Tag: BSgenome

Analysis of Roche KAPA Target Enrichment kit experimental data obtained on an Illumina sequencing system is most frequently performed using a variety of publicly available, open-source analysis tools. The typical variant calling analysis workflow consists of sequencing read quality assessment, read filtering, mapping against the reference genome, duplicate removal, coverage…

Creating a Variant containing FASTA for proteomics search from VCF and genomic FASTA 0 Dear Biostar Community I’m currently trying to generate a protein FASTA containing all known variants from HeLa (from Cosmic CellLinesProject) for variant detection in proteomics measurements. For this, I’ve downloaded the variants file (VCF) and the…

DOI: 10.18129/B9.bioc.CAGEr     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see CAGEr. Analysis of CAGE (Cap Analysis of Gene Expression) sequencing data for precise mapping of transcription start sites and promoterome mining Bioconductor version: 3.9 Preprocessing of CAGE sequencing data, identification and…

DOI: 10.18129/B9.bioc.TxDb.Hsapiens.UCSC.hg38.knownGene     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see TxDb.Hsapiens.UCSC.hg38.knownGene. Annotation package for TxDb object(s) Bioconductor version: 3.9 Exposes an annotation databases generated from UCSC by exposing these as TxDb objects Author: Bioconductor Core Team, Bioconductor Package Maintainer <maintainer at…

    This package is for version 2.14 of Bioconductor; for the stable, up-to-date release version, see GenomicRanges. Representation and manipulation of genomic intervals Bioconductor version: 2.14 The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyze high-throughput sequencing…

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg19.masked. Full masked genome sequences for Homo sapiens (UCSC version hg19) Bioconductor version: 3.3 Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg19, Feb. 2009) and stored in Biostrings objects….

DOI: 10.18129/B9.bioc.BSgenome.Cfamiliaris.UCSC.canFam2   Full genome sequences for Canis lupus familiaris (UCSC version canFam2) Bioconductor version: Release (3.18) Full genome sequences for Canis lupus familiaris (Dog) as provided by UCSC (canFam2, May 2005) and stored in Biostrings objects. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation…

DOI: 10.18129/B9.bioc.rtracklayer     R interface to genome annotation files and the UCSC genome browser Bioconductor version: Release (3.6) Extensible framework for interacting with multiple genome browsers (currently UCSC built-in) and manipulating annotation tracks in various formats (currently GFF, BED, bedGraph, BED15, WIG, BigWig and 2bit built-in). The user may…

Download stats for annotation package BSgenome.Creinhardtii.JGI.v5.6 This page was generated on 2023-11-10 03:17:02 -0500 (Fri, 10 Nov 2023). BSgenome.Creinhardtii.JGI.v5.6 home page: release version. Number of downloads for annotation package BSgenome.Creinhardtii.JGI.v5.6, year by year, from 2023 back to 2009 (years with no downloads are omitted): 2023 Month Nb of distinct IPs Nb of downloads Jan/2023 11…

* gnu/packages/bioconductor.scm (r-bsgenome-hsapiens-ucsc-hg38-masked): New variable. Change-Id: Ic1b646a3bd3b7262dd82f0972961c2e89628e90b — gnu/packages/bioconductor.scm | 36 +++++++++++++++++++++++++++++++++++ 1 file changed, 36 insertions(+) Toggle diff (51 lines) diff –git a/gnu/packages/bioconductor.scm b/gnu/packages/bioconductor.scm index d79236ea26..ac09a079b4 100644 — a/gnu/packages/bioconductor.scm +++ b/gnu/packages/bioconductor.scm @@ -68,6 +68,42 @@ (define-module (gnu packages bioconductor) ;;; Annotations +(define-public r-bsgenome-hsapiens-ucsc-hg38-masked + (package + (name “r-bsgenome-hsapiens-ucsc-hg38-masked”) +…

DOI: 10.18129/B9.bioc.EpiTxDb   Storing and accessing epitranscriptomic information using the AnnotationDbi interface Bioconductor version: Release (3.18) EpiTxDb facilitates the storage of epitranscriptomic information. More specifically, it can keep track of modification identity, position, the enzyme for introducing it on the RNA, a specifier which determines the position on the RNA…

1. Install r-bioc-genomeinfodb package In this section, we are going to explain the necessary steps to install r-bioc-genomeinfodb package: sudo apt install r-bioc-genomeinfodb Copy 2. Uninstall / Remove r-bioc-genomeinfodb package Please follow the guidance below to uninstall r-bioc-genomeinfodb package: sudo apt remove r-bioc-genomeinfodb Copy sudo apt autoclean && sudo apt…

Unable to Generate Motif class for zebrafish scATAC data using Signac package. 0 Hi, I am analyzing zebrafish scATAC data using Signac package. The package does not allow me to create motif class. It gives me the following error after running AddMotif function. `ATAC <- AddMotifs( object = ATAC, genome…

Error in Gviz (actually, rtracklayer) | IdeogramTrack 0 @25075190 Last seen 7 minutes ago South Korea When I run this code (below) iTrack <- IdeogramTrack(genome = “hg19”, chromosome = “chr2”, name = “”) then I get the error Error: failed to load external entity “http://genome.ucsc.edu/FAQ/FAQreleases” Did someone else encounter this…

DOI: 10.18129/B9.bioc.plyinteractions   Extending tidy verbs to genomic interactions Bioconductor version: Release (3.18) Operate on `GInteractions` objects as tabular data using `dplyr`-like verbs. The functions and methods in `plyinteractions` provide a grammatical approach to manipulate `GInteractions`, to facilitate their integration in genomic analysis workflows. Author: Jacques Serizay [aut, cre] Maintainer:…

DOI: 10.18129/B9.bioc.regioneR   This is the development version of regioneR; for the stable release version, see regioneR. Association analysis of genomic regions based on permutation tests Bioconductor version: Development (3.19) regioneR offers a statistical framework based on customizable permutation tests to assess the association between genomic region sets and other…

Using injectSNPs with a custom set of SNPs 1 @steve-pederson-23427 Last seen 14 hours ago Australia Hi, I’m sorry if this is a dumb question, but I have a set of SNPs obtained from a large cohort study which can’t be released as a SNPlocs package. Is there any way…

Hi, my current implementation returns the indexes of input genomic range where “CG” are found but i want to get the genomic location matching the pattern. pls see code and example data. thank you in advance for your help getMotif_sites <- function(ref_genome=NULL, grList=NULL, context=”CG”){ library(Biostrings) # Load ref genome of…

DOI: 10.18129/B9.bioc.GreyListChIP     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see GreyListChIP. Grey Lists — Mask Artefact Regions Based on ChIP Inputs Bioconductor version: 3.11 Identify regions of ChIP experiments with high signal in the input, that lead to spurious peaks during…

I am using Diffbind for an ATAC-Seq analysis. My peak caller is MACS2, and here is my sample sheet: I run Diffbind with the following codes, but it crashed every time on dba.count . it can finished Computing summits… Recentering peaks… Reads will be counted as Paired-end. But have this…

DOI: 10.18129/B9.bioc.RSVSim     RSVSim: an R/Bioconductor package for the simulation of structural variations Bioconductor version: Release (3.11) RSVSim is a package for the simulation of deletions, insertions, inversion, tandem-duplications and translocations of various sizes in any genome available as FASTA-file or BSgenome data package. SV breakpoints can be placed…

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP142.GRCh37     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see SNPlocs.Hsapiens.dbSNP142.GRCh37. SNP locations for Homo sapiens (dbSNP Build 142) Bioconductor version: 3.13 SNP locations and alleles for Homo sapiens extracted from NCBI dbSNP Build 142. The source data files used for…

DOI: 10.18129/B9.bioc.BSgenome.Osativa.MSU.MSU7     Oryza sativa full genome (MSU7) Bioconductor version: Release (3.14) Oryza sativa full genome as provided by MSU (MSU7 Genome Release) and stored in Biostrings objects. Author: Wen Yao <ywhzau at gmail.com> Maintainer: Wen Yao <ywhzau at gmail.com> Citation (from within R, enter citation(“BSgenome.Osativa.MSU.MSU7”)): Installation To install…

DOI: 10.18129/B9.bioc.MafH5.gnomAD.v3.1.1.GRCh38     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see MafH5.gnomAD.v3.1.1.GRCh38. Minor allele frequency data from gnomAD version 3.1.1 for GRCh38 Bioconductor version: 3.13 Store minor allele frequency data from the Genome Aggregation Database (gnomAD version 3.1.1) for the human genome…

DOI: 10.18129/B9.bioc.BSgenome.Rnorvegicus.UCSC.rn7   Full genome sequences for Rattus norvegicus (UCSC genome rn7) Bioconductor version: Release (3.17) Full genome sequences for Rattus norvegicus (Rat) as provided by UCSC (genome rn7) and stored in Biostrings objects. Author: The Bioconductor Dev Team Maintainer: Bioconductor Package Maintainer <maintainer at bioconductor.org> Citation (from within R,…

DOI: 10.18129/B9.bioc.BSgenome.Cjacchus.UCSC.calJac4   This is the development version of BSgenome.Cjacchus.UCSC.calJac4; for the stable release version, see BSgenome.Cjacchus.UCSC.calJac4. Full genome sequences for Callithrix jacchus (UCSC version calJac4) Bioconductor version: Development (3.18) Full genome sequences for Callithrix jacchus (Marmoset) as provided by UCSC (calJac4, May 2020) and wrapped in a BSgenome object….

Bioconductor is an open-source software project that provides tools for the analysis and comprehension of high-throughput genomic data. It’s a powerful tool, widely used in bioinformatics and computational biology to process and analyze intricate biological data. Bioconductor’s strength lies in its vast array of packages specifically tailored for genomics research,…

DOI: 10.18129/B9.bioc.wavClusteR     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see wavClusteR. Sensitive and highly resolved identification of RNA-protein interaction sites in PAR-CLIP data Bioconductor version: 3.12 The package provides an integrated pipeline for the analysis of PAR-CLIP data. PAR-CLIP-induced transitions are…

Dear all, I forged a BSgenome with BSgenomeForge for the Indian medaka. This is what the seed file looks like: Package: BSgenome.Omelastigma.NCBI.ASM292280v2 Title: Full genomic sequences for Oryzias melastigma (NCBI assembly ASM292280v2) Description: Full genomic sequences for Oryzias melastigma as provided by NCBI (assembly ASM292280v2, assembly accession GCF_002922805.2). The sequences…

I have Granges with start and end but I want to count number of gc in stretch of DNA. however, i’m not able to properly subset bsgenome to be able to do that. here’s my approach. > gr_pro GRanges object with 3 ranges and 2 metadata columns: seqnames ranges strand…

I have Granges with start and end but I want to count number of gc in stretch of DNA. however, i’m not able to properly subset bsgenome to be able to do that. here’s my approach. > gr_pro GRanges object with 3 ranges and 2 metadata columns: seqnames ranges strand…

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Thu, 27 Jul 2023 06:08:48 +0200 Source: r-bioc-bsgenome Architecture: source Version: 1.68.0-1 Distribution: unstable Urgency: medium Maintainer: Debian R Packages Maintainers <r-pkg-t…@alioth-lists.debian.net> Changed-By: Andreas Tille <ti…@debian.org> Changes: r-bioc-bsgenome (1.68.0-1) unstable; urgency=medium . * New upstream version * Rename d/t/run-unit-tests to d/t/vignette…

Install r-bioc-bsgenome Installing r-bioc-bsgenome package on Ubuntu is as easy as running the following command on terminal: sudo apt-get update sudo apt-get install r-bioc-bsgenome r-bioc-bsgenome package information More information about install using apt-get Advanced Package Tool, or APT, is a free software user interface that works with core libraries to…

DOI: 10.18129/B9.bioc.txcutr   Transcriptome CUTteR Bioconductor version: Release (3.17) Various mRNA sequencing library preparation methods generate sequencing reads specifically from the transcript ends. Analyses that focus on quantification of isoform usage from such data can be aided by using truncated versions of transcriptome annotations, both at the alignment or pseudo-alignment…

Gallus gallus (Chicken) full genome (UCSC version galGal3) Bioconductor version: 2.6 Gallus gallus (Chicken) full genome as provided by UCSC (galGal3, May 2006) and stored in Biostrings objects. Author: H. Pages Maintainer: Biocore Team c/o BioC user list <bioconductor at stat.math.ethz.ch> To install this package, start R and enter: source(“http://bioconductor.org/biocLite.R”)…

.. BSgenome.Amellifera.BeeBase.assembly4.html BSgenome.Amellifera.UCSC.apiMel2.html BSgenome.Athaliana.TAIR.01222004.html BSgenome.Athaliana.TAIR.04232008.html BSgenome.Btaurus.UCSC.bosTau3.html BSgenome.Btaurus.UCSC.bosTau4.html BSgenome.Celegans.UCSC.ce2.html BSgenome.Cfamiliaris.UCSC.canFam2.html BSgenome.Dmelanogaster.UCSC.dm2.html BSgenome.Dmelanogaster.UCSC.dm3.html BSgenome.Drerio.UCSC.danRer5.html BSgenome.Ecoli.NCBI.20080805.html BSgenome.Ggallus.UCSC.galGal3.html BSgenome.Hsapiens.UCSC.hg17.html BSgenome.Hsapiens.UCSC.hg18.html BSgenome.Hsapiens.UCSC.hg19.html BSgenome.Mmusculus.UCSC.mm8.html BSgenome.Mmusculus.UCSC.mm9.html BSgenome.Ptroglodytes.UCSC.panTro2.html BSgenome.Rnorvegicus.UCSC.rn4.html BSgenome.Scerevisiae.UCSC.sacCer1.html BSgenome.Scerevisiae.UCSC.sacCer2.html GGHumanMethCancerPanelv1.db.html GO.db.html Hs6UG171.db.html HuExExonProbesetLocationHg18.html HuExExonProbesetLocationHg19.html HuO22.db.html IlluminaHumanMethylation27k.db.html JazaeriMetaData.db.html KEGG.db.html LAPOINTE.db.html Masks.Dmelanogaster.UCSC.dm3.html MoExExonProbesetLocation.html Mu15v1.db.html Mu22v3.db.html Norway981.db.html OperonHumanV3.db.html PFAM.db.html POCRCannotation.db.html PartheenMetaData.db.html RaExExonProbesetLocation.html RmiR.Hs.miRNA.html RmiR.hsa.html Roberts2005Annotation.db.html SHDZ.db.html SNPlocs.Hsapiens.dbSNP.20071016.html SNPlocs.Hsapiens.dbSNP.20080617.html SNPlocs.Hsapiens.dbSNP.20090506.html…

Download stats for software package BSgenome.Mmusculus.UCSC.mm10 This page was generated on 2023-06-28 04:04:42 -0400 (Wed, 28 Jun 2023). BSgenome.Mmusculus.UCSC.mm10 home page: release version, devel version. Number of downloads for software package BSgenome.Mmusculus.UCSC.mm10, year by year, from 2023 back to 2009 (years with no downloads are omitted): 2023 Month Nb of distinct IPs Nb of downloads…

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.UCSC.hg38.masked     Full masked genome sequences for Homo sapiens (UCSC version hg38, based on GRCh38.p13) Bioconductor version: Release (3.14) Full genome sequences for Homo sapiens (Human) as provided by UCSC (genome hg38, based on GRCh38.p13) and stored in Biostrings objects. The sequences are the same as in BSgenome.Hsapiens.UCSC.hg38,…

IsoformSwitchAnalyzeR Error in reading GTF file 0 Hi, I am using IsoformSwitchAnalyzeR v1.21.0 in R 4.3.0 environment using RStudio (2023.06.0+421 “Mountain Hydrangea” Release). When I try to import GTF file (obtained from Ensembl Plants) I get the following error ; Step 1 of 7: Checking data… Step 2 of 7:…

VariantFiltering error 0 @andrew-beggs-5579 Last seen 15 hours ago United Kingdom Hi Trying to run VariantFilter, manage to import fine, PED file is pretty standard: FAM001 SAMPLE_C SAMPLE_P1 SAMPLE_P2 1 2 FAM001 SAMPLE_P1 0 0 0 1 FAM001 SAMPLE_P2 0 0 0 1 > vfpar VariantFiltering parameter object VCF file(s):…

Get Intron Seq 1 @c209ec01 Last seen 5 hours ago United States Hello, I’m wondering how to intron sequence by coordinates. For example, I know that there might be an intron in chr20 start=50941210,end=50942030, I’m wondering if I could use the BSgenome package in R to derive the DNAString object…

      This is the development version of SNPlocs.Hsapiens.dbSNP.20100427; for the stable release version, see SNPlocs.Hsapiens.dbSNP.20100427. SNP locations for Homo sapiens (dbSNP BUILD 131) Bioconductor version: Development (3.5) SNP locations and alleles for Homo sapiens extracted from dbSNP BUILD 131:human_9606 (based on GRCh37). The source data files used for…

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.UCSC.hg38     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg38. Full genome sequences for Homo sapiens (UCSC version hg38, based on GRCh38.p12) Bioconductor version: 3.13 Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg38, based on GRCh38.p12)…

plyranges:: summarise() not recognizing previous summarized column (counts) 0 I’m calculating proportions of cpgs methylated per chromosome but i get the error and not sure how to resolve it > cpgr %>% group_by(seqnames) %>% summarise(cnts = n(), prop = cnts/seqlengths(cpgr)) Error in eval_tidy(quo, data = overscope) : object ‘cnts’ not…

DOI: 10.18129/B9.bioc.REMP     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see REMP. Repetitive Element Methylation Prediction Bioconductor version: 3.13 Machine learning-based tools to predict DNA methylation of locus-specific repetitive elements (RE) by learning surrounding genetic and epigenetic information. These tools provide genomewide…

DOI: 10.18129/B9.bioc.karyoploteR     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see karyoploteR. Plot customizable linear genomes displaying arbitrary data Bioconductor version: 3.13 karyoploteR creates karyotype plots of arbitrary genomes and offers a complete set of functions to plot arbitrary data on them….

DOI: 10.18129/B9.bioc.SomaticSignatures     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see SomaticSignatures. Somatic Signatures Bioconductor version: 3.13 The SomaticSignatures package identifies mutational signatures of single nucleotide variants (SNVs). It provides a infrastructure related to the methodology described in Nik-Zainal (2012, Cell), with…

Submitting BSgenome package for a new assembly 0 @0821d9fe Last seen 4 hours ago Germany Hi, Is it possible to upload BSgenome/GenomicFeatures packages for new genome assemblies of non-model species? I assembled these genomes and had to create the BSgenome package as it was required for a different tool that…

Comment: DoparParam() execution fails when foreach() works by boris • 0 Registration allows me to use ClusterMQ as the backend for foreach/BiocParallel, linking to SLURM and unlocking far larger compute resource… Comment: TCGAbiolinks cannot find bcr_patient_barcode by Habil Zare &utrif; 170 Have you increased the version so that it builds…

Error in .Call2(“C_solve_user_SEW”, refwidths, start, end, width, translate.negative.coord 0 Dear guys, Any solutions for the error when trying to construct the trinucleotideMatrix? test_maf.tnm = trinucleotideMatrix(maf = test_maf, ref_genome = “BSgenome.Hsapiens.UCSC.hg38” ) ## some site/region cause the error -Extracting 5′ and 3′ adjacent bases -Extracting +/- 20bp around mutated bases for…

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP149.GRCh38     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see SNPlocs.Hsapiens.dbSNP149.GRCh38. SNP locations for Homo sapiens (dbSNP Build 149) Bioconductor version: 3.15 SNP locations and alleles for Homo sapiens extracted from NCBI dbSNP Build 149. The source data files used for…

Q7. Load the following 3 packages: BSGenome, preprocessCore, biomaRt ## if they arent available under your packages in rstudio cloud, please use: install.packages(BiocManager) BiocManager::install(“biomaRt”) #Q8. Create a DNAString with the following sequence: **CATCACACAGCATGACCCCCATGACGATAAACGTC** and save it in a variable of your choosing. #Q9. From the sequence you created, extract the…

please solve this question from codes done in R studio #Q13. Plesse write the code to install and load the mouse genome (BSgenome.Mmusculus.UCSC.mm10). If installing, this will probably take some time. #Q14. What is code to determine the length of the following chromosomes of the mouse genome (Mmusculus)? #chr3 and…

multi-mapping reads settings in Rsubread or Rsubjunc 0 Hi All, I am using Rsubjunc to process my RNA seq data for DEseq2 and differential splicing analysis. I have a question about how to set multi-mapping reads alignment in Rsubjunc R package. The command I used is attached to the end…

DOI: 10.18129/B9.bioc.BSgenome.Mmulatta.UCSC.rheMac2.masked   This package is for version 3.16 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mmulatta.UCSC.rheMac2.masked. Full masked genome sequences for Macaca mulatta (UCSC version rheMac2) Bioconductor version: 3.16 Full genome sequences for Macaca mulatta (Rhesus) as provided by UCSC (rheMac2, Jan. 2006) and stored in Biostrings…

Phylogenetic tree construction Tree diagram showing relationships between CDK proteins was constructed from a multi-sequence alignment (MSA) using Geneious95. The “Geneious Aligner”, was used to generate the MSA, and the neighbor joining method was used to construct the tree. All default parameters were used except where otherwise indicated. Combinatorial CRISPR…

DOI: 10.18129/B9.bioc.BSgenome.Sscrofa.UCSC.susScr3     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Sscrofa.UCSC.susScr3. Full genome sequences for Sus scrofa (UCSC version susScr3) Bioconductor version: 3.15 Full genome sequences for Sus scrofa (Pig) as provided by UCSC (susScr3, Aug. 2011) and stored in Biostrings…

DOI: 10.18129/B9.bioc.BSgenome.Celegans.UCSC.ce6     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Celegans.UCSC.ce6. Full genome sequences for Caenorhabditis elegans (UCSC version ce6) Bioconductor version: 3.15 Full genome sequences for Caenorhabditis elegans (Worm) as provided by UCSC (ce6, May 2008) and stored in Biostrings…

DOI: 10.18129/B9.bioc.ATACCoGAPS   Analysis Tools for scATACseq Data with CoGAPS Bioconductor version: Release (3.17) Provides tools for running the CoGAPS algorithm (Fertig et al, 2010) on single-cell ATAC sequencing data and analysis of the results. Can be used to perform analyses at the level of genes, motifs, TFs, or pathways….

    This package is for version 2.9 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mmusculus.UCSC.mm9. Mus musculus (Mouse) full genome (UCSC version mm9) Bioconductor version: 2.9 Mus musculus (Mouse) full genome as provided by UCSC (mm9, Jul. 2007) and stored in Biostrings objects. Author: H. Pages Maintainer:…

DOI: 10.18129/B9.bioc.BSgenome.Drerio.UCSC.danRer5.masked   Full masked genome sequences for Danio rerio (UCSC version danRer5) Bioconductor version: Release (3.17) Full genome sequences for Danio rerio (Zebrafish) as provided by UCSC (danRer5, Jul. 2007) and stored in Biostrings objects. The sequences are the same as in BSgenome.Drerio.UCSC.danRer5, except that each of them has…

DOI: 10.18129/B9.bioc.phastCons100way.UCSC.hg19     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see phastCons100way.UCSC.hg19. UCSC phastCons conservation scores for hg19 Bioconductor version: 3.13 Store UCSC phastCons conservation scores for the human genome (hg19) calculated from multiple alignments with other 99 vertebrate species. Author: Robert…

Home Bioconductor 3.17 Released April 26, 2023 Bioconductors: We are pleased to announce Bioconductor 3.17, consisting of 2230 software packages, 419 experiment data packages, 912 annotation packages, 27 workflows and 3 books. There are 79 new software packages, 7 new data experiment packages, no new annotation packages, 2 new workflows,…

DOI: 10.18129/B9.bioc.BSgenome.Ptroglodytes.UCSC.panTro6     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Ptroglodytes.UCSC.panTro6. Full genome sequences for Pan troglodytes (UCSC version panTro6) Bioconductor version: 3.13 Full genome sequences for Pan troglodytes (Chimp) as provided by UCSC (panTro6, Jan. 2018) and stored in Biostrings…

DOI: 10.18129/B9.bioc.Ularcirc     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see Ularcirc. Shiny app for canonical and back splicing analysis (i.e. circular and mRNA analysis) Bioconductor version: 3.13 Ularcirc reads in STAR aligned splice junction files and provides visualisation and analysis tools…

Last updated on 2023-04-18 | Edit this page Estimated time NA minutes Expand All Solutions Questions How do I install Bioconductor packages? How do I check if newer versions of my installed packages are available? How do I update Bioconductor packages? How do I find out the name of packages…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Gaculeatus.UCSC.gasAcu1. Gasterosteus aculeatus (Stickleback) full genome (UCSC version gasAcu1) Bioconductor version: 2.11 Gasterosteus aculeatus (Stickleback) full genome as provided by UCSC (gasAcu1, Feb. 2006) and stored in Biostrings objects. Author: H. Pages Maintainer:…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg17. Homo sapiens (Human) full genome (UCSC version hg17) Bioconductor version: 2.11 Homo sapiens (Human) full genome as provided by UCSC (hg17, May 2004) and stored in Biostrings objects. Author: H. Pages Maintainer:…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.UCSC.hg18. Homo sapiens (Human) full genome (UCSC version hg18) Bioconductor version: 2.11 Homo sapiens (Human) full genome as provided by UCSC (hg18, Mar. 2006) and stored in Biostrings objects. Author: The Bioconductor Dev…

This is the development version of GenomicRanges; for the stable release version, see GenomicRanges. The ability to efficiently represent and manipulate genomic annotations and alignments is playing a central role when it comes to analyzing high-throughput sequencing data (a.k.a. NGS data). The GenomicRanges package defines general purpose containers for storing…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Tgondii.ToxoDB.7.0. Toxoplasma gondii ME49 (ToxoDB-7.0) Bioconductor version: 2.11 Toxoplasma gondii ME49 genome Release 7.0 available at www.toxodb.org Author: Matthew Croken <matthew.croken at phd.einstein.yu.edu>, Olivier Lucas <olucas.usf at gmail.com> Maintainer: Matthew Croken <matthew.croken at…

DOI: 10.18129/B9.bioc.diffHic     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see diffHic. Differential Analyis of Hi-C Data Bioconductor version: 3.15 Detects differential interactions across biological conditions in a Hi-C experiment. Methods are provided for read alignment and data pre-processing into interaction counts….

Download stats for workflow package BSgenome.Hsapiens.UCSC.hg38 This page was generated on 2023-04-01 01:19:13 -0400 (Sat, 01 Apr 2023). BSgenome.Hsapiens.UCSC.hg38 home page: release version, devel version. Number of downloads for workflow package BSgenome.Hsapiens.UCSC.hg38, year by year, from 2023 back to 2015 (years with no downloads are omitted): 2023 Month Nb of distinct IPs Nb of downloads…

Request : Add Chinese Spring Wheat genome to BSgenome 1 @fb1210e9 Last seen 6 months ago France Hello, The team I am currently working with is studying chinese spring wheat (Triticum aestivum) and we would greatly benefit from a common package for both the base genome and its related annotation….

Infrastructure for Biostrings-based genome data packages Bioconductor version: 2.5 Infrastructure shared by all the Biostrings-based genome data packages Author: Herve Pages Maintainer: H. Pages <hpages at fhcrc.org> To install this package, start R and enter: source(“http://bioconductor.org/biocLite.R”) biocLite(“BSgenome”) To cite this package in a publication, start R and enter: citation(“BSgenome”) Documentation…

    This package is for version 2.11 of Bioconductor; for the stable, up-to-date release version, see GeneRegionScan. GeneRegionScan Bioconductor version: 2.11 A package with focus on analysis of discrete regions of the genome. This package is useful for investigation of one or a few genes using Affymetrix data, since…

Hi, I am attempting to work through the workflow described in “Swimming downstream: statistical analysis of differential transcript usage following Salmon quantification.” I am running into an error message when I try to make the counts dataframe for DRIMseq: Error in data.frame(gene_id = txdf$GENEID, feature_id = txdf$TXNAME, cts) : arguments…

I am trying to annotate a list of SNPs using the hg38 genome (knownGene) and locateVariants(). The program is able to successfully run and provide “GeneIDs” for several of the loci. However, some GeneIDs are applied to SNPs in completely different regions and on completely different chromosomes. When I cross…

No BSgenome for Human HG19 or HG38 with R version 4.2.2 and Bioconductor 3.16 1 @aac4f0b4 Last seen 17 hours ago France Hello, I’m currently trying to install BSgenome.Hsapiens.UCSC.hg19 and BSgenome.Hsapiens.UCSC.hg38 through bioconductor on my desktop (Windows) My current R version is 4.2.2.and bioconductor is 3.16 My command is this…

DOI: 10.18129/B9.bioc.BSgenome.Mmusculus.UCSC.mm8.masked     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mmusculus.UCSC.mm8.masked. Full masked genome sequences for Mus musculus (UCSC version mm8) Bioconductor version: 3.13 Full genome sequences for Mus musculus (Mouse) as provided by UCSC (mm8, Feb. 2006) and stored in…

DOI: 10.18129/B9.bioc.crisprDesign   This is the development version of crisprDesign; for the stable release version, see crisprDesign. Comprehensive design of CRISPR gRNAs for nucleases and base editors Bioconductor version: Development (3.17) Provides a comprehensive suite of functions to design and annotate CRISPR guide RNA (gRNAs) sequences. This includes on- and…

DOI: 10.18129/B9.bioc.BSgenome.Cjacchus.UCSC.calJac3     This package is for version 3.13 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Cjacchus.UCSC.calJac3. Full genome sequences for Callithrix jacchus (UCSC version calJac3) Bioconductor version: 3.13 Full genome sequences for Callithrix jacchus (Marmoset) as provided by UCSC (calJac3, Mar. 2009) and stored in Biostrings…

Infrastructure for manipulating intervals on sequences Bioconductor version: 2.6 The package provides efficient low-level and highly reusable S4 classes for storing ranges of integers, RLE vectors (Run-Length Encoding), and, more generally, data that can be organized sequentially, as well as views on these sequences. Efficient list-like classes are also provided…

Download stats for software package BSgenome.Hsapiens.NCBI.GRCh38 This page was generated on 2023-03-01 05:20:23 -0500 (Wed, 01 Mar 2023). BSgenome.Hsapiens.NCBI.GRCh38 home page: release version, devel version. Number of downloads for software package BSgenome.Hsapiens.NCBI.GRCh38, year by year, from 2023 back to 2009 (years with no downloads are omitted): 2022 Month Nb of distinct IPs Nb of downloads…

Hi, I am running the HTSeqGenie on both MacOS and Linux with the test TP53 samples. They both gave me error in reading the fastq files. It seems having problems reading the fastq.gz files in each parallel process. Could anyone help me with this please? Error are at below: checkConfig.R/checkConfig.template:…

DOI: 10.18129/B9.bioc.crisprseekplus     crisprseekplus Bioconductor version: Release (3.16) Bioinformatics platform containing interface to work with offTargetAnalysis and compare2Sequences in the CRISPRseek package, and GUIDEseqAnalysis. Author: Sophie Wigmore <Sophie.Wigmore at umassmed.edu>, Alper Kucukural <alper.kucukural at umassmed.edu>, Lihua Julie Zhu <julie.zhu at umassmed.edu>, Michael Brodsky <Michael.Brodsky at umassmed.edu>, Manuel Garber <Manuel.Garber…

DOI: 10.18129/B9.bioc.XtraSNPlocs.Hsapiens.dbSNP141.GRCh38     This package is deprecated. It will probably be removed from Bioconductor. Please refer to the package end-of-life guidelines for more information. This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see XtraSNPlocs.Hsapiens.dbSNP141.GRCh38. Extra SNP locations for Homo sapiens (dbSNP Build 141)…

snpsBySeqname() and snpsByOverlaps() functions in BSgenome package did not work in my computer 0 @af6d9623 Last seen 5 hours ago Hong Kong I want to get SNPs information with snpsByOverlaps() and snpsBySeqname() function, but it relied as below: #my code library(SNPlocs.Hsapiens.dbSNP144.GRCh38) library(BSgenome.Hsapiens.NCBI.GRCh38) snps <- SNPlocs.Hsapiens.dbSNP144.GRCh38 snpsBySeqname(snps,c(‘1′,’MT’)) #results #Error in extract_rowids(x_rowids_env,…

DOI: 10.18129/B9.bioc.gcapc     GC Aware Peak Caller Bioconductor version: Release (3.13) Peak calling for ChIP-seq data with consideration of potential GC bias in sequencing reads. GC bias is first estimated with generalized linear mixture models using effective GC strategy, then applied into peak significance estimation. Author: Mingxiang Teng and…

DOI: 10.18129/B9.bioc.RESOLVE     This is the development version of RESOLVE; for the stable release version, see RESOLVE. RESOLVE: An R package for the efficient analysis of mutational signatures from cancer genomes Bioconductor version: Development (3.17) Cancer is a genetic disease caused by somatic mutations in genes controlling key biological…

DOI: 10.18129/B9.bioc.BSgenome.Mfuro.UCSC.musFur1     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Mfuro.UCSC.musFur1. Full genome sequences for Mustela putorius furo (UCSC version musFur1) Bioconductor version: 3.12 Full genome sequences for Mustela putorius furo (Ferret) as provided by UCSC (musFur1, Apr. 2011) and stored…

DOI: 10.18129/B9.bioc.metaseqR2     An R package for the analysis and result reporting of RNA-Seq data by combining multiple statistical algorithms Bioconductor version: Release (3.11) Provides an interface to several normalization and statistical testing packages for RNA-Seq gene expression data. Additionally, it creates several diagnostic plots, performs meta-analysis by combinining…

DOI: 10.18129/B9.bioc.DiffBind     This package is for version 3.15 of Bioconductor; for the stable, up-to-date release version, see DiffBind. Differential Binding Analysis of ChIP-Seq Peak Data Bioconductor version: 3.15 Compute differentially bound sites from multiple ChIP-seq experiments using affinity (quantitative) data. Also enables occupancy (overlap) analysis and plotting functions….

HI everyone. I have a set of mouse SNPs (~974) from GRCm39 that I’m trying to get either GERP or UCSC Conservation scores on. To do this, I’m using rtracklayer to try to query the ranges of the SNP and return the multiz35way conservation score. However, when I do this,…

    This package is for version 3.2 of Bioconductor; for the stable, up-to-date release version, see MEDIPS. DNA IP-seq data analysis Bioconductor version: 3.2 MEDIPS was developed for analyzing data derived from methylated DNA immunoprecipitation (MeDIP) experiments followed by sequencing (MeDIP-seq). However, MEDIPS provides functionalities for the analysis of…

DOI: 10.18129/B9.bioc.BSgenome.Scerevisiae.UCSC.sacCer1     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Scerevisiae.UCSC.sacCer1. Saccharomyces cerevisiae (Yeast) full genome (UCSC version sacCer1) Bioconductor version: 3.12 Saccharomyces cerevisiae (Yeast) full genome as provided by UCSC (sacCer1, Oct. 2003) and stored in Biostrings objects. Author: The…

Hello! I am working on analyzing a dataset I created with the 10x Chromium Single Cell Multiome kit. In order to add gene annotation to the ATAC data, I am trying to install and use the “EnsDb.Mmusculus.v79” and “BSgenome.Mmusculus.UCSC.mm10” packages with bioconductor. The same ERROR has come up repeatedly whenever…

Please these Questions using R Studio #Q13. Plesse write the code to install and load the mouse genome (BSgenome.Mmusculus.UCSC.mm10). If installing, this will probably take some time. #Q14. What is code to determine the length of the following chromosomes of the mouse genome (Mmusculus)? #chr3 and chr19 #Q15. What is…

DOI: 10.18129/B9.bioc.MafH5.gnomAD.v3.1.1.GRCh38     This is the development version of MafH5.gnomAD.v3.1.1.GRCh38; for the stable release version, see MafH5.gnomAD.v3.1.1.GRCh38. Minor allele frequency data from gnomAD version 3.1.1 for GRCh38 Bioconductor version: Development (3.16) Store minor allele frequency data from the Genome Aggregation Database (gnomAD version 3.1.1) for the human genome version…

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP155.GRCh37     This is the development version of SNPlocs.Hsapiens.dbSNP155.GRCh37; to use it, please install the devel version of Bioconductor. Human SNP locations and alleles extracted from dbSNP Build 155 and placed on the GRCh37/hg19 assembly Bioconductor version: Development (3.16) The 929,496,192 SNPs in this package were extracted from…