Tag: Brunello

MAGeCK mle returns all genes as essential

I am working on using MAGeCK to define essential genes from a CRISPR screen on model MPNST cell lines using the Brunello library. Counts and normalization proceed perfectly fine, I am able to get a counts table that looks like so: sgRNA Gene ST8814_Final ST8814_Initial STS26T_Final STS26T_Initial NEIL1_49554_TGGAAGGGGGCACTTAGCGA NEIL1 1339…

Continue Reading MAGeCK mle returns all genes as essential

Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis

Cell culture IMR90 (CCL-186) and WI38 (AG06814-N) fibroblasts were purchased from ATCC and the Coriell Institute for Medical Research, respectively. IMR90 and WI38 fibroblasts were grown under 7.5% CO2 and 3% O2 in GlutaMax-DMEM (Gibco, 10569-010) supplemented with 0.1 mM non-essential amino acids (Corning, 25-025-Cl) and 15% fetal bovine serum (VWR/Seradigm,…

Continue Reading Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis