terms of being able to convert most of Ensembl.gene to gene.symbol). Install the package if you have not installed by running…

Hi, I have a question about DESeq2 LFCshrinkage: Is it possible that some genes have a slightly higher LFC after shrinkage? It happened during my RNAseq DE analysis, I have very deeply sequenced samples with large base means. I tried visualizing using MAplot check, and it looks fine. I’m mainly…

Ensembl ID mapping GRCh37 vs GRCh38 0 I currently have a large list of Ensembl protein IDs (ENSP) that are from GRCh37. I need to map these IDs to the entry name listed on the UniProt website (e.g. ‘CASPE_HUMAN’ ). I am having trouble doing this using the UniProt dataset…

Get gene names from rs SNP ids for mmusculus_gene_ensembl 1 I have mouse data with an old mapping from rs SNP IDs to base pair position and chromosome. I would like to query Ensembl to get the genes and then the gene annotations for the rs SNP IDs in my…

I am trying to run the following Biomart script (params$species == “rabbit”){ ensembl = useMart(biomart=”ENSEMBL_MART_ENSEMBL”, dataset=”ocuniculus_gene_ensembl”, host=”uswest.ensembl.org“, ensemblRedirect = FALSE) orgSymbols <- unlist(getBM(attributes=”ensembl_gene_id”, mart=ensembl)) mart <- useMart(dataset = “ocuniculus_gene_ensembl”, biomart=”ensembl”, host=”uswest.ensembl.org“) The host keeps timing out – does anyone know another host URL I could use? Thank you Read more…

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Explore SNVs associations with traits of UK BioBank. GWAS study results where made publicly available courtesy of Neale’s Lab on August 1st, 2018. For more information please visit: www.nealelab.is/uk-biobank INSTALL In R: devtools::install_github(“adRn-s/ukbbgwas”). DEV(s) Dependencies Mandatory and optional dependencies can all be handled with bioconda. Here’s a complete YAML specification…

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Feedback and help Who is this course for? A knowledge of some genomics is required, and some bioinformatics knowledge would be useful but is not essential.  What will I achieve? By the end of the course you will be able to: Explain what Ensembl is and where the data…

Ethical compliance The research carried out in this study has been approved by the Swedish Board of Agriculture, Jordbruksverket: N343/12. Cell culture Mouse primary fibroblasts were derived from adult (>10 weeks old) CAST/EiJ × C57BL/6J or C57BL/6J × CAST/EiJ mice by skinning, mincing and culturing tail explants (for at least 10 d) in DMEM high…

Workflow Platforms for Systems Genetics eQTL Platforms eQTL Viewer Mouse Genome Informatics: Phenotypes, Alleles & Disease Models PhenoGen Informatics (CO U) eXtensible Genotype And Phenotype platform (XGAP) MOLGENIS & MetaNetwork, Swertz & Jansen, U Groningen Weighted Gene Co-expression Network Analysis (WGCNA), Horvath, UCLA iPlant Sage Bionetworks Repository: Synapse GenomeSpace Institute…

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

circRNA quantification, differential expression analysis and miRNA target prediction of RNA-Seq data Introduction nf-core/circrna is a best-practice analysis pipeline for the quantification, miRNA target prediction and differential expression analysis of circular RNAs in paired-end RNA sequencing data. The pipeline is built using Nextflow, a workflow tool to run tasks across…

Unable to get all Uniprot IDs corresponding to Ensembl ID 1 I want to convert Ensembl gene IDs to Uniprot IDs. I have used the biomaRt package in R and perform the following commands. > ensembl <- useEnsembl(biomart = “genes”, dataset = “hsapiens_gene_ensembl”) > getBM(mart=ensembl,attributes=c(“ensembl_gene_id”,”uniprot_gn_id”),filters=”ensembl_gene_id”,values=”ENSG00000183955″,uniqueRows=TRUE); As a result, the following…