Tag: Brunello

CRISPR guide RNA libraries have been iteratively improved to provide increasingly efficient reagents, although their large size is a barrier for many applications. We design an optimised minimal genome-wide human CRISPR-Cas9 library (MinLibCas9) by mining existing large-scale gene loss-of-function datasets, resulting in a greater than 42% reduction in size compared…

doi: 10.3389/fgeed.2023.1218328. eCollection 2023. Affiliations Expand Affiliation 1 Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Silver Spring, MD, United States. Free PMC article Item in Clipboard Brian J Iaffaldano et al. Front Genome Ed. 2023. Free PMC article Show details Display…

Review . 2023 Jul 21;205(8):293. doi: 10.1007/s00203-023-03636-3. Affiliations Expand Affiliations 1 The Affiliated Nanhua Hospital, Department of Clinical Laboratory, Hengyang Medical School, University of South China, Hengyang, Hunan, 421001, China. 2 Department of Public Health Laboratory Sciences, School of Public Health, Hengyang Medical School, University of South China, Hengyang, Hunan,…

Woodside Energy will move ahead with development of the Julimar-Brunello Phase 3 project offshore Western Australia. In its second-quarter 2023 report dated July 18, the company confirmed a positive final investment decision was made on the project—which will provide a new supply of gas to the Chevron-operated Wheatstone LNG plant—in…

Offshore staff NEWCASTLE & HOUSTON — TechnipFMC has been awarded a contract by Woodside Energy to engineer, procure, construct and install flexible pipes and umbilicals for the Julimar Phase 3 development offshore Western Australia. The Julimar Field is about 200 km (124 miles) offshore northwest Australia.  TechnipFMC will tie back four subsea gas…

Phylogenetic tree construction Tree diagram showing relationships between CDK proteins was constructed from a multi-sequence alignment (MSA) using Geneious95. The “Geneious Aligner”, was used to generate the MSA, and the neighbor joining method was used to construct the tree. All default parameters were used except where otherwise indicated. Combinatorial CRISPR…

I am working on using MAGeCK to define essential genes from a CRISPR screen on model MPNST cell lines using the Brunello library. Counts and normalization proceed perfectly fine, I am able to get a counts table that looks like so: sgRNA Gene ST8814_Final ST8814_Initial STS26T_Final STS26T_Initial NEIL1_49554_TGGAAGGGGGCACTTAGCGA NEIL1 1339…

Cell culture IMR90 (CCL-186) and WI38 (AG06814-N) fibroblasts were purchased from ATCC and the Coriell Institute for Medical Research, respectively. IMR90 and WI38 fibroblasts were grown under 7.5% CO2 and 3% O2 in GlutaMax-DMEM (Gibco, 10569-010) supplemented with 0.1 mM non-essential amino acids (Corning, 25-025-Cl) and 15% fetal bovine serum (VWR/Seradigm,…