Tag: BSgenome

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Bioconductor – BSgenome.Cjacchus.UCSC.calJac4

DOI: 10.18129/B9.bioc.BSgenome.Cjacchus.UCSC.calJac4     Full genome sequences for Callithrix jacchus (UCSC version calJac4) Bioconductor version: Release (3.15) Full genome sequences for Callithrix jacchus (Marmoset) as provided by UCSC (calJac4, May 2020) and wrapped in a BSgenome object. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation…

Continue Reading Bioconductor – BSgenome.Cjacchus.UCSC.calJac4

[BioC] rtracklayer 1.6: invalid class “ucscCart” object

Dear Bioc, Following the rtracklayer documentation, section 2.2.4, ‘A Shortcut’, I encounter the following error browseGenome (subTargetTrack) Error in validObject(.Object) :invalid class “ucscCart” object: superclass “ANYTHING” not defined in the environment of the object’s class traceback () 13: stop(msg, ” “, errors, domain = NA)12: validObject(.Object)11: initialize(value, …)10: initialize(value, …)9:…

Continue Reading [BioC] rtracklayer 1.6: invalid class “ucscCart” object

Convert ensembl IDs from dataframe to entrez IDs vector

Convert ensembl IDs from dataframe to entrez IDs vector 0 I want to convert ensembl IDs in to entrez IDs to perform Ontology Analysis. I need to create a vector of ensembl IDs and it does not work. library(ChIPpeakAnno) #to use the function convert2EntrezID library(BSgenome.Athaliana.TAIR.TAIR9) #to get the entrez IDs…

Continue Reading Convert ensembl IDs from dataframe to entrez IDs vector

‘No genomes installed!’ error from getREF

I was trying to use the getPlotSetArray() function, but I got the error ‘No genomes installed!’ from the getREF function. I digged into the problem and it turns out that in the latest version of the BSgenome package the output of the function BSgenome::installed.genomes(splitNameParts=TRUE) changed from: pkgname organism provider provider_version…

Continue Reading ‘No genomes installed!’ error from getREF

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor – BSgenome.Ppaniscus.UCSC.panPan1

DOI: 10.18129/B9.bioc.BSgenome.Ppaniscus.UCSC.panPan1     Full genome sequences for Pan paniscus (UCSC version panPan1) Bioconductor version: Release (3.14) Full genome sequences for Pan paniscus (Bonobo) as provided by UCSC (panPan1, May 2012) and stored in Biostrings objects. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from…

Continue Reading Bioconductor – BSgenome.Ppaniscus.UCSC.panPan1

Bioconductor – BSgenome.Amellifera.NCBI.AmelHAv3.1

DOI: 10.18129/B9.bioc.BSgenome.Amellifera.NCBI.AmelHAv3.1     Full genome sequences for Apis mellifera (Amel_HAv3.1) Bioconductor version: Release (3.14) Full genome sequences for Apis mellifera as provided by NCBI (assembly Amel_HAv3.1, assembly accession GCF_003254395.2) and stored in Biostrings objects. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from within…

Continue Reading Bioconductor – BSgenome.Amellifera.NCBI.AmelHAv3.1

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Bioconductor – BSgenome.Creinhardtii.JGI.v5.6

DOI: 10.18129/B9.bioc.BSgenome.Creinhardtii.JGI.v5.6     Full genome sequences for Chlamydomonas reinhardtii (v5.6) Bioconductor version: Release (3.14) Full genome sequences for Chlamydomonas reinhardtii (v5.6) as provided by JGI and stored in Biostrings objects. The data in this package is public. See ‘citation(“BSgenome.Creinhardtii.JGI.v5.6”)’ for how to cite in publications. Author: The Bioconductor Dev…

Continue Reading Bioconductor – BSgenome.Creinhardtii.JGI.v5.6

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – branchpointer

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Continue Reading Bioconductor – branchpointer

Bioconductor – txcutr (development version)

DOI: 10.18129/B9.bioc.txcutr     This is the development version of txcutr; for the stable release version, see txcutr. Transcriptome CUTteR Bioconductor version: Development (3.15) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can…

Continue Reading Bioconductor – txcutr (development version)

Bioconductor – r3Cseq

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see r3Cseq. Analysis of Chromosome Conformation Capture and Next-generation Sequencing (3C-seq) Bioconductor version: 3.3 This package is an implementation of data analysis for the long-range interactions from 3C-seq assay. Author: Supat Thongjuea, MRC Molecular…

Continue Reading Bioconductor – r3Cseq

Bioconductor – BSgenome.Scerevisiae.UCSC.sacCer3

DOI: 10.18129/B9.bioc.BSgenome.Scerevisiae.UCSC.sacCer3     This package is for version 3.10 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Scerevisiae.UCSC.sacCer3. Saccharomyces cerevisiae (Yeast) full genome (UCSC version sacCer3) Bioconductor version: 3.10 Saccharomyces cerevisiae (Yeast) full genome as provided by UCSC (sacCer3, April 2011) and stored in Biostrings objects. Author: The…

Continue Reading Bioconductor – BSgenome.Scerevisiae.UCSC.sacCer3

Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

I have a bed file which contains DNA sequences information as follow: ** track name=”194″ description=”194 methylation (sites)” color=0,60,120 useScore=1 chr1 15864 15866 FALSE 894 + chr1 534241 534243 FALSE 921 – chr1 710096 710098 FALSE 729 + chr1 714176 714178 FALSE 12 – chr1 720864 720866 FALSE 988 -…

Continue Reading Convert DNAStringSet to a list of elements in R? (Error in seq[[1]][[“seq”]] : subscript out of bounds in R)

Bioconductor – RiboCrypt

DOI: 10.18129/B9.bioc.RiboCrypt     Interactive visualization in genomics Bioconductor version: Release (3.14) R Package for interactive visualization and browsing NGS data. It contains a browser for both transcript and genomic coordinate view. In addition a QC and general metaplots are included, among others differential translation plots and gene expression plots….

Continue Reading Bioconductor – RiboCrypt

Bioconductor – monaLisa

DOI: 10.18129/B9.bioc.monaLisa     Binned Motif Enrichment Analysis and Visualization Bioconductor version: Release (3.14) Useful functions to work with sequence motifs in the analysis of genomics data. These include methods to annotate genomic regions or sequences with predicted motif hits and to identify motifs that drive observed changes in accessibility…

Continue Reading Bioconductor – monaLisa

Bioconductor – BSgenome.Hsapiens.NCBI.GRCh38

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.NCBI.GRCh38     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.NCBI.GRCh38. Full genome sequences for Homo sapiens (GRCh38) Bioconductor version: 3.11 Full genome sequences for Homo sapiens (Human) as provided by NCBI (GRCh38, 2013-12-17) and stored in Biostrings objects. Author: The…

Continue Reading Bioconductor – BSgenome.Hsapiens.NCBI.GRCh38

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

Bioconductor – BSgenome.Mmulatta.UCSC.rheMac10

DOI: 10.18129/B9.bioc.BSgenome.Mmulatta.UCSC.rheMac10     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mmulatta.UCSC.rheMac10. Full genome sequences for Macaca mulatta (UCSC version rheMac10) Bioconductor version: 3.11 Full genome sequences for Macaca mulatta (Rhesus) as provided by UCSC (rheMac10, Feb. 2019) and stored in Biostrings…

Continue Reading Bioconductor – BSgenome.Mmulatta.UCSC.rheMac10

Bioconductor – Rariant

    This package is for version 3.0 of Bioconductor; for the stable, up-to-date release version, see Rariant. Identification and Assessment of Single Nucleotide Variants through Shifts in Non-Consensus Base Call Frequencies Bioconductor version: 3.0 The ‘Rariant’ package identifies single nucleotide variants from sequencing data based on the difference of…

Continue Reading Bioconductor – Rariant

Bioconductor – BSgenome.Hsapiens.UCSC.hg19

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg19. Full genome sequences for Homo sapiens (UCSC version hg19) Bioconductor version: 3.2 Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg19, Feb. 2009) and stored in Biostrings objects. Author:…

Continue Reading Bioconductor – BSgenome.Hsapiens.UCSC.hg19

Forge a BSgenome data package

My supervisor has requested that I create coverage plots to visualize BAM alignments of RNA-Seq data. I though a good way to do this would be to use Gviz. We work on the model legume Medicago truncatula which does not have a BSgenome package so I though I’d try and…

Continue Reading Forge a BSgenome data package

Loading a genome in BSgenome

Loading a genome in BSgenome 1 Is it possible to load a genome assembled by me (sequence not submitted to any database yet) in the BSgenome package for further study? How? BSgenome Bioconductor genome assembly • 1.1k views Same question here. Please, let us know if you figure out how…

Continue Reading Loading a genome in BSgenome

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Bioconductor – chipseq

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see chipseq. chipseq: A package for analyzing chipseq data Bioconductor version: 3.4 Tools for helping process short read data for chipseq experiments Author: Deepayan Sarkar, Robert Gentleman, Michael Lawrence, Zizhen Yao Maintainer: Bioconductor Package…

Continue Reading Bioconductor – chipseq

Bioconductor – BSgenome.Hsapiens.UCSC.hg38.dbSNP151.major

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.UCSC.hg38.dbSNP151.major     Full genome sequences for Homo sapiens (UCSC version hg38, based on GRCh38.p12) with injected major alleles (dbSNP151) Bioconductor version: Release (3.13) Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg38, based on GRCh38.p12) with major allele injected from dbSNP151, and stored in Biostrings…

Continue Reading Bioconductor – BSgenome.Hsapiens.UCSC.hg38.dbSNP151.major

BSgenomes for HIV viruses

BSgenomes for HIV viruses 0 Dear Biostars users, I wonder if there are BSgenomes available for HIV viruses? I am trying to identify clusters from CLIP-seq data mapping to the HIV genome with wavClusteR. I stuck at one step as below: `require(BSgenome.Hsapiens.UCSC.hg19) wavclusters <- filterClusters( clusters = clusters, highConfSub =…

Continue Reading BSgenomes for HIV viruses