Tag: CCA
Analysis of tRNA-derived small RNAs
Introduction Sarcoidosis is a multisystem inflammatory disease of unknown aetiology that is characterised by non-caseating epithelioid granulomatous lesions (aggregates of lymphocytes, macrophages, epithelioid cells, and giant cells).1 Typical clinical features include bilateral hilar lymph node lesions, pulmonary infiltration, and eye and skin lesions. Some patients may also have neurological and…
Pathalys Pharma and Launch Therapeutics Announce First Patient Enrolled Ahead of Schedule in Pivotal Phase 3 Program for Upacicalcet in Patients Receiving Hemodialysis
Pathalys and LaunchTx leverage recently announced collaboration to accelerate enrollment for the upacicalcet development program. RESEARCH TRIANGLE PARK, N.C. and BOSTON, May 31, 2023 /PRNewswire/ — Pathalys Pharma, Inc., a private, late-stage biopharma company co-founded by Catalys Pacific and DaVita Venture Group, and Launch Therapeutics (Launch Tx), a clinical development company, today announced…
corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database
corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database 0 hello everyone.. I have a problem seems to be very easy but I cant find a solution so I need your help. I have downloaded PSI values for CHOL (cholangiocarcinoma) AS events from…
Relay Therapeutics Announces Full Dose Escalation Data for
CAMBRIDGE, Mass., May 25, 2023 (GLOBE NEWSWIRE) — Relay Therapeutics, Inc. (Nasdaq: RLAY), a clinical-stage precision medicine company transforming the drug discovery process by combining leading-edge computational and experimental technologies, today announced complete first-in-human dose escalation data for RLY-4008, an investigational, potent, selective and oral small molecule inhibitor of fibroblast…
Relay Therapeutics Announces Promising Results for Investigational Drug Targeting FGFR2
On May 25, 2023, Relay Therapeutics made a significant announcement regarding their latest investigational drug, RLY-4008. This oral small molecule inhibitor specifically targets fibroblast growth factor receptor 2 (FGFR2) and has shown promising results during its first-in-human dose escalation trials. The data was collected from the Phase 1/2 ReFocus study,…
Ongoing Investigation of RLY-4008 Highlights Evolving Treatment Options for FGFR2+ Cholangiocarcinoma
R. Kate (Katie) Kelley, MD The selective FGFR2 inhibitor RLY-4008 has generated higher response rates compared with historical data for prior pan-FGFR inhibitors in patients with cholangiocarcinoma harboring FGFR2 fusions or alterations who have not been exposed to a prior FGFR inhibitor, according to R. Kate (Katie) Kelley, MD. Data…
Deletion of endothelial leptin receptors in mice promotes diet-induced obesity
Experimental animals The generation of mice with tamoxifen-inducible, Tie2.Cre-ERT2-mediated deletion of LepR in endothelial cells was described previously12,17. For Cre recombinase activation, mice (6 weeks-of-age) were fed tamoxifen citrate-containing rodent chow (Envigo; TD.130860) for 6 weeks49. Genomic DNA from the brain, lung, small intestine, subcutaneous adipose tissue (SCAT) and visceral adipose tissue…
vep – How to normalise indel of different transcript direction?
I am trying to reproduce an analysis result, and there is a requirement regarding the format of the result: the ‘3’ rule ‘: all mutations should be expressed in a position close to the end of the gene transcription direction (3’ end). The result I obtained is(annotate from VEP) Chromosome…
A guide through the genome of crops
BZR1 regulatory network in maize and Arabidopsis. a Distribution of ZmBZR1 binding around transcribed genes. Frequency of ZmBZR1 binding peaks up to 10 kb up- or downstream of TSS or TTS and intra-genic, respectively. b ChIP-seq identified ZmBZR1 binding in proximity of putative targets repressed (BR6ox2/BRD1), induced (IAA19) or not controlled…
Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant
Ethics statement All experiments with hamsters were performed in accordance with the Science Council of Japan’s Guidelines for the Proper Conduct of Animal Experiments. The protocols were approved by the Institutional Animal Care and Use Committee of National University Corporation Hokkaido University (approval ID: 20-0123 and 20-0060). All protocols involving…
Functional genomics in stroke: current and future applications of iPSCs and gene editing to dissect the function of risk variants | BMC Cardiovascular Disorders
Feigin VL, Stark BA, Johnson CO, Roth GA, Bisignano C, Abady GG, et al. Global, regional, and national burden of stroke and its risk factors, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Neurol. 2021;20:1–26. Article Google Scholar Wolters FJ, Arfan IM. Epidemiology of Vascular…
CHMP ISSUES POSITIVE OPINION FOR FUTIBATINIB FOR THE TREATMENT OF ADULTS WITH CHOLANGIOCARCINOMA
ZUG, Switzerland, April 27, 2023 /PRNewswire/ — Taiho Oncology Europe GmbH and Taiho Pharmaceutical Co., Ltd. announced today that the European Medicines Agency’s (EMA) Committee for Medicinal Products for Human Use (CHMP) has issued a positive opinion recommending the conditional marketing authorization (CMA) of futibatinib for the treatment of adult…
LCK Inhibition Reduces CCA Growth Via YAP Downregulation
The following is a summary of the “LCK inhibition downregulates YAP activity and is therapeutic in patient-derived models of cholangiocarcinoma,” published in the January 2023 issue of Hepatology by Conboy et al. Novel and effective medicinal therapy for cholangiocarcinoma (CCA) is needed. Yes-associated protein (YAP), a member of the Hippo…
PAI-1 4G/5G polymorphism in patients with DM & hypertension
Introduction Diabetes mellitus (DM) is a group of metabolic syndromes characterized by disorders of glucose metabolism, including type 1 DM, type 2 DM, gestational DM, and specific types of DM due to other causes. DM is closely associated with abnormal cardiac electrophysiological signal conduction and arrhythmias, whereby it triggers sudden…
Innovent reports OS data from Phase ll trial of Pemazyre
The Phase ll trial of Pemazyre includes Chinese patients with advanced cholangiocarcinoma. Credit: Nephron/commons.wikimedia.org. Innovent Biologics has presented overall survival (OS) data from a Phase ll trial of Pemazyre (pemigatinib) in Chinese patients diagnosed with advanced cholangiocarcinoma (CCA). The open-label, multi-centre, single-arm Phase ll trial has been designed to assess…
Relay Therapeutics’ Stock Price Premium Vs Peers Is Justified By Its Platform Technology, Analyst Says
Raymond James initiated coverage of Relay Therapeutics Inc (NASDAQ: RLAY) with an Outperform rating and a price target of $29 based upon the stock trading at 8x our EV/5-year forward sales estimate. The price is a premium to small-cap peers trading at 1-2x and mid-cap peers at ~3x, justified by Relay’s platform technology for identifying…
FGFR2 testing in cholangiocarcinoma: translating molecular studies into clinical practice
Review doi: 10.32074/1591-951X-859. Online ahead of print. Affiliations Expand Affiliations 1 Department of Medicine (DIMED), Surgical Pathology Unit, University of Padua, Padua (PD), Italy. 2 Medical Oncology, Azienda Ospedaliero-Universitaria Pisana, Pisa (PI), Italy. 3 Department of Public Health, University of Naples Federico II, Naples (NA), Italy. 4 Department of Medicine…
End result of trna | DLBCL treatment involves standard immuno-chemotherapy
Sequence tRNA Bounds tRNA One end of the L shape has the anticodon, while the other has the attachment site for the amino acid. Different tRNAs have slightly different structures, and this is important for making sure they get loaded up with the right amino acid. Loading a tRNA with…
InnoCare Releases 2022 Annual Results and Business Highlights
BEIJING–(BUSINESS WIRE)– InnoCare Pharma (HKEX: 09969; SSE: 688428), a leading biopharmaceutical company focusing on cancer and autoimmune diseases, today announced 2022 annual results as of 31 December 2022. Dr. Jasmine Cui, Co-founder, Chairwoman and CEO of InnoCare, said, “The company achieved high-quality development in various fields in 2022: rapid growth…
Python formatting when visualizing Primer3-py dimers
I am currently creating a program to analyze primers prior to multiplexing. I am interested in visualizing homo/heterodimers and hairpin structures. To do this I am using Primer3-py bindings. I am able to get a nice visual representation of dimers like so: z = primer3.bindings.calcHeterodimer(‘TGACACCGCCAAGGTGAATTT’, ‘CCGCTCCGTGGTTGGTCCGGTGGCGAGCGG’, output_structure = True).ascii_structure_lines print([i.split(‘\t’)[1]…
Urothelial Carcinoma Pipeline Assets and Comparative Analysis of Clinical and Non-Clinical Stage Products
PRESS RELEASE Published March 13, 2023 DelveInsight’s, “Urothelial Carcinoma Pipeline Insight, 2023,” report provides comprehensive insights about 40+ companies and 50+ pipeline drugs in the Urothelial Carcinoma pipeline landscape. It covers the Urothelial Carcinoma pipeline drug profiles, including Urothelial Carcinoma clinical trials and nonclinical stage products. It also covers the…
ncRNA | Free Full-Text | Long Noncoding RNA H19: A Novel Oncogene in Liver Cancer
Received: 9 February 2023 / Revised: 4 March 2023 / Accepted: 6 March 2023 / Published: 9 March 2023 Round 1 Reviewer 1 Report In this paper, they reviewed the role of a long non-coding RNA, H19, in liver cancer. H19 is a lncRNA, which has been extensively studied. Multiple…
course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN
News:course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN 0 Dear all, registration is now open for the 2nd edition of the course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN. Dates: online, 24-28 April This course will offer participants a practical introduction to some of the most useful functions available within…
Relay Therapeutics Reports Fourth Quarter and Full Year
Advanced RLY-4008: Reported interim data with 88% overall response rate at pivotal dose and 63% across all doses in pan-FGFR treatment-naïve, FGFR2-fusion cholangiocarcinoma patients & announced anticipated registrational path Progressed & expanded breast cancer portfolio: Continued monotherapy and initiated combination arms in study of PI3Kα inhibitor RLY-2608 & disclosed 3…
Relay Therapeutics: It Could Be Time To ‘Be Greedy When Others Are Fearful’ (NASDAQ:RLAY)
domoyega/E+ via Getty Images Investment Overview – Cash Intensive But Cash Rich – At Current Price Relay Offers The Patient Investor Value I have covered Relay Therapeutics (NASDAQ:RLAY) several times for Seeking Alpha since the company completed what was, at the time, the third largest biotech IPO in history, raising…
integration using rPCA with reference or without it?
integration using rPCA with reference or without it? 0 Hello all, I have decided to integrate my single cell dataset using rPCA rather than CCA because I thought using CCA overcorrect my dataset. I know there is two approaches using rPCA: to use references in “FindIntegrationAnchors” function and the reason…
Python 01 in Bioinformatics | Processing Gene Sequences from Scratch
1. Download of sequence data When we start to understand the processing flow of the sequence, we first need to know the sequence download URL. One of the well-known websites is NCBI (National Center for Biotechnology Information) US National Center for Biotechnology Information. 1. Enter NCBI through the following website,…
A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva
. 2023 Jan 25;1239:340736. doi: 10.1016/j.aca.2022.340736. Epub 2022 Dec 23. Affiliations Expand Affiliations 1 Department of Health Inspection and Quarantine, School of Public Health, Fujian Medical University, Fuzhou, Fujian, 350122, PR China. 2 College of Chemistry, Key Laboratory of Analysis and Detecting Technology, Food Safety MOE, Fuzhou University, Fuzhou, 350002,…
Kinnate’s CCA therapy KIN-3248 receives FDA Fast Track status
Micrograph of cholangiocarcinoma. Credit: Nephron / Wikimedia. Kinnate Biopharma has received Fast Track designation from the US Food and Drug Administration (FDA) for its pan-FGFR inhibitor, KIN-3248, to treat unresectable, locally advanced or metastatic cholangiocarcinoma (CCA). KIN-3248 is indicated to treat CCA harbouring fibroblast growth factor receptor 2 (FGFR2) gene…
Potential Roles of mtDNA Mutations in PCOS-IR
Introduction Polycystic ovary syndrome (PCOS) is the most common endocrine disease occurring during reproductive years. It was a kind of endocrine and metabolic disorders that results in obesity, irregularity of menstruation, OS, hyperinsulinemia, hyperandrogenism, infertility, and sterility.1,2 First identified in 1935, PCOS was also recognized as Stein–Leventhal syndrome.3 Diagnosis of…
Multivariate data analysis with R and vegan
News:course – Multivariate data analysis with R and vegan 0 Hi all, registration is now open for the 2nd edition of the course “Multivariate data analysis with R and vegan“. Dates: online, April, 24-28 This course will offer participants a practical introduction to some of the most useful functions available…
nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs | BMC Bioinformatics
Sanger HL, Klotz G, Riesner D, Gross HJ, Kleinschmidt AK. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci. 1976;73(11):3852–6. doi.org/10.1073/pnas.73.11.3852. Article CAS Google Scholar Arnberg AC, Van Ommen G-JB, Grivell LA, Van Bruggen EFJ, Borst P. Some yeast mitochondrial RNAs…
Evaluation of automated techniques for extraction of circulating cell-free DNA for implementation in standardized high-throughput workflows
Huebner, H. et al. Filtration based assessment of CTCs and Cell Search® based assessment are both powerful predictors of prognosis for metastatic breast cancer patients. BMC Cancer 18, 204. doi.org/10.1186/s12885-018-4115-1 (2018). Article Google Scholar Banys-Paluchowski, M., Krawczyk, N. & Fehm, T. Liquid biopsy in breast cancer. Geburtshilfe Frauenheilkd 80, 1093–1104….
Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine
Animals and immunizations The study protocol and all veterinarian procedures were approved by the Bioqual IACUC per a memorandum of understanding with the Duke IACUC, and were performed based on standard operating procedures. Macaques studied were housed and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited…
Inferring and perturbing cell fate regulomes in human brain organoids
Experimental methods Stem cell and organoid culture We used six human iPS cell lines (Hoik1, Wibj2, Kucg2 from the HipSci resource47; 409B2 from the RIKEN BRC cell bank; 01F49i-N-B7 (B7) from Institute of Molecular and Clinical Ophthalmology Basel; and WTC from the Allen Institute) and three human ES cell lines (H1-PAX6YFP…
A Phase 3, Open-Label, Randomized Study of Futibatinib Versus Gemcitabine-Cisplatin Chemotherapy as First-Line Treatment of Patients with Advanced Cholangiocarcinoma Harboring FGFR2 Gene Rearrangements
Official Trial Title A phase 3, open-label, randomized study of futibatinib versus germcitabine-cisplatin chemotherapy as first-line treatment of patients with advanced cholagiocarcinoma harboring FGFR2 gene rearrangements (FOENIX-CCA3) Study Description The University of Virginia is participating in a global clinical research study for adults ages 18 years of age, and over…
Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3
In vitro reconstitution of Escherichia coli CRISPR-Cas3 interference E. coli CRISPR-Cas3 is generally well-characterized type I CRISPR complexes in vitro and in vivo32,33,37,38. However, recombinant EcoCas3 protein is difficult to purify because of poor solubility and propensity to aggregate at 37 °C25,26,30,39. Co-expression of HtpG chaperon40 and/or low temperature growth at…
Live-seq enables temporal transcriptomic recording of single cells
Biological materials RAW264.7, 293T and HeLa cells were obtained from ATCC. RAW264.7 cells with Tnf-mCherry reporter and relA-GFP fusion protein (RAW-G9 clone) were kindly provided by I.D.C. Fraser (National Institutes of Health). The IBA cell line derived from the stromal vascular fraction of interscapular brown adipose tissue of young male…
between results of RNAseq and absence/presence of Type3 Secretion System
Correlation between two different datasets: between results of RNAseq and absence/presence of Type3 Secretion System 1 Dear All, I have a “How would you solve” kind of question. I have two sets of tables : 1. Log2FoldChange table and 2. Effectors Table. Firstly, the Log2FoldChange table was obtained by performing…
(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData
(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData 0 I have a question regarding re-clustering after removing cells using SubsetData (R – Seurat package). I am in the process of analyzing a relatively large single-cell dataset (16 separate samples of ~5-10k cells each). In our first…
C698R mutation in Lrsam1 gene impairs nerve regeneration in a CMT2P mouse model
Animal generation The Lrsam1C698R knock-in mice were generated on a C57Bl/6J background using the CRISPR/Cas9 technique. Briefly, single-cell zygotes from C57BL/6J mice were microinjected with mRNA encoding Cas9 and a guide sequence (5′-ACAGCAGCAGACGTGGCCAC-3′ at 20 ng/µl) to target the exon 26 of Lrsam1. A single stranded DNA oligo carrying the C698R mutation…
Single-cell analyses define a continuum of cell state and composition changes in the malignant transformation of polyps to colorectal cancer
Mapping molecular changes across malignant transformation We generated single-cell data for 81 samples collected from eight FAP and seven non-FAP donors (Fig. 1a and Supplementary Tables 1 and 2). For each tissue, we performed matched scATAC-seq and snRNA-seq (10x Genomics). We obtained high-quality single-cell chromatin accessibility profiles for 447,829 cells…
Helsinn Expands US R&D Capabilities on Heels of BridgeBio Licensing Deal
Helsinn Group is expanding its global research and development capacity with the launch of a new dedicated hub in the U.S. The new R&D facility is a product of Helsinn’s new licensing deal with BridgeBio and will operate under Helsinn Therapeutics (U.S.). It will be instrumental in furthering the company’s projected increase in clinical activities to…
tReasure: R-based GUI package analyzing tRNA expression profiles from small RNA sequencing data | BMC Bioinformatics
tReasure (tRNA Expression Analysis Software Utilizing R for Easy use) is a graphical user interface (GUI) tool for the analysis of tRNA expression profiles from deep-sequencing data of small RNAs (small RNA-seq) using R packages. The whole analysis workflow, including the uploading of FASTQ files of small RNA-seq, quantification of…
Solved 28) What structure below provides an “anticodon”?
Transcribed image text: 28) What structure below provides an “anticodon”? (2pts) OmicroRNA mRNA tRNA rRNA 29) Which of the following modifications is involved in the 3′ (three prime) end-processing of pre- (4pts) mRNA precursors in eukaryotic cells? Addition of a methlyguanosine cap Splicing out introns Addition of Poly-A tail Forming…
Metagenomics technology and microbial community diversity analysis methods
A large number of microorganisms in nature cannot be cultivated under laboratory conditions by pure culture methods, and the technical methods of traditional microbiology limit the research on environmental microorganisms. The rapid development of high-throughput omics technology has enabled humans to have an unprecedented understanding of the complex microbial communities…
Helsinn Group and BridgeBio Pharma Announce Update to Strategic Collaboration to Develop, Manufacture and Commercialize Infigratinib in Oncology Indications in the U.S.
Lugano, Switzerland and Palo Alto, CA – Helsinn Group (Helsinn), a fully integrated, global biopharma company with a diversified pipeline of innovative oncology assets and strong track-record of commercial execution, and BridgeBio Pharma, Inc. (Nasdaq: BBIO) (BridgeBio), a commercial-stage biopharmaceutical company that focuses on genetic diseases and cancers, announced an…
Identification of Hub Genes Associated with COPD Through Integrated Bi
Introduction Chronic obstructive pulmonary disease (COPD) will become the third leading cause of death worldwide.1,2 The incidence of COPD worldwide is 13.1%3 and is 13.7% in the Chinese population over 40 years of age.4 Emphysema is one of the most common phenotypes.1 Over the past few decades, we have conducted…
scrnaseq – Integrating scRNA-seq data using raw data
I believe when you say alignment, you mean aligning reads to a genome (sometimes to transcriptome) and count these to get count matrices. In the aforementioned paper, however, what is meant is “bringing different data sets to a level where they can be compared/integrated/…”. Basically scRNA-seq data are heavily prone…
The Evolving Treatment Landscape of Cholangiocarcinoma
Recent genomic profiling studies revealed that approximately 40% of patients with biliary tract cancers harbor actionable genomic mutations. The advances in the understanding and characterization of biliary tract cancers (BTCs), particularly intrahepatic cholangiocarcinoma (iCCA), and genomic profiling over the past decade have led to a rapid expansion of available treatment…
Summer Research Assistant/Associate, Center for Computational Biology
Tremendous opportunities for discovery have emerged in the biological sciences, requiring the combined power of theory, data analysis, and simulation. Researchers are being confronted by an explosion of information from genome sequencing, gene expression profiling, proteomics, electron microscopy and tomography, and multiple high-resolution imaging modalities both dynamic and static. The…
Mutational Analysis of Mitochondrial tRNA Genes
Introduction Diabetes is a very complex disease characterized by the presence of chronic hyperglycemia. Clinically, insulin-dependent type 1 and non-insulin-dependent type 2 are the main types of diabetes. Among them, type 2 diabetes mellitus (T2DM, [MIM125853]) is a common endocrine disorder affecting approximately 10% of adult population.1 In most cases,…
Gene mutation analysis in papillary thyroid carcinoma
Introduction Thyroid tumors are the most common malignant tumors of the endocrine system, and their incidence has been increasing in the recent decades. Currently, there are some target drugs that can effectively treat PTC, and next-generation sequencing (NGS) can be used for targeted therapy. In order to make better informed…
New frog on the block!
The worldwide scientific community is too often bombarded with bad news — from first time ever rains at the Greenland ice summit to the Intergovernmental Panel on Climate Change’s (IPCC) doomsday forecast, there is hardly ever a reason to celebrate. Yet for Bangladesh’s nature enthusiasts, there is cause to celebrate….