Tag: CCA

Domestic pigs are susceptible to experimental infection with non-human primate-derived Reston virus without the need for adaptation

Ethics and animal welfare statement All infectious work with RESTV, including sample inactivation, was performed in the Containment Level 4 laboratory (CL4) in accordance with the policies and protocols outlined by the Canadian Science Centre for Human and Animal Health Institutional Biosafety Committee. All animal work was performed in strict…

Continue Reading Domestic pigs are susceptible to experimental infection with non-human primate-derived Reston virus without the need for adaptation

Frontiers Publishing Partnerships | Construction of recombinant adenovirus-5 vector to prevent replication-competent adenovirus occurrence

Introduction In recent years, recombinant adenoviral vectors have been used in different fields of biomedical sciences such as in vitro and in vivo gene transfer, vaccine development, and gene therapy (Russell, 2000; Mitani and Kubo, 2002). Multiple features of recombinant adenoviral vectors such as high packaging capacity for transgene insertion,…

Continue Reading Frontiers Publishing Partnerships | Construction of recombinant adenovirus-5 vector to prevent replication-competent adenovirus occurrence

Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain

Mouse brain tissues All experimental procedures using live animals were approved by the Salk Institute Animal Care and Use Committee under protocol number 18-00006. Adult (P56) C57BL/6J male mice were purchased from the Jackson Laboratory at 7 weeks of age and maintained in the Salk animal barrier facility on 12-h dark–light…

Continue Reading Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain

Cholangiocarcinoma Pipeline Drugs Analysis Report(2023 Updates): FDA Approvals, Clinical Trials, Therapies, MOA, ROA by DelveInsight

PRESS RELEASE Published December 12, 2023 (Las Vegas, Nevada, United States) As per DelveInsight’s assessment, globally, Cholangiocarcinoma pipeline constitutes 55+ key companies continuously working towards developing 60+ Cholangiocarcinoma treatment therapies, analysis of Clinical Trials, Therapies, Mechanism of Action, Route of Administration, and Developments analyzes DelveInsight. The Cholangiocarcinoma Pipeline report embraces…

Continue Reading Cholangiocarcinoma Pipeline Drugs Analysis Report(2023 Updates): FDA Approvals, Clinical Trials, Therapies, MOA, ROA by DelveInsight

Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…

Continue Reading Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

RPTOR mutation: a novel predictor of efficacious immunotherapy in melanoma

Li Z, Gao Y, Cao Y et al (2023) Extracellular RNA in Melanoma: advances, challenges, and opportunities. Front Cell Dev Biol 11:1141543. doi.org/10.3389/fcell.2023.1141543 Article  PubMed  PubMed Central  Google Scholar  Hamid O, Cowey CL, Offner M, Faries M, Carvajal RD (2019) Efficacy, Safety, and tolerability of approved combination BRAF and MEK…

Continue Reading RPTOR mutation: a novel predictor of efficacious immunotherapy in melanoma

GENFIT Updates 2024 Outlook Following Acceptance of

US Food and Drug Administration (FDA) has granted Priority Review for New Drug Application (NDA) for elafibranor in PBC, and European Medicine Agency (EMA) has also validated the Marketing Authorization Application (MAA) for elafibranor. Acceptance triggers a first milestone payment. Further milestones are expected upon US and European launches which…

Continue Reading GENFIT Updates 2024 Outlook Following Acceptance of

tRNA therapeutics for genetic diseases

Huang, X. et al. The landscape of mRNA nanomedicine. Nat. Med. 28, 2273–2287 (2022). Article  CAS  Google Scholar  Rohner, E., Yang, R., Foo, K. S., Goedel, A. & Chien, K. R. Unlocking the promise of mRNA therapeutics. Nat. Biotechnol. 40, 1586–1600 (2022). Article  CAS  Google Scholar  Brown, A., Shao, S.,…

Continue Reading tRNA therapeutics for genetic diseases

A Reliable Method for Quantifying Plasma Cell-Free DNA Using an Internal Standard Strategy: Evaluation in a Cohort of Non-Pregnant and Pregnant Women

Martignano F. Cell-free DNA: an overview of sample types and isolation procedures. In: Casadio V, Salvi S, editors. Cell-free DNA as diagnostic markers. Methods in molecular biology, Vol. 1909. New York, NY: Humana Press; 2019. p. 13–27. doi.org/10.1007/978-1-4939-8973-7_2. Volckmar AL, Sültmann H, Riediger A, Fioretos T, Schirmacher P, Endris V,…

Continue Reading A Reliable Method for Quantifying Plasma Cell-Free DNA Using an Internal Standard Strategy: Evaluation in a Cohort of Non-Pregnant and Pregnant Women

Metagenomic profiles of archaea and bacteria within thermal and geochemical gradients of the Guaymas Basin deep subsurface

Sampling sites and depths Metagenomes were produced from sediment samples at drilling sites U1545B to U1549B that follow a northwest-to-southeast transect across the northwestern flanking region of Guaymas Basin (Fig. 1A) and include an off-axis hydrothermal system, the Ringvent site (Fig. 1B). The samples were selected to coordinate with depths used for…

Continue Reading Metagenomic profiles of archaea and bacteria within thermal and geochemical gradients of the Guaymas Basin deep subsurface

ICMR-NIIH Bioinformatics Job – Biotech, Microbiology, Biochem Job

“Exciting Job Opportunity in Bioinformatics at ICMR-NIIH: Apply Now for Biotech, Microbiology, and Biochem Positions!” ICMR-NIIH Bioinformatics Job – Biotech, Microbiology, Biochem Apply Online National Institute of Immunohaematology (NIIH), a part of the Department of Health Research under the Ministry of Health and Family Welfare, invites applications for the following…

Continue Reading ICMR-NIIH Bioinformatics Job – Biotech, Microbiology, Biochem Job

Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs

Rv3907c is the CCA-adding enzyme in Mycobacterium It remains unclear whether the rv3907c gene product, originally annotated as poly(A) polymerase, is in fact the CCA-adding enzyme in Mtb. Rv3907c is composed of three domains, an N-terminal class II polymerase β superfamily domain, a central RNA-binding domain and a C-terminal HD…

Continue Reading Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs

Are liger or Seurat CCA good strategies for multiple scRNA-seq data integration?

Are liger or Seurat CCA good strategies for multiple scRNA-seq data integration? 1 Hi, I am working on analyzing multiple scRNA-seq dataset from embryonic tissues at progressive stages. I used three recent integration algorithms 1) liger, 2) Seurat CCA and 3) fastMNN. I started with these based on recommendation from…

Continue Reading Are liger or Seurat CCA good strategies for multiple scRNA-seq data integration?

Oncogenic activation revealed by FGFR2 genetic alterations in intrahepatic cholangiocarcinomas | Cell & Bioscience

Everhart JE, Ruhl CE. Burden of digestive diseases in the United States Part III: Liver, biliary tract, and pancreas. Gastroenterology. 2009;136(4):1134–44. Article  PubMed  Google Scholar  Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. Lancet. 2005;366(9493):1303–14. Article  PubMed  Google Scholar  Nakanuma Y, Klimstra DS, Komuta M, Zen Y (2019) Intrahepatic…

Continue Reading Oncogenic activation revealed by FGFR2 genetic alterations in intrahepatic cholangiocarcinomas | Cell & Bioscience

Options for assigning cell labels to barcodes from CITE-seq experiment

Options for assigning cell labels to barcodes from CITE-seq experiment 0 I have barcodes from a CITE-seq experiment that I would like to assign cell labels to. To accomplish this task, I used the Monaco reference database as input into SingleR based on the RNA expression data. I would now…

Continue Reading Options for assigning cell labels to barcodes from CITE-seq experiment

Relay: Market Underestimating Lirafugratinib’s Potential (Upgrade) (RLAY)

Anchiy At a Glance Relay Therapeutics (NASDAQ:RLAY) has reached a critical phase, juxtaposing strong financial foundations against increasing operational costs, which I have previously analyzed in depth. Since my last evaluation, lirafugratinib’s clinical momentum has been maintained in the Phase 1/2 ReFocus trial, showing significant promise for FGFR2-altered cholangiocarcinoma, although…

Continue Reading Relay: Market Underestimating Lirafugratinib’s Potential (Upgrade) (RLAY)

Correction of a homoplasmic mitochondrial tRNA mutation in patient-derived iPSCs via a mitochondrial base editor

Human induced pluripotent stem cells (iPSCs) Reprogramming and Culture This study was ethically approved by the Medical Ethics Committee of Nanjing Maternal and Child Health Care Hospital (2021KY-131), and informed consents were obtained from the patient’s legal guardian as well as the healthy donors, in accordance with the Declaration of…

Continue Reading Correction of a homoplasmic mitochondrial tRNA mutation in patient-derived iPSCs via a mitochondrial base editor

Relay Therapeutics Reports Third Quarter 2023 Financial Results and Corporate Highlights

Relay Therapeutics, Inc. Reported initial RLY-4008 (lirafugratinib) data demonstrating durable responses across multiple FGFR2-altered solid tumors Announced plans to initiate RLY-2608 + fulvestrant + CDK4/6 triplet combinations in HR+/HER2- breast cancer by YE 2023 Updated pipeline to extend cash runway by approximately 1 year Approximately $811 million in cash, cash…

Continue Reading Relay Therapeutics Reports Third Quarter 2023 Financial Results and Corporate Highlights

HLA allele-calling using multi-ancestry whole-exome sequencing from the UK Biobank identifies 129 novel associations in 11 autoimmune diseases

HLA allele calling from WES HLA-HD was used to call HLA alleles for 454,824 participants at 3-field resolution (representing the allele’s serological specificity, HLA protein, and synonymous variants). We used the UKB whole-genome genotyping (unavailable in 1283 participants) projected on the 1000 Genome reference to estimate genetic ancestry. We found…

Continue Reading HLA allele-calling using multi-ancestry whole-exome sequencing from the UK Biobank identifies 129 novel associations in 11 autoimmune diseases

Microsurgical Creation of Giant Bifurcation Aneurysms in Rabbits for the Evaluation of Endovascular Devices

Here, we describe the technique for the microsurgical creation of giant bifurcation aneurysms in rabbits for the evaluation of endovascular devices. Reliable animal models for giant aneurysms are rare. However, these models are extremely important for the development of new endovascular devices to treat these aneurysms safely. The advantages of…

Continue Reading Microsurgical Creation of Giant Bifurcation Aneurysms in Rabbits for the Evaluation of Endovascular Devices

HOXC-AS3 as an Oncological Biomarker and Therapeutic Target

1Department of Gastrointestinal Surgery, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, 330008, People’s Republic of China; 2Department of General Surgery, Jiujiang Hospital of Traditional Chinese Medicine, Jiujiang, Jiangxi, 332007, People’s Republic of China; 3Queen Mary School, Nanchang University, Nanchang, Jiangxi, 330038, People’s Republic of China Correspondence: Hongliang Luo,…

Continue Reading HOXC-AS3 as an Oncological Biomarker and Therapeutic Target

MD Anderson research highlights: ESMO 2023 sp

ABSTRACTS: LBA71, 1088MO, 95MO, LBA48, 1082O, 1085O, LBA34, 243MO MADRID ― The University of Texas MD Anderson Cancer Center’s Research Highlights provides a glimpse into recent basic, translational and clinical cancer research from MD Anderson experts. This special edition features upcoming oral presentations by MD Anderson researchers at the 2023 European Society for Medical Oncology…

Continue Reading MD Anderson research highlights: ESMO 2023 sp

Neuron Navigator 1 (Nav1) regulates the response to cocaine in mice

Mouse strains All mouse procedures were approved by the Institutional Animal Care and Use Committees at Binghamton or Stanford University; and were conducted in accordance with the National Institute of Health Guide for Care and Use of Laboratory Animals, Eighth Edition. All mice were originally obtained from Jackson Laboratories, and…

Continue Reading Neuron Navigator 1 (Nav1) regulates the response to cocaine in mice

Positive Breast Cancer Data from Relay Therapeutics

Last week, Relay Therapeutics shared results about their experimental drug, RLY-4008, designed to treat a specific type of breast cancer. The drug is being tested in a two-step study named the “ReFocus trial.” They’ve completed the first step, and now they’re in the second step, figuring out the right dosage….

Continue Reading Positive Breast Cancer Data from Relay Therapeutics

Relay Therapeutics Pauses Lirafugratinib Rare Cancer Plans Due to IRA

Pictured: Finger pressing pause button/iStock, cagkansayin Relay Therapeutics announced plans Thursday to shift gears, pausing its push for rare cancer and switching focus to the larger tumor-agnostic market. The Boston-based biotech is pointing to the Inflation Reduction Act as a driving factor of its decision.  Relay’s FGFR2 inhibitor has been…

Continue Reading Relay Therapeutics Pauses Lirafugratinib Rare Cancer Plans Due to IRA

Relay Therapeutics Announces Initial RLY-4008

35% ORR in patients with FGFR2 fusions (excluding CCA) & 40% ORR in patients with FGFR2-altered HR+/HER2- breast cancer RLY-4008 commercialization plans to focus on broader tumor agnostic opportunities Clinical focus on PI3Kα mutant selective programs, with plans to initiate RLY-2608 triplet combinations in HR+/HER2- breast cancer by YE 2023…

Continue Reading Relay Therapeutics Announces Initial RLY-4008

Relay Therapeutics, Inc. Announces Initial RLY-4008 (lirafugratinib) Data Demonstrating Durable Responses Across Multiple FGFR2-Altered Solid Tumors -October 12, 2023 at 04:05 pm EDT

Relay Therapeutics, Inc. announced initial clinical data for RLY-4008 (lirafugratinib) in patients with FGFR2-altered solid tumors. The first part of the study (dose escalation) is complete, and the second part of the study (dose expansion) is ongoing at the 70mg QD recommended Phase 2 dose. Most treatment-related adverse events were…

Continue Reading Relay Therapeutics, Inc. Announces Initial RLY-4008 (lirafugratinib) Data Demonstrating Durable Responses Across Multiple FGFR2-Altered Solid Tumors -October 12, 2023 at 04:05 pm EDT

Knight Therapeutics Announces Regulatory Submission of

MONTREAL, Oct. 10, 2023 (GLOBE NEWSWIRE) — Knight Therapeutics Inc., (TSX: GUD) (“Knight”) a pan-American (ex-USA) specialty pharmaceutical company, announced today that its Brazilian affiliate, United Medical Ltd., has submitted a marketing authorization application for pemigatinib to ANVISA, the Brazilian health regulatory agency, under the rare diseases approval pathway, for…

Continue Reading Knight Therapeutics Announces Regulatory Submission of

When should I NOT apply batch correction for my single-cell RNAseq data?

Hi! Some personal thoughts/opinions: integration is about finding the similar cell types/states across data sets (either with or without batch effect). An experimental batch corresponds to a set of samples that were processed simultaneously in the same manner and, thus, reducing the effect of technical artifacts/noise. As I see your…

Continue Reading When should I NOT apply batch correction for my single-cell RNAseq data?

ncRNA | Free Full-Text | Long Non-Coding RNA TUG1 Gene Polymorphism and TUG1 Expression Level as Molecular Biomarkers of Systemic Lupus Erythematosus and Lupus Nephritis

1. Introduction Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with a wide variety of manifestations ranging from mild cutaneous to organ failure as lupus nephritis (LN) and cardiopulmonary complications [1]. SLE is mainly present among young women, with a greater incidence in certain ethnic groups, such as Asian,…

Continue Reading ncRNA | Free Full-Text | Long Non-Coding RNA TUG1 Gene Polymorphism and TUG1 Expression Level as Molecular Biomarkers of Systemic Lupus Erythematosus and Lupus Nephritis

Relay Therapeutics to Present Clinical Data on RLY-4008 in Advanced FGFR2-Altered Solid Tumors at 2023 AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics

Relay Therapeutics, Inc. CAMBRIDGE, Mass., Sept. 18, 2023 (GLOBE NEWSWIRE) — Relay Therapeutics, Inc. (Nasdaq: RLAY), a clinical-stage precision medicine company transforming the drug discovery process by combining leading-edge computational and experimental technologies, today announced that data for RLY-4008 (lirafugratinib) in patients with advanced FGFR2-altered solid tumors outside of cholangiocarcinoma…

Continue Reading Relay Therapeutics to Present Clinical Data on RLY-4008 in Advanced FGFR2-Altered Solid Tumors at 2023 AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics

Single-cell brain organoid screening identifies developmental defects in autism

Stem cell and cerebral organoid culture conditions Feeder-free hES cells or iPS cells were cultured on hES cell-qualified Matrigel (Corning, catalogue no. 354277)-coated plates with Essential8 stem cell medium supplemented with bovine serum albumin (BSA). H9 embryonic stem cells were obtained from WiCell. Cells were maintained in a 5% CO2 incubator at 37 °C….

Continue Reading Single-cell brain organoid screening identifies developmental defects in autism

Eimeria zuernii (Eimeriidae: Coccidia): mitochondrial genome and genetic diversity in the Chinese yak | Parasites & Vectors

Eimeria zuernii mitogenome feature The E. zuernii linear mitogenome was 6176 bp in size and encoded three PCGs, cytb, cox1, and cox3, as well as seven interspersed small subunit (SSU) and twelve interspersed large subunit (LSU) rDNA fragments (Fig. 2). No transfer RNAs (tRNAs) were found in the E. zuernii mitogenome, similar…

Continue Reading Eimeria zuernii (Eimeriidae: Coccidia): mitochondrial genome and genetic diversity in the Chinese yak | Parasites & Vectors

Cholangiocarcinoma Pipeline Drugs Analysis Report, 2023: FDA Approvals, Clinical Trials, Therapies, Mechanism of Action, Route of Administration by DelveInsight

PRESS RELEASE Published August 31, 2023 (Las Vegas, Nevada, United States) As per DelveInsight’s assessment, globally, Cholangiocarcinoma pipeline constitutes 55+ key companies continuously working towards developing 60+ Cholangiocarcinoma treatment therapies, analysis of Clinical Trials, Therapies, Mechanism of Action, Route of Administration, and Developments analyzes DelveInsight. The Cholangiocarcinoma Pipeline report embraces…

Continue Reading Cholangiocarcinoma Pipeline Drugs Analysis Report, 2023: FDA Approvals, Clinical Trials, Therapies, Mechanism of Action, Route of Administration by DelveInsight

Tutustu 93+ imagen r studio correlation

Jaa kuvia r studio correlation. Correlation Test Between Two Variables in R – Easy Guides – Wiki – STHDA Correlation Analyses in R – Easy Guides – Wiki – STHDA Pearson correlation in R | R-bloggers Correlation coefficient and correlation test in R | R-bloggers Correlation Analyses in R –…

Continue Reading Tutustu 93+ imagen r studio correlation

Struktur Komunitas dan Aktivitas Bakteri Nitrifikasi, Denitrifikasi, dan Nitrat Amonifikasi di Tambak Udang Sistem Intensif

Udang merupakan salah satu komoditas unggulan perikanan budidaya di Indonesia. Tambak udang sebagai suatu ekosistem memiliki senyawa nitrogen anorganik utama yang dapat terlarut dalam air, yaitu amonia (NH3), nitrat (NO3-), dan nitrit (NO2-). Permasalahan yang sering terjadi dalam pengelolaan tambak udang yaitu penurunan kualitas air dan sedimen yang disebabkan oleh…

Continue Reading Struktur Komunitas dan Aktivitas Bakteri Nitrifikasi, Denitrifikasi, dan Nitrat Amonifikasi di Tambak Udang Sistem Intensif

Spatial transcriptomics: recent developments and insights in respiratory research | Military Medical Research

Zepp JA, Morrisey EE. Cellular crosstalk in the development and regeneration of the respiratory system. Nat Rev Mol Cell Biol. 2019;20(9):551–66. Article  CAS  PubMed  PubMed Central  Google Scholar  Kiley JP. Advancing respiratory research. Chest. 2011;140(2):497–501. Article  PubMed  PubMed Central  Google Scholar  Goldstraw P, Ball D, Jett JR, Le Chevalier T,…

Continue Reading Spatial transcriptomics: recent developments and insights in respiratory research | Military Medical Research

What is the next step in preventative therapi

image: In a chronic inflammatory context, epigenetic changes occur in LPCs: (1) through a sustained stimulation by cytokines that either promotes dedifferentiation and transformation of LPCs to CSCs (IL-17, TNF-α and IL-6), or in contrast avoiding their transformation (IFN-γ, IL-27); (2) by hosting small non-coding RNAs transferred by exosomes coming from…

Continue Reading What is the next step in preventative therapi

MenT nucleotidyltransferase toxins extend tRNA acceptor stems and can be inhibited by asymmetrical antitoxin binding

MenAT1 sequence analysis Analysis of gene neighbourhoods for rv0078B (menA1) was performed using default settings in FlaGs (www.webflags.se/). Output sequences for MenA1 and cognate MenT1 homologues were then used to perform sequence alignments using MUSCLE (www.ebi.ac.uk/Tools/msa/muscle/), then formatted in Jalview (www.jalview.org/), sorting by pairwise alignment. Residues of interest were then…

Continue Reading MenT nucleotidyltransferase toxins extend tRNA acceptor stems and can be inhibited by asymmetrical antitoxin binding

Transcriptomic risk scores for attention deficit/hyperactivity disorder

Song P, Zha M, Yang Q, Zhang Y, Li X, Rudan I. The prevalence of adult attention-deficit hyperactivity disorder: A global systematic review and meta-analysis. J Glob Health. 2021;11:1–9. Article  Google Scholar  Faraone SV, Asherson P, Banaschewski T, Biederman J, Buitelaar JK, Ramos-Quiroga JA, et al. Attention-deficit/hyperactivity disorder. Nat Rev…

Continue Reading Transcriptomic risk scores for attention deficit/hyperactivity disorder

ctDNA and Lung Cancer | SpringerLink

Abbosh C, Birkbak NJ, Wilson GA, et al (2017) Phylogenetic ctDNA analysis depicts early-stage lung cancer evolution. Nature 545:446–451. doi.org/10.1038/nature22364 CrossRef  CAS  PubMed  PubMed Central  Google Scholar  Adalsteinsson VA, Ha G, Freeman SS, et al (2017) Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors. Nat Commun…

Continue Reading ctDNA and Lung Cancer | SpringerLink

A culture-free method for rapidly and accurately quantifying active SARS-CoV-2

Boger B, Fachi MM, Vilhena RO, Cobre AF, Tonin FS, Pontarolo R. Systematic review with meta-analysis of the accuracy of diagnostic tests for COVID-19. Am J Infect Control. 2021;49(1):21–9. doi.org/10.1016/j.ajic.2020.07.011. Article  CAS  PubMed  Google Scholar  Sule WF, Oluwayelu DO. Real-time RT-PCR for COVID-19 diagnosis: challenges and prospects. Pan Afr Med…

Continue Reading A culture-free method for rapidly and accurately quantifying active SARS-CoV-2

EC grants conditional marketing authorization for Taiho’s Lytgobi

The European Commission has granted conditional marketing authorization for Lytgobi (futibatinib) monotherapy for the treatment of adult patients with locally advanced or metastatic cholangiocarcinoma (CCA) with a fibroblast growth factor receptor (FGFR2) fusion or rearrangement that have progressed after at least one prior line of systemic therapy. The treatment for…

Continue Reading EC grants conditional marketing authorization for Taiho’s Lytgobi

Patterns and determinants of the global herbivorous mycobiome

Sampling overview A total of 661 samples belonging to 34 species and 9 families of foregut-fermenting ruminant (thereafter ruminant, n = 468), foregut-fermenting pseudoruminant (thereafter pseudoruminant, n = 17), and hindgut fermenters (n = 176) were examined (Fig. 1a, b, Supplementary Data 1). The dataset also provides a high level of replication for a variety of animals (229…

Continue Reading Patterns and determinants of the global herbivorous mycobiome

Solved Need help with All Please!! Which of the following is

Need help with All Please!! Which of the following is a function of rRNA in a ribosome? Group of answer choices To ensure that only the correct mRNAs enter the ribosome To recruit the appropriate tRNA molecules into the ribosome Peptidyl transferase activity To regulate the speed of translation by…

Continue Reading Solved Need help with All Please!! Which of the following is

Nitrate and a nitrate-reducing Rothia aeria strain as potential prebiotic or synbiotic treatments for periodontitis

Bacterial strains and growth conditions Rothia aeria CECT9999 (Ra9, isolate D1P7 described in24), was used as a nitrate-reducing probiotic candidate. Prior to the experiment, Brain Heart Infusion (BHI) (Biolife, Deerfield, Illinois, USA) agar plates were inoculated with the strain, incubated for 48 h at 37 °C, and stored at 4 °C for up…

Continue Reading Nitrate and a nitrate-reducing Rothia aeria strain as potential prebiotic or synbiotic treatments for periodontitis

Analysis of tRNA-derived small RNAs

Introduction Sarcoidosis is a multisystem inflammatory disease of unknown aetiology that is characterised by non-caseating epithelioid granulomatous lesions (aggregates of lymphocytes, macrophages, epithelioid cells, and giant cells).1 Typical clinical features include bilateral hilar lymph node lesions, pulmonary infiltration, and eye and skin lesions. Some patients may also have neurological and…

Continue Reading Analysis of tRNA-derived small RNAs

Pathalys Pharma and Launch Therapeutics Announce First Patient Enrolled Ahead of Schedule in Pivotal Phase 3 Program for Upacicalcet in Patients Receiving Hemodialysis

Pathalys and LaunchTx leverage recently announced collaboration to accelerate enrollment for the upacicalcet development program. RESEARCH TRIANGLE PARK, N.C. and BOSTON, May 31, 2023 /PRNewswire/ — Pathalys Pharma, Inc., a private, late-stage biopharma company co-founded by Catalys Pacific and DaVita Venture Group, and Launch Therapeutics (Launch Tx), a clinical development company, today announced…

Continue Reading Pathalys Pharma and Launch Therapeutics Announce First Patient Enrolled Ahead of Schedule in Pivotal Phase 3 Program for Upacicalcet in Patients Receiving Hemodialysis

corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database

corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database 0 hello everyone.. I have a problem seems to be very easy but I cant find a solution so I need your help. I have downloaded PSI values for CHOL (cholangiocarcinoma) AS events from…

Continue Reading corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database

Relay Therapeutics Announces Full Dose Escalation Data for

CAMBRIDGE, Mass., May 25, 2023 (GLOBE NEWSWIRE) — Relay Therapeutics, Inc. (Nasdaq: RLAY), a clinical-stage precision medicine company transforming the drug discovery process by combining leading-edge computational and experimental technologies, today announced complete first-in-human dose escalation data for RLY-4008, an investigational, potent, selective and oral small molecule inhibitor of fibroblast…

Continue Reading Relay Therapeutics Announces Full Dose Escalation Data for

Relay Therapeutics Announces Promising Results for Investigational Drug Targeting FGFR2

On May 25, 2023, Relay Therapeutics made a significant announcement regarding their latest investigational drug, RLY-4008. This oral small molecule inhibitor specifically targets fibroblast growth factor receptor 2 (FGFR2) and has shown promising results during its first-in-human dose escalation trials. The data was collected from the Phase 1/2 ReFocus study,…

Continue Reading Relay Therapeutics Announces Promising Results for Investigational Drug Targeting FGFR2

Ongoing Investigation of RLY-4008 Highlights Evolving Treatment Options for FGFR2+ Cholangiocarcinoma

R. Kate (Katie) Kelley, MD The selective FGFR2 inhibitor RLY-4008 has generated higher response rates compared with historical data for prior pan-FGFR inhibitors in patients with cholangiocarcinoma harboring FGFR2 fusions or alterations who have not been exposed to a prior FGFR inhibitor, according to R. Kate (Katie) Kelley, MD. Data…

Continue Reading Ongoing Investigation of RLY-4008 Highlights Evolving Treatment Options for FGFR2+ Cholangiocarcinoma

Deletion of endothelial leptin receptors in mice promotes diet-induced obesity

Experimental animals The generation of mice with tamoxifen-inducible, Tie2.Cre-ERT2-mediated deletion of LepR in endothelial cells was described previously12,17. For Cre recombinase activation, mice (6 weeks-of-age) were fed tamoxifen citrate-containing rodent chow (Envigo; TD.130860) for 6 weeks49. Genomic DNA from the brain, lung, small intestine, subcutaneous adipose tissue (SCAT) and visceral adipose tissue…

Continue Reading Deletion of endothelial leptin receptors in mice promotes diet-induced obesity

vep – How to normalise indel of different transcript direction?

I am trying to reproduce an analysis result, and there is a requirement regarding the format of the result: the ‘3’ rule ‘: all mutations should be expressed in a position close to the end of the gene transcription direction (3’ end). The result I obtained is(annotate from VEP) Chromosome…

Continue Reading vep – How to normalise indel of different transcript direction?

A guide through the genome of crops

BZR1 regulatory network in maize and Arabidopsis. a Distribution of ZmBZR1 binding around transcribed genes. Frequency of ZmBZR1 binding peaks up to 10 kb up- or downstream of TSS or TTS and intra-genic, respectively. b ChIP-seq identified ZmBZR1 binding in proximity of putative targets repressed (BR6ox2/BRD1), induced (IAA19) or not controlled…

Continue Reading A guide through the genome of crops

Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant

Ethics statement All experiments with hamsters were performed in accordance with the Science Council of Japan’s Guidelines for the Proper Conduct of Animal Experiments. The protocols were approved by the Institutional Animal Care and Use Committee of National University Corporation Hokkaido University (approval ID: 20-0123 and 20-0060). All protocols involving…

Continue Reading Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant

Functional genomics in stroke: current and future applications of iPSCs and gene editing to dissect the function of risk variants | BMC Cardiovascular Disorders

Feigin VL, Stark BA, Johnson CO, Roth GA, Bisignano C, Abady GG, et al. Global, regional, and national burden of stroke and its risk factors, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Neurol. 2021;20:1–26. Article  Google Scholar  Wolters FJ, Arfan IM. Epidemiology of Vascular…

Continue Reading Functional genomics in stroke: current and future applications of iPSCs and gene editing to dissect the function of risk variants | BMC Cardiovascular Disorders

CHMP ISSUES POSITIVE OPINION FOR FUTIBATINIB FOR THE TREATMENT OF ADULTS WITH CHOLANGIOCARCINOMA

ZUG, Switzerland, April 27, 2023 /PRNewswire/ — Taiho Oncology Europe GmbH and Taiho Pharmaceutical Co., Ltd. announced today that the European Medicines Agency’s (EMA) Committee for Medicinal Products for Human Use (CHMP) has issued a positive opinion recommending the conditional marketing authorization (CMA) of futibatinib for the treatment of adult…

Continue Reading CHMP ISSUES POSITIVE OPINION FOR FUTIBATINIB FOR THE TREATMENT OF ADULTS WITH CHOLANGIOCARCINOMA

LCK Inhibition Reduces CCA Growth Via YAP Downregulation

The following is a summary of the “LCK inhibition downregulates YAP activity and is therapeutic in patient-derived models of cholangiocarcinoma,” published in the January 2023 issue of Hepatology by Conboy et al. Novel and effective medicinal therapy for cholangiocarcinoma (CCA) is needed. Yes-associated protein (YAP), a member of the Hippo…

Continue Reading LCK Inhibition Reduces CCA Growth Via YAP Downregulation

PAI-1 4G/5G polymorphism in patients with DM & hypertension

Introduction Diabetes mellitus (DM) is a group of metabolic syndromes characterized by disorders of glucose metabolism, including type 1 DM, type 2 DM, gestational DM, and specific types of DM due to other causes. DM is closely associated with abnormal cardiac electrophysiological signal conduction and arrhythmias, whereby it triggers sudden…

Continue Reading PAI-1 4G/5G polymorphism in patients with DM & hypertension

Innovent reports OS data from Phase ll trial of Pemazyre

The Phase ll trial of Pemazyre includes Chinese patients with advanced cholangiocarcinoma. Credit: Nephron/commons.wikimedia.org. Innovent Biologics has presented overall survival (OS) data from a Phase ll trial of Pemazyre (pemigatinib) in Chinese patients diagnosed with advanced cholangiocarcinoma (CCA). The open-label, multi-centre, single-arm Phase ll trial has been designed to assess…

Continue Reading Innovent reports OS data from Phase ll trial of Pemazyre

Relay Therapeutics’ Stock Price Premium Vs Peers Is Justified By Its Platform Technology, Analyst Says

Raymond James initiated coverage of Relay Therapeutics Inc (NASDAQ: RLAY) with an Outperform rating and a price target of $29 based upon the stock trading at 8x our EV/5-year forward sales estimate. The price is a premium to small-cap peers trading at 1-2x and mid-cap peers at ~3x, justified by Relay’s platform technology for identifying…

Continue Reading Relay Therapeutics’ Stock Price Premium Vs Peers Is Justified By Its Platform Technology, Analyst Says

FGFR2 testing in cholangiocarcinoma: translating molecular studies into clinical practice

Review doi: 10.32074/1591-951X-859. Online ahead of print. Affiliations Expand Affiliations 1 Department of Medicine (DIMED), Surgical Pathology Unit, University of Padua, Padua (PD), Italy. 2 Medical Oncology, Azienda Ospedaliero-Universitaria Pisana, Pisa (PI), Italy. 3 Department of Public Health, University of Naples Federico II, Naples (NA), Italy. 4 Department of Medicine…

Continue Reading FGFR2 testing in cholangiocarcinoma: translating molecular studies into clinical practice

End result of trna | DLBCL treatment involves standard immuno-chemotherapy

Sequence tRNA Bounds tRNA One end of the L shape has the anticodon, while the other has the attachment site for the amino acid. Different tRNAs have slightly different structures, and this is important for making sure they get loaded up with the right amino acid. Loading a tRNA with…

Continue Reading End result of trna | DLBCL treatment involves standard immuno-chemotherapy

InnoCare Releases 2022 Annual Results and Business Highlights

BEIJING–(BUSINESS WIRE)– InnoCare Pharma (HKEX: 09969; SSE: 688428), a leading biopharmaceutical company focusing on cancer and autoimmune diseases, today announced 2022 annual results as of 31 December 2022. Dr. Jasmine Cui, Co-founder, Chairwoman and CEO of InnoCare, said, “The company achieved high-quality development in various fields in 2022: rapid growth…

Continue Reading InnoCare Releases 2022 Annual Results and Business Highlights

Python formatting when visualizing Primer3-py dimers

I am currently creating a program to analyze primers prior to multiplexing. I am interested in visualizing homo/heterodimers and hairpin structures. To do this I am using Primer3-py bindings. I am able to get a nice visual representation of dimers like so: z = primer3.bindings.calcHeterodimer(‘TGACACCGCCAAGGTGAATTT’, ‘CCGCTCCGTGGTTGGTCCGGTGGCGAGCGG’, output_structure = True).ascii_structure_lines print([i.split(‘\t’)[1]…

Continue Reading Python formatting when visualizing Primer3-py dimers

Urothelial Carcinoma Pipeline Assets and Comparative Analysis of Clinical and Non-Clinical Stage Products

PRESS RELEASE Published March 13, 2023 DelveInsight’s, “Urothelial Carcinoma Pipeline Insight, 2023,” report provides comprehensive insights about 40+ companies and 50+ pipeline drugs in the Urothelial Carcinoma pipeline landscape. It covers the Urothelial Carcinoma pipeline drug profiles, including Urothelial Carcinoma clinical trials and nonclinical stage products. It also covers the…

Continue Reading Urothelial Carcinoma Pipeline Assets and Comparative Analysis of Clinical and Non-Clinical Stage Products

ncRNA | Free Full-Text | Long Noncoding RNA H19: A Novel Oncogene in Liver Cancer

Received: 9 February 2023 / Revised: 4 March 2023 / Accepted: 6 March 2023 / Published: 9 March 2023 Round 1 Reviewer 1 Report In this paper, they reviewed the role of a long non-coding RNA, H19, in liver cancer. H19 is a lncRNA, which has been extensively studied. Multiple…

Continue Reading ncRNA | Free Full-Text | Long Noncoding RNA H19: A Novel Oncogene in Liver Cancer

course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN

News:course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN 0 Dear all, registration is now open for the 2nd edition of the course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN. Dates: online, 24-28 April This course will offer participants a practical introduction to some of the most useful functions available within…

Continue Reading course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN

Relay Therapeutics Reports Fourth Quarter and Full Year

Advanced RLY-4008: Reported interim data with 88% overall response rate at pivotal dose and 63% across all doses in pan-FGFR treatment-naïve, FGFR2-fusion cholangiocarcinoma patients & announced anticipated registrational path Progressed & expanded breast cancer portfolio: Continued monotherapy and initiated combination arms in study of PI3Kα inhibitor RLY-2608 & disclosed 3…

Continue Reading Relay Therapeutics Reports Fourth Quarter and Full Year

Relay Therapeutics: It Could Be Time To ‘Be Greedy When Others Are Fearful’ (NASDAQ:RLAY)

domoyega/E+ via Getty Images Investment Overview – Cash Intensive But Cash Rich – At Current Price Relay Offers The Patient Investor Value I have covered Relay Therapeutics (NASDAQ:RLAY) several times for Seeking Alpha since the company completed what was, at the time, the third largest biotech IPO in history, raising…

Continue Reading Relay Therapeutics: It Could Be Time To ‘Be Greedy When Others Are Fearful’ (NASDAQ:RLAY)

integration using rPCA with reference or without it?

integration using rPCA with reference or without it? 0 Hello all, I have decided to integrate my single cell dataset using rPCA rather than CCA because I thought using CCA overcorrect my dataset. I know there is two approaches using rPCA: to use references in “FindIntegrationAnchors” function and the reason…

Continue Reading integration using rPCA with reference or without it?

Python 01 in Bioinformatics | Processing Gene Sequences from Scratch

1. Download of sequence data When we start to understand the processing flow of the sequence, we first need to know the sequence download URL. One of the well-known websites is NCBI (National Center for Biotechnology Information) US National Center for Biotechnology Information. 1. Enter NCBI through the following website,…

Continue Reading Python 01 in Bioinformatics | Processing Gene Sequences from Scratch

A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva

. 2023 Jan 25;1239:340736. doi: 10.1016/j.aca.2022.340736. Epub 2022 Dec 23. Affiliations Expand Affiliations 1 Department of Health Inspection and Quarantine, School of Public Health, Fujian Medical University, Fuzhou, Fujian, 350122, PR China. 2 College of Chemistry, Key Laboratory of Analysis and Detecting Technology, Food Safety MOE, Fuzhou University, Fuzhou, 350002,…

Continue Reading A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva

Kinnate’s CCA therapy KIN-3248 receives FDA Fast Track status

Micrograph of cholangiocarcinoma. Credit: Nephron / Wikimedia. Kinnate Biopharma has received Fast Track designation from the US Food and Drug Administration (FDA) for its pan-FGFR inhibitor, KIN-3248, to treat unresectable, locally advanced or metastatic cholangiocarcinoma (CCA). KIN-3248 is indicated to treat CCA harbouring fibroblast growth factor receptor 2 (FGFR2) gene…

Continue Reading Kinnate’s CCA therapy KIN-3248 receives FDA Fast Track status

Potential Roles of mtDNA Mutations in PCOS-IR

Introduction Polycystic ovary syndrome (PCOS) is the most common endocrine disease occurring during reproductive years. It was a kind of endocrine and metabolic disorders that results in obesity, irregularity of menstruation, OS, hyperinsulinemia, hyperandrogenism, infertility, and sterility.1,2 First identified in 1935, PCOS was also recognized as Stein–Leventhal syndrome.3 Diagnosis of…

Continue Reading Potential Roles of mtDNA Mutations in PCOS-IR

Multivariate data analysis with R and vegan

News:course – Multivariate data analysis with R and vegan 0 Hi all, registration is now open for the 2nd edition of the course “Multivariate data analysis with R and vegan“. Dates: online, April, 24-28 This course will offer participants a practical introduction to some of the most useful functions available…

Continue Reading Multivariate data analysis with R and vegan

nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs | BMC Bioinformatics

Sanger HL, Klotz G, Riesner D, Gross HJ, Kleinschmidt AK. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci. 1976;73(11):3852–6. doi.org/10.1073/pnas.73.11.3852. Article  CAS  Google Scholar  Arnberg AC, Van Ommen G-JB, Grivell LA, Van Bruggen EFJ, Borst P. Some yeast mitochondrial RNAs…

Continue Reading nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs | BMC Bioinformatics

Evaluation of automated techniques for extraction of circulating cell-free DNA for implementation in standardized high-throughput workflows

Huebner, H. et al. Filtration based assessment of CTCs and Cell Search® based assessment are both powerful predictors of prognosis for metastatic breast cancer patients. BMC Cancer 18, 204. doi.org/10.1186/s12885-018-4115-1 (2018). Article  Google Scholar  Banys-Paluchowski, M., Krawczyk, N. & Fehm, T. Liquid biopsy in breast cancer. Geburtshilfe Frauenheilkd 80, 1093–1104….

Continue Reading Evaluation of automated techniques for extraction of circulating cell-free DNA for implementation in standardized high-throughput workflows

Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine

Animals and immunizations The study protocol and all veterinarian procedures were approved by the Bioqual IACUC per a memorandum of understanding with the Duke IACUC, and were performed based on standard operating procedures. Macaques studied were housed and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited…

Continue Reading Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine

Inferring and perturbing cell fate regulomes in human brain organoids

Experimental methods Stem cell and organoid culture We used six human iPS cell lines (Hoik1, Wibj2, Kucg2 from the HipSci resource47; 409B2 from the RIKEN BRC cell bank; 01F49i-N-B7 (B7) from Institute of Molecular and Clinical Ophthalmology Basel; and WTC from the Allen Institute) and three human ES cell lines (H1-PAX6YFP…

Continue Reading Inferring and perturbing cell fate regulomes in human brain organoids

A Phase 3, Open-Label, Randomized Study of Futibatinib Versus Gemcitabine-Cisplatin Chemotherapy as First-Line Treatment of Patients with Advanced Cholangiocarcinoma Harboring FGFR2 Gene Rearrangements

Official Trial Title A phase 3, open-label, randomized study of futibatinib versus germcitabine-cisplatin chemotherapy as first-line treatment of patients with advanced cholagiocarcinoma harboring FGFR2 gene rearrangements (FOENIX-CCA3) Study Description The University of Virginia is participating in a global clinical research study for adults ages 18 years of age, and over…

Continue Reading A Phase 3, Open-Label, Randomized Study of Futibatinib Versus Gemcitabine-Cisplatin Chemotherapy as First-Line Treatment of Patients with Advanced Cholangiocarcinoma Harboring FGFR2 Gene Rearrangements

Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3

In vitro reconstitution of Escherichia coli CRISPR-Cas3 interference E. coli CRISPR-Cas3 is generally well-characterized type I CRISPR complexes in vitro and in vivo32,33,37,38. However, recombinant EcoCas3 protein is difficult to purify because of poor solubility and propensity to aggregate at 37 °C25,26,30,39. Co-expression of HtpG chaperon40 and/or low temperature growth at…

Continue Reading Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3

Live-seq enables temporal transcriptomic recording of single cells

Biological materials RAW264.7, 293T and HeLa cells were obtained from ATCC. RAW264.7 cells with Tnf-mCherry reporter and relA-GFP fusion protein (RAW-G9 clone) were kindly provided by I.D.C. Fraser (National Institutes of Health). The IBA cell line derived from the stromal vascular fraction of interscapular brown adipose tissue of young male…

Continue Reading Live-seq enables temporal transcriptomic recording of single cells

between results of RNAseq and absence/presence of Type3 Secretion System

Correlation between two different datasets: between results of RNAseq and absence/presence of Type3 Secretion System 1 Dear All, I have a “How would you solve” kind of question. I have two sets of tables : 1. Log2FoldChange table and 2. Effectors Table. Firstly, the Log2FoldChange table was obtained by performing…

Continue Reading between results of RNAseq and absence/presence of Type3 Secretion System

(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData

(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData 0 I have a question regarding re-clustering after removing cells using SubsetData (R – Seurat package). I am in the process of analyzing a relatively large single-cell dataset (16 separate samples of ~5-10k cells each). In our first…

Continue Reading (Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData

C698R mutation in Lrsam1 gene impairs nerve regeneration in a CMT2P mouse model

Animal generation The Lrsam1C698R knock-in mice were generated on a C57Bl/6J background using the CRISPR/Cas9 technique. Briefly, single-cell zygotes from C57BL/6J mice were microinjected with mRNA encoding Cas9 and a guide sequence (5′-ACAGCAGCAGACGTGGCCAC-3′ at 20 ng/µl) to target the exon 26 of Lrsam1. A single stranded DNA oligo carrying the C698R mutation…

Continue Reading C698R mutation in Lrsam1 gene impairs nerve regeneration in a CMT2P mouse model

Single-cell analyses define a continuum of cell state and composition changes in the malignant transformation of polyps to colorectal cancer

Mapping molecular changes across malignant transformation We generated single-cell data for 81 samples collected from eight FAP and seven non-FAP donors (Fig. 1a and Supplementary Tables 1 and 2). For each tissue, we performed matched scATAC-seq and snRNA-seq (10x Genomics). We obtained high-quality single-cell chromatin accessibility profiles for 447,829 cells…

Continue Reading Single-cell analyses define a continuum of cell state and composition changes in the malignant transformation of polyps to colorectal cancer

Helsinn Expands US R&D Capabilities on Heels of BridgeBio Licensing Deal

Helsinn Group is expanding its global research and development capacity with the launch of a new dedicated hub in the U.S. The new R&D facility is a product of Helsinn’s new licensing deal with BridgeBio and will operate under Helsinn Therapeutics (U.S.). It will be instrumental in furthering the company’s projected increase in clinical activities to…

Continue Reading Helsinn Expands US R&D Capabilities on Heels of BridgeBio Licensing Deal

tReasure: R-based GUI package analyzing tRNA expression profiles from small RNA sequencing data | BMC Bioinformatics

tReasure (tRNA Expression Analysis Software Utilizing R for Easy use) is a graphical user interface (GUI) tool for the analysis of tRNA expression profiles from deep-sequencing data of small RNAs (small RNA-seq) using R packages. The whole analysis workflow, including the uploading of FASTQ files of small RNA-seq, quantification of…

Continue Reading tReasure: R-based GUI package analyzing tRNA expression profiles from small RNA sequencing data | BMC Bioinformatics

Solved 28) What structure below provides an “anticodon”?

Transcribed image text: 28) What structure below provides an “anticodon”? (2pts) OmicroRNA mRNA tRNA rRNA 29) Which of the following modifications is involved in the 3′ (three prime) end-processing of pre- (4pts) mRNA precursors in eukaryotic cells? Addition of a methlyguanosine cap Splicing out introns Addition of Poly-A tail Forming…

Continue Reading Solved 28) What structure below provides an “anticodon”?

Metagenomics technology and microbial community diversity analysis methods

A large number of microorganisms in nature cannot be cultivated under laboratory conditions by pure culture methods, and the technical methods of traditional microbiology limit the research on environmental microorganisms. The rapid development of high-throughput omics technology has enabled humans to have an unprecedented understanding of the complex microbial communities…

Continue Reading Metagenomics technology and microbial community diversity analysis methods

Helsinn Group and BridgeBio Pharma Announce Update to Strategic Collaboration to Develop, Manufacture and Commercialize Infigratinib in Oncology Indications in the U.S.

Lugano, Switzerland and Palo Alto, CA – Helsinn Group (Helsinn), a fully integrated, global biopharma company with a diversified pipeline of innovative oncology assets and strong track-record of commercial execution, and BridgeBio Pharma, Inc. (Nasdaq: BBIO) (BridgeBio), a commercial-stage biopharmaceutical company that focuses on genetic diseases and cancers, announced an…

Continue Reading Helsinn Group and BridgeBio Pharma Announce Update to Strategic Collaboration to Develop, Manufacture and Commercialize Infigratinib in Oncology Indications in the U.S.

Identification of Hub Genes Associated with COPD Through Integrated Bi

Introduction Chronic obstructive pulmonary disease (COPD) will become the third leading cause of death worldwide.1,2 The incidence of COPD worldwide is 13.1%3 and is 13.7% in the Chinese population over 40 years of age.4 Emphysema is one of the most common phenotypes.1 Over the past few decades, we have conducted…

Continue Reading Identification of Hub Genes Associated with COPD Through Integrated Bi

scrnaseq – Integrating scRNA-seq data using raw data

I believe when you say alignment, you mean aligning reads to a genome (sometimes to transcriptome) and count these to get count matrices. In the aforementioned paper, however, what is meant is “bringing different data sets to a level where they can be compared/integrated/…”. Basically scRNA-seq data are heavily prone…

Continue Reading scrnaseq – Integrating scRNA-seq data using raw data

The Evolving Treatment Landscape of Cholangiocarcinoma

Recent genomic profiling studies revealed that approximately 40% of patients with biliary tract cancers harbor actionable genomic mutations. The advances in the understanding and characterization of biliary tract cancers (BTCs), particularly intrahepatic cholangiocarcinoma (iCCA), and genomic profiling over the past decade have led to a rapid expansion of available treatment…

Continue Reading The Evolving Treatment Landscape of Cholangiocarcinoma

Summer Research Assistant/Associate, Center for Computational Biology

Tremendous opportunities for discovery have emerged in the biological sciences, requiring the combined power of theory, data analysis, and simulation. Researchers are being confronted by an explosion of information from genome sequencing, gene expression profiling, proteomics, electron microscopy and tomography, and multiple high-resolution imaging modalities both dynamic and static. The…

Continue Reading Summer Research Assistant/Associate, Center for Computational Biology

Mutational Analysis of Mitochondrial tRNA Genes

Introduction Diabetes is a very complex disease characterized by the presence of chronic hyperglycemia. Clinically, insulin-dependent type 1 and non-insulin-dependent type 2 are the main types of diabetes. Among them, type 2 diabetes mellitus (T2DM, [MIM125853]) is a common endocrine disorder affecting approximately 10% of adult population.1 In most cases,…

Continue Reading Mutational Analysis of Mitochondrial tRNA Genes

Gene mutation analysis in papillary thyroid carcinoma

Introduction Thyroid tumors are the most common malignant tumors of the endocrine system, and their incidence has been increasing in the recent decades. Currently, there are some target drugs that can effectively treat PTC, and next-generation sequencing (NGS) can be used for targeted therapy. In order to make better informed…

Continue Reading Gene mutation analysis in papillary thyroid carcinoma