Categories
Tag: CCA
Domestic pigs are susceptible to experimental infection with non-human primate-derived Reston virus without the need for adaptation
Ethics and animal welfare statement All infectious work with RESTV, including sample inactivation, was performed in the Containment Level 4 laboratory (CL4) in accordance with the policies and protocols outlined by the Canadian Science Centre for Human and Animal Health Institutional Biosafety Committee. All animal work was performed in strict…
Frontiers Publishing Partnerships | Construction of recombinant adenovirus-5 vector to prevent replication-competent adenovirus occurrence
Introduction In recent years, recombinant adenoviral vectors have been used in different fields of biomedical sciences such as in vitro and in vivo gene transfer, vaccine development, and gene therapy (Russell, 2000; Mitani and Kubo, 2002). Multiple features of recombinant adenoviral vectors such as high packaging capacity for transgene insertion,…
Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain
Mouse brain tissues All experimental procedures using live animals were approved by the Salk Institute Animal Care and Use Committee under protocol number 18-00006. Adult (P56) C57BL/6J male mice were purchased from the Jackson Laboratory at 7 weeks of age and maintained in the Salk animal barrier facility on 12-h dark–light…
Cholangiocarcinoma Pipeline Drugs Analysis Report(2023 Updates): FDA Approvals, Clinical Trials, Therapies, MOA, ROA by DelveInsight
PRESS RELEASE Published December 12, 2023 (Las Vegas, Nevada, United States) As per DelveInsight’s assessment, globally, Cholangiocarcinoma pipeline constitutes 55+ key companies continuously working towards developing 60+ Cholangiocarcinoma treatment therapies, analysis of Clinical Trials, Therapies, Mechanism of Action, Route of Administration, and Developments analyzes DelveInsight. The Cholangiocarcinoma Pipeline report embraces…
Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland
Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…
RPTOR mutation: a novel predictor of efficacious immunotherapy in melanoma
Li Z, Gao Y, Cao Y et al (2023) Extracellular RNA in Melanoma: advances, challenges, and opportunities. Front Cell Dev Biol 11:1141543. doi.org/10.3389/fcell.2023.1141543 Article PubMed PubMed Central Google Scholar Hamid O, Cowey CL, Offner M, Faries M, Carvajal RD (2019) Efficacy, Safety, and tolerability of approved combination BRAF and MEK…
GENFIT Updates 2024 Outlook Following Acceptance of
US Food and Drug Administration (FDA) has granted Priority Review for New Drug Application (NDA) for elafibranor in PBC, and European Medicine Agency (EMA) has also validated the Marketing Authorization Application (MAA) for elafibranor. Acceptance triggers a first milestone payment. Further milestones are expected upon US and European launches which…
tRNA therapeutics for genetic diseases
Huang, X. et al. The landscape of mRNA nanomedicine. Nat. Med. 28, 2273–2287 (2022). Article CAS Google Scholar Rohner, E., Yang, R., Foo, K. S., Goedel, A. & Chien, K. R. Unlocking the promise of mRNA therapeutics. Nat. Biotechnol. 40, 1586–1600 (2022). Article CAS Google Scholar Brown, A., Shao, S.,…
A Reliable Method for Quantifying Plasma Cell-Free DNA Using an Internal Standard Strategy: Evaluation in a Cohort of Non-Pregnant and Pregnant Women
Martignano F. Cell-free DNA: an overview of sample types and isolation procedures. In: Casadio V, Salvi S, editors. Cell-free DNA as diagnostic markers. Methods in molecular biology, Vol. 1909. New York, NY: Humana Press; 2019. p. 13–27. doi.org/10.1007/978-1-4939-8973-7_2. Volckmar AL, Sültmann H, Riediger A, Fioretos T, Schirmacher P, Endris V,…
Metagenomic profiles of archaea and bacteria within thermal and geochemical gradients of the Guaymas Basin deep subsurface
Sampling sites and depths Metagenomes were produced from sediment samples at drilling sites U1545B to U1549B that follow a northwest-to-southeast transect across the northwestern flanking region of Guaymas Basin (Fig. 1A) and include an off-axis hydrothermal system, the Ringvent site (Fig. 1B). The samples were selected to coordinate with depths used for…
ICMR-NIIH Bioinformatics Job – Biotech, Microbiology, Biochem Job
“Exciting Job Opportunity in Bioinformatics at ICMR-NIIH: Apply Now for Biotech, Microbiology, and Biochem Positions!” ICMR-NIIH Bioinformatics Job – Biotech, Microbiology, Biochem Apply Online National Institute of Immunohaematology (NIIH), a part of the Department of Health Research under the Ministry of Health and Family Welfare, invites applications for the following…
Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs
Rv3907c is the CCA-adding enzyme in Mycobacterium It remains unclear whether the rv3907c gene product, originally annotated as poly(A) polymerase, is in fact the CCA-adding enzyme in Mtb. Rv3907c is composed of three domains, an N-terminal class II polymerase β superfamily domain, a central RNA-binding domain and a C-terminal HD…
Are liger or Seurat CCA good strategies for multiple scRNA-seq data integration?
Are liger or Seurat CCA good strategies for multiple scRNA-seq data integration? 1 Hi, I am working on analyzing multiple scRNA-seq dataset from embryonic tissues at progressive stages. I used three recent integration algorithms 1) liger, 2) Seurat CCA and 3) fastMNN. I started with these based on recommendation from…
Oncogenic activation revealed by FGFR2 genetic alterations in intrahepatic cholangiocarcinomas | Cell & Bioscience
Everhart JE, Ruhl CE. Burden of digestive diseases in the United States Part III: Liver, biliary tract, and pancreas. Gastroenterology. 2009;136(4):1134–44. Article PubMed Google Scholar Khan SA, Thomas HC, Davidson BR, Taylor-Robinson SD. Cholangiocarcinoma. Lancet. 2005;366(9493):1303–14. Article PubMed Google Scholar Nakanuma Y, Klimstra DS, Komuta M, Zen Y (2019) Intrahepatic…
Options for assigning cell labels to barcodes from CITE-seq experiment
Options for assigning cell labels to barcodes from CITE-seq experiment 0 I have barcodes from a CITE-seq experiment that I would like to assign cell labels to. To accomplish this task, I used the Monaco reference database as input into SingleR based on the RNA expression data. I would now…
Relay: Market Underestimating Lirafugratinib’s Potential (Upgrade) (RLAY)
Anchiy At a Glance Relay Therapeutics (NASDAQ:RLAY) has reached a critical phase, juxtaposing strong financial foundations against increasing operational costs, which I have previously analyzed in depth. Since my last evaluation, lirafugratinib’s clinical momentum has been maintained in the Phase 1/2 ReFocus trial, showing significant promise for FGFR2-altered cholangiocarcinoma, although…
Correction of a homoplasmic mitochondrial tRNA mutation in patient-derived iPSCs via a mitochondrial base editor
Human induced pluripotent stem cells (iPSCs) Reprogramming and Culture This study was ethically approved by the Medical Ethics Committee of Nanjing Maternal and Child Health Care Hospital (2021KY-131), and informed consents were obtained from the patient’s legal guardian as well as the healthy donors, in accordance with the Declaration of…
Relay Therapeutics Reports Third Quarter 2023 Financial Results and Corporate Highlights
Relay Therapeutics, Inc. Reported initial RLY-4008 (lirafugratinib) data demonstrating durable responses across multiple FGFR2-altered solid tumors Announced plans to initiate RLY-2608 + fulvestrant + CDK4/6 triplet combinations in HR+/HER2- breast cancer by YE 2023 Updated pipeline to extend cash runway by approximately 1 year Approximately $811 million in cash, cash…
HLA allele-calling using multi-ancestry whole-exome sequencing from the UK Biobank identifies 129 novel associations in 11 autoimmune diseases
HLA allele calling from WES HLA-HD was used to call HLA alleles for 454,824 participants at 3-field resolution (representing the allele’s serological specificity, HLA protein, and synonymous variants). We used the UKB whole-genome genotyping (unavailable in 1283 participants) projected on the 1000 Genome reference to estimate genetic ancestry. We found…
Microsurgical Creation of Giant Bifurcation Aneurysms in Rabbits for the Evaluation of Endovascular Devices
Here, we describe the technique for the microsurgical creation of giant bifurcation aneurysms in rabbits for the evaluation of endovascular devices. Reliable animal models for giant aneurysms are rare. However, these models are extremely important for the development of new endovascular devices to treat these aneurysms safely. The advantages of…
HOXC-AS3 as an Oncological Biomarker and Therapeutic Target
1Department of Gastrointestinal Surgery, The Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, 330008, People’s Republic of China; 2Department of General Surgery, Jiujiang Hospital of Traditional Chinese Medicine, Jiujiang, Jiangxi, 332007, People’s Republic of China; 3Queen Mary School, Nanchang University, Nanchang, Jiangxi, 330038, People’s Republic of China Correspondence: Hongliang Luo,…
MD Anderson research highlights: ESMO 2023 sp
ABSTRACTS: LBA71, 1088MO, 95MO, LBA48, 1082O, 1085O, LBA34, 243MO MADRID ― The University of Texas MD Anderson Cancer Center’s Research Highlights provides a glimpse into recent basic, translational and clinical cancer research from MD Anderson experts. This special edition features upcoming oral presentations by MD Anderson researchers at the 2023 European Society for Medical Oncology…
Neuron Navigator 1 (Nav1) regulates the response to cocaine in mice
Mouse strains All mouse procedures were approved by the Institutional Animal Care and Use Committees at Binghamton or Stanford University; and were conducted in accordance with the National Institute of Health Guide for Care and Use of Laboratory Animals, Eighth Edition. All mice were originally obtained from Jackson Laboratories, and…
Positive Breast Cancer Data from Relay Therapeutics
Last week, Relay Therapeutics shared results about their experimental drug, RLY-4008, designed to treat a specific type of breast cancer. The drug is being tested in a two-step study named the “ReFocus trial.” They’ve completed the first step, and now they’re in the second step, figuring out the right dosage….
Relay Therapeutics Pauses Lirafugratinib Rare Cancer Plans Due to IRA
Pictured: Finger pressing pause button/iStock, cagkansayin Relay Therapeutics announced plans Thursday to shift gears, pausing its push for rare cancer and switching focus to the larger tumor-agnostic market. The Boston-based biotech is pointing to the Inflation Reduction Act as a driving factor of its decision. Relay’s FGFR2 inhibitor has been…
Relay Therapeutics Announces Initial RLY-4008
35% ORR in patients with FGFR2 fusions (excluding CCA) & 40% ORR in patients with FGFR2-altered HR+/HER2- breast cancer RLY-4008 commercialization plans to focus on broader tumor agnostic opportunities Clinical focus on PI3Kα mutant selective programs, with plans to initiate RLY-2608 triplet combinations in HR+/HER2- breast cancer by YE 2023…
Relay Therapeutics, Inc. Announces Initial RLY-4008 (lirafugratinib) Data Demonstrating Durable Responses Across Multiple FGFR2-Altered Solid Tumors -October 12, 2023 at 04:05 pm EDT
Relay Therapeutics, Inc. announced initial clinical data for RLY-4008 (lirafugratinib) in patients with FGFR2-altered solid tumors. The first part of the study (dose escalation) is complete, and the second part of the study (dose expansion) is ongoing at the 70mg QD recommended Phase 2 dose. Most treatment-related adverse events were…
Knight Therapeutics Announces Regulatory Submission of
MONTREAL, Oct. 10, 2023 (GLOBE NEWSWIRE) — Knight Therapeutics Inc., (TSX: GUD) (“Knight”) a pan-American (ex-USA) specialty pharmaceutical company, announced today that its Brazilian affiliate, United Medical Ltd., has submitted a marketing authorization application for pemigatinib to ANVISA, the Brazilian health regulatory agency, under the rare diseases approval pathway, for…
When should I NOT apply batch correction for my single-cell RNAseq data?
Hi! Some personal thoughts/opinions: integration is about finding the similar cell types/states across data sets (either with or without batch effect). An experimental batch corresponds to a set of samples that were processed simultaneously in the same manner and, thus, reducing the effect of technical artifacts/noise. As I see your…
ncRNA | Free Full-Text | Long Non-Coding RNA TUG1 Gene Polymorphism and TUG1 Expression Level as Molecular Biomarkers of Systemic Lupus Erythematosus and Lupus Nephritis
1. Introduction Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with a wide variety of manifestations ranging from mild cutaneous to organ failure as lupus nephritis (LN) and cardiopulmonary complications [1]. SLE is mainly present among young women, with a greater incidence in certain ethnic groups, such as Asian,…
Relay Therapeutics to Present Clinical Data on RLY-4008 in Advanced FGFR2-Altered Solid Tumors at 2023 AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics
Relay Therapeutics, Inc. CAMBRIDGE, Mass., Sept. 18, 2023 (GLOBE NEWSWIRE) — Relay Therapeutics, Inc. (Nasdaq: RLAY), a clinical-stage precision medicine company transforming the drug discovery process by combining leading-edge computational and experimental technologies, today announced that data for RLY-4008 (lirafugratinib) in patients with advanced FGFR2-altered solid tumors outside of cholangiocarcinoma…
Single-cell brain organoid screening identifies developmental defects in autism
Stem cell and cerebral organoid culture conditions Feeder-free hES cells or iPS cells were cultured on hES cell-qualified Matrigel (Corning, catalogue no. 354277)-coated plates with Essential8 stem cell medium supplemented with bovine serum albumin (BSA). H9 embryonic stem cells were obtained from WiCell. Cells were maintained in a 5% CO2 incubator at 37 °C….
Eimeria zuernii (Eimeriidae: Coccidia): mitochondrial genome and genetic diversity in the Chinese yak | Parasites & Vectors
Eimeria zuernii mitogenome feature The E. zuernii linear mitogenome was 6176 bp in size and encoded three PCGs, cytb, cox1, and cox3, as well as seven interspersed small subunit (SSU) and twelve interspersed large subunit (LSU) rDNA fragments (Fig. 2). No transfer RNAs (tRNAs) were found in the E. zuernii mitogenome, similar…
Cholangiocarcinoma Pipeline Drugs Analysis Report, 2023: FDA Approvals, Clinical Trials, Therapies, Mechanism of Action, Route of Administration by DelveInsight
PRESS RELEASE Published August 31, 2023 (Las Vegas, Nevada, United States) As per DelveInsight’s assessment, globally, Cholangiocarcinoma pipeline constitutes 55+ key companies continuously working towards developing 60+ Cholangiocarcinoma treatment therapies, analysis of Clinical Trials, Therapies, Mechanism of Action, Route of Administration, and Developments analyzes DelveInsight. The Cholangiocarcinoma Pipeline report embraces…
Tutustu 93+ imagen r studio correlation
Jaa kuvia r studio correlation. Correlation Test Between Two Variables in R – Easy Guides – Wiki – STHDA Correlation Analyses in R – Easy Guides – Wiki – STHDA Pearson correlation in R | R-bloggers Correlation coefficient and correlation test in R | R-bloggers Correlation Analyses in R –…
Struktur Komunitas dan Aktivitas Bakteri Nitrifikasi, Denitrifikasi, dan Nitrat Amonifikasi di Tambak Udang Sistem Intensif
Udang merupakan salah satu komoditas unggulan perikanan budidaya di Indonesia. Tambak udang sebagai suatu ekosistem memiliki senyawa nitrogen anorganik utama yang dapat terlarut dalam air, yaitu amonia (NH3), nitrat (NO3-), dan nitrit (NO2-). Permasalahan yang sering terjadi dalam pengelolaan tambak udang yaitu penurunan kualitas air dan sedimen yang disebabkan oleh…
Spatial transcriptomics: recent developments and insights in respiratory research | Military Medical Research
Zepp JA, Morrisey EE. Cellular crosstalk in the development and regeneration of the respiratory system. Nat Rev Mol Cell Biol. 2019;20(9):551–66. Article CAS PubMed PubMed Central Google Scholar Kiley JP. Advancing respiratory research. Chest. 2011;140(2):497–501. Article PubMed PubMed Central Google Scholar Goldstraw P, Ball D, Jett JR, Le Chevalier T,…
What is the next step in preventative therapi
image: In a chronic inflammatory context, epigenetic changes occur in LPCs: (1) through a sustained stimulation by cytokines that either promotes dedifferentiation and transformation of LPCs to CSCs (IL-17, TNF-α and IL-6), or in contrast avoiding their transformation (IFN-γ, IL-27); (2) by hosting small non-coding RNAs transferred by exosomes coming from…
MenT nucleotidyltransferase toxins extend tRNA acceptor stems and can be inhibited by asymmetrical antitoxin binding
MenAT1 sequence analysis Analysis of gene neighbourhoods for rv0078B (menA1) was performed using default settings in FlaGs (www.webflags.se/). Output sequences for MenA1 and cognate MenT1 homologues were then used to perform sequence alignments using MUSCLE (www.ebi.ac.uk/Tools/msa/muscle/), then formatted in Jalview (www.jalview.org/), sorting by pairwise alignment. Residues of interest were then…
Transcriptomic risk scores for attention deficit/hyperactivity disorder
Song P, Zha M, Yang Q, Zhang Y, Li X, Rudan I. The prevalence of adult attention-deficit hyperactivity disorder: A global systematic review and meta-analysis. J Glob Health. 2021;11:1–9. Article Google Scholar Faraone SV, Asherson P, Banaschewski T, Biederman J, Buitelaar JK, Ramos-Quiroga JA, et al. Attention-deficit/hyperactivity disorder. Nat Rev…
ctDNA and Lung Cancer | SpringerLink
Abbosh C, Birkbak NJ, Wilson GA, et al (2017) Phylogenetic ctDNA analysis depicts early-stage lung cancer evolution. Nature 545:446–451. doi.org/10.1038/nature22364 CrossRef CAS PubMed PubMed Central Google Scholar Adalsteinsson VA, Ha G, Freeman SS, et al (2017) Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors. Nat Commun…
A culture-free method for rapidly and accurately quantifying active SARS-CoV-2
Boger B, Fachi MM, Vilhena RO, Cobre AF, Tonin FS, Pontarolo R. Systematic review with meta-analysis of the accuracy of diagnostic tests for COVID-19. Am J Infect Control. 2021;49(1):21–9. doi.org/10.1016/j.ajic.2020.07.011. Article CAS PubMed Google Scholar Sule WF, Oluwayelu DO. Real-time RT-PCR for COVID-19 diagnosis: challenges and prospects. Pan Afr Med…
EC grants conditional marketing authorization for Taiho’s Lytgobi
The European Commission has granted conditional marketing authorization for Lytgobi (futibatinib) monotherapy for the treatment of adult patients with locally advanced or metastatic cholangiocarcinoma (CCA) with a fibroblast growth factor receptor (FGFR2) fusion or rearrangement that have progressed after at least one prior line of systemic therapy. The treatment for…
Targeted Intra-Arterial Gemcitabine vs. Continuation of IV Gemcitabine plus Nab-Paclitaxel Following Induction with Sequential IV Gemcitabine plus Nab-Paclitaxel and Radiotherapy for Locally Advanced Pancreatic Cancer (TIGeR-PaC) First Interim Analysis Presented at the 2023 ESMO World Congress on Gastrointestinal Cancer
Delayed Nasdaq – 04:00:00 2023-06-27 pm EDT 5-day change 1st Jan Change 2.150 USD +4.88% +8.59% -8.51% The Phase 3 Study: Targeted Intra-Arterial Gemcitabine vs. Continuation of IV Gemcitabine plus Nab-Paclitaxel Following Induction with Sequential IV Gemcitabine plus Nab-Paclitaxel and Radiotherapy for Locally Advanced Pancreatic Cancer (TIGeR-PaC) First Interim Analysis…
Patterns and determinants of the global herbivorous mycobiome
Sampling overview A total of 661 samples belonging to 34 species and 9 families of foregut-fermenting ruminant (thereafter ruminant, n = 468), foregut-fermenting pseudoruminant (thereafter pseudoruminant, n = 17), and hindgut fermenters (n = 176) were examined (Fig. 1a, b, Supplementary Data 1). The dataset also provides a high level of replication for a variety of animals (229…
Solved Need help with All Please!! Which of the following is
Need help with All Please!! Which of the following is a function of rRNA in a ribosome? Group of answer choices To ensure that only the correct mRNAs enter the ribosome To recruit the appropriate tRNA molecules into the ribosome Peptidyl transferase activity To regulate the speed of translation by…
Nitrate and a nitrate-reducing Rothia aeria strain as potential prebiotic or synbiotic treatments for periodontitis
Bacterial strains and growth conditions Rothia aeria CECT9999 (Ra9, isolate D1P7 described in24), was used as a nitrate-reducing probiotic candidate. Prior to the experiment, Brain Heart Infusion (BHI) (Biolife, Deerfield, Illinois, USA) agar plates were inoculated with the strain, incubated for 48 h at 37 °C, and stored at 4 °C for up…
Analysis of tRNA-derived small RNAs
Introduction Sarcoidosis is a multisystem inflammatory disease of unknown aetiology that is characterised by non-caseating epithelioid granulomatous lesions (aggregates of lymphocytes, macrophages, epithelioid cells, and giant cells).1 Typical clinical features include bilateral hilar lymph node lesions, pulmonary infiltration, and eye and skin lesions. Some patients may also have neurological and…
Pathalys Pharma and Launch Therapeutics Announce First Patient Enrolled Ahead of Schedule in Pivotal Phase 3 Program for Upacicalcet in Patients Receiving Hemodialysis
Pathalys and LaunchTx leverage recently announced collaboration to accelerate enrollment for the upacicalcet development program. RESEARCH TRIANGLE PARK, N.C. and BOSTON, May 31, 2023 /PRNewswire/ — Pathalys Pharma, Inc., a private, late-stage biopharma company co-founded by Catalys Pacific and DaVita Venture Group, and Launch Therapeutics (Launch Tx), a clinical development company, today announced…
corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database
corresponding clinical data from TCGA database of PSI values for CCA AS events in spliceseq database 0 hello everyone.. I have a problem seems to be very easy but I cant find a solution so I need your help. I have downloaded PSI values for CHOL (cholangiocarcinoma) AS events from…
Relay Therapeutics Announces Full Dose Escalation Data for
CAMBRIDGE, Mass., May 25, 2023 (GLOBE NEWSWIRE) — Relay Therapeutics, Inc. (Nasdaq: RLAY), a clinical-stage precision medicine company transforming the drug discovery process by combining leading-edge computational and experimental technologies, today announced complete first-in-human dose escalation data for RLY-4008, an investigational, potent, selective and oral small molecule inhibitor of fibroblast…
Relay Therapeutics Announces Promising Results for Investigational Drug Targeting FGFR2
On May 25, 2023, Relay Therapeutics made a significant announcement regarding their latest investigational drug, RLY-4008. This oral small molecule inhibitor specifically targets fibroblast growth factor receptor 2 (FGFR2) and has shown promising results during its first-in-human dose escalation trials. The data was collected from the Phase 1/2 ReFocus study,…
Ongoing Investigation of RLY-4008 Highlights Evolving Treatment Options for FGFR2+ Cholangiocarcinoma
R. Kate (Katie) Kelley, MD The selective FGFR2 inhibitor RLY-4008 has generated higher response rates compared with historical data for prior pan-FGFR inhibitors in patients with cholangiocarcinoma harboring FGFR2 fusions or alterations who have not been exposed to a prior FGFR inhibitor, according to R. Kate (Katie) Kelley, MD. Data…
Deletion of endothelial leptin receptors in mice promotes diet-induced obesity
Experimental animals The generation of mice with tamoxifen-inducible, Tie2.Cre-ERT2-mediated deletion of LepR in endothelial cells was described previously12,17. For Cre recombinase activation, mice (6 weeks-of-age) were fed tamoxifen citrate-containing rodent chow (Envigo; TD.130860) for 6 weeks49. Genomic DNA from the brain, lung, small intestine, subcutaneous adipose tissue (SCAT) and visceral adipose tissue…
vep – How to normalise indel of different transcript direction?
I am trying to reproduce an analysis result, and there is a requirement regarding the format of the result: the ‘3’ rule ‘: all mutations should be expressed in a position close to the end of the gene transcription direction (3’ end). The result I obtained is(annotate from VEP) Chromosome…
A guide through the genome of crops
BZR1 regulatory network in maize and Arabidopsis. a Distribution of ZmBZR1 binding around transcribed genes. Frequency of ZmBZR1 binding peaks up to 10 kb up- or downstream of TSS or TTS and intra-genic, respectively. b ChIP-seq identified ZmBZR1 binding in proximity of putative targets repressed (BR6ox2/BRD1), induced (IAA19) or not controlled…
Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant
Ethics statement All experiments with hamsters were performed in accordance with the Science Council of Japan’s Guidelines for the Proper Conduct of Animal Experiments. The protocols were approved by the Institutional Animal Care and Use Committee of National University Corporation Hokkaido University (approval ID: 20-0123 and 20-0060). All protocols involving…
Functional genomics in stroke: current and future applications of iPSCs and gene editing to dissect the function of risk variants | BMC Cardiovascular Disorders
Feigin VL, Stark BA, Johnson CO, Roth GA, Bisignano C, Abady GG, et al. Global, regional, and national burden of stroke and its risk factors, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Neurol. 2021;20:1–26. Article Google Scholar Wolters FJ, Arfan IM. Epidemiology of Vascular…
CHMP ISSUES POSITIVE OPINION FOR FUTIBATINIB FOR THE TREATMENT OF ADULTS WITH CHOLANGIOCARCINOMA
ZUG, Switzerland, April 27, 2023 /PRNewswire/ — Taiho Oncology Europe GmbH and Taiho Pharmaceutical Co., Ltd. announced today that the European Medicines Agency’s (EMA) Committee for Medicinal Products for Human Use (CHMP) has issued a positive opinion recommending the conditional marketing authorization (CMA) of futibatinib for the treatment of adult…
LCK Inhibition Reduces CCA Growth Via YAP Downregulation
The following is a summary of the “LCK inhibition downregulates YAP activity and is therapeutic in patient-derived models of cholangiocarcinoma,” published in the January 2023 issue of Hepatology by Conboy et al. Novel and effective medicinal therapy for cholangiocarcinoma (CCA) is needed. Yes-associated protein (YAP), a member of the Hippo…
PAI-1 4G/5G polymorphism in patients with DM & hypertension
Introduction Diabetes mellitus (DM) is a group of metabolic syndromes characterized by disorders of glucose metabolism, including type 1 DM, type 2 DM, gestational DM, and specific types of DM due to other causes. DM is closely associated with abnormal cardiac electrophysiological signal conduction and arrhythmias, whereby it triggers sudden…
Innovent reports OS data from Phase ll trial of Pemazyre
The Phase ll trial of Pemazyre includes Chinese patients with advanced cholangiocarcinoma. Credit: Nephron/commons.wikimedia.org. Innovent Biologics has presented overall survival (OS) data from a Phase ll trial of Pemazyre (pemigatinib) in Chinese patients diagnosed with advanced cholangiocarcinoma (CCA). The open-label, multi-centre, single-arm Phase ll trial has been designed to assess…
Relay Therapeutics’ Stock Price Premium Vs Peers Is Justified By Its Platform Technology, Analyst Says
Raymond James initiated coverage of Relay Therapeutics Inc (NASDAQ: RLAY) with an Outperform rating and a price target of $29 based upon the stock trading at 8x our EV/5-year forward sales estimate. The price is a premium to small-cap peers trading at 1-2x and mid-cap peers at ~3x, justified by Relay’s platform technology for identifying…
FGFR2 testing in cholangiocarcinoma: translating molecular studies into clinical practice
Review doi: 10.32074/1591-951X-859. Online ahead of print. Affiliations Expand Affiliations 1 Department of Medicine (DIMED), Surgical Pathology Unit, University of Padua, Padua (PD), Italy. 2 Medical Oncology, Azienda Ospedaliero-Universitaria Pisana, Pisa (PI), Italy. 3 Department of Public Health, University of Naples Federico II, Naples (NA), Italy. 4 Department of Medicine…
End result of trna | DLBCL treatment involves standard immuno-chemotherapy
Sequence tRNA Bounds tRNA One end of the L shape has the anticodon, while the other has the attachment site for the amino acid. Different tRNAs have slightly different structures, and this is important for making sure they get loaded up with the right amino acid. Loading a tRNA with…
InnoCare Releases 2022 Annual Results and Business Highlights
BEIJING–(BUSINESS WIRE)– InnoCare Pharma (HKEX: 09969; SSE: 688428), a leading biopharmaceutical company focusing on cancer and autoimmune diseases, today announced 2022 annual results as of 31 December 2022. Dr. Jasmine Cui, Co-founder, Chairwoman and CEO of InnoCare, said, “The company achieved high-quality development in various fields in 2022: rapid growth…
Python formatting when visualizing Primer3-py dimers
I am currently creating a program to analyze primers prior to multiplexing. I am interested in visualizing homo/heterodimers and hairpin structures. To do this I am using Primer3-py bindings. I am able to get a nice visual representation of dimers like so: z = primer3.bindings.calcHeterodimer(‘TGACACCGCCAAGGTGAATTT’, ‘CCGCTCCGTGGTTGGTCCGGTGGCGAGCGG’, output_structure = True).ascii_structure_lines print([i.split(‘\t’)[1]…
Urothelial Carcinoma Pipeline Assets and Comparative Analysis of Clinical and Non-Clinical Stage Products
PRESS RELEASE Published March 13, 2023 DelveInsight’s, “Urothelial Carcinoma Pipeline Insight, 2023,” report provides comprehensive insights about 40+ companies and 50+ pipeline drugs in the Urothelial Carcinoma pipeline landscape. It covers the Urothelial Carcinoma pipeline drug profiles, including Urothelial Carcinoma clinical trials and nonclinical stage products. It also covers the…
ncRNA | Free Full-Text | Long Noncoding RNA H19: A Novel Oncogene in Liver Cancer
Received: 9 February 2023 / Revised: 4 March 2023 / Accepted: 6 March 2023 / Published: 9 March 2023 Round 1 Reviewer 1 Report In this paper, they reviewed the role of a long non-coding RNA, H19, in liver cancer. H19 is a lncRNA, which has been extensively studied. Multiple…
course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN
News:course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN 0 Dear all, registration is now open for the 2nd edition of the course MULTIVARIATE DATA ANALYSIS WITH R AND VEGAN. Dates: online, 24-28 April This course will offer participants a practical introduction to some of the most useful functions available within…
Relay Therapeutics Reports Fourth Quarter and Full Year
Advanced RLY-4008: Reported interim data with 88% overall response rate at pivotal dose and 63% across all doses in pan-FGFR treatment-naïve, FGFR2-fusion cholangiocarcinoma patients & announced anticipated registrational path Progressed & expanded breast cancer portfolio: Continued monotherapy and initiated combination arms in study of PI3Kα inhibitor RLY-2608 & disclosed 3…
Relay Therapeutics: It Could Be Time To ‘Be Greedy When Others Are Fearful’ (NASDAQ:RLAY)
domoyega/E+ via Getty Images Investment Overview – Cash Intensive But Cash Rich – At Current Price Relay Offers The Patient Investor Value I have covered Relay Therapeutics (NASDAQ:RLAY) several times for Seeking Alpha since the company completed what was, at the time, the third largest biotech IPO in history, raising…
integration using rPCA with reference or without it?
integration using rPCA with reference or without it? 0 Hello all, I have decided to integrate my single cell dataset using rPCA rather than CCA because I thought using CCA overcorrect my dataset. I know there is two approaches using rPCA: to use references in “FindIntegrationAnchors” function and the reason…
Python 01 in Bioinformatics | Processing Gene Sequences from Scratch
1. Download of sequence data When we start to understand the processing flow of the sequence, we first need to know the sequence download URL. One of the well-known websites is NCBI (National Center for Biotechnology Information) US National Center for Biotechnology Information. 1. Enter NCBI through the following website,…
A CRISPR/Cas12a-assisted array for Helicobacter pylori DNA analysis in saliva
. 2023 Jan 25;1239:340736. doi: 10.1016/j.aca.2022.340736. Epub 2022 Dec 23. Affiliations Expand Affiliations 1 Department of Health Inspection and Quarantine, School of Public Health, Fujian Medical University, Fuzhou, Fujian, 350122, PR China. 2 College of Chemistry, Key Laboratory of Analysis and Detecting Technology, Food Safety MOE, Fuzhou University, Fuzhou, 350002,…
Kinnate’s CCA therapy KIN-3248 receives FDA Fast Track status
Micrograph of cholangiocarcinoma. Credit: Nephron / Wikimedia. Kinnate Biopharma has received Fast Track designation from the US Food and Drug Administration (FDA) for its pan-FGFR inhibitor, KIN-3248, to treat unresectable, locally advanced or metastatic cholangiocarcinoma (CCA). KIN-3248 is indicated to treat CCA harbouring fibroblast growth factor receptor 2 (FGFR2) gene…
Potential Roles of mtDNA Mutations in PCOS-IR
Introduction Polycystic ovary syndrome (PCOS) is the most common endocrine disease occurring during reproductive years. It was a kind of endocrine and metabolic disorders that results in obesity, irregularity of menstruation, OS, hyperinsulinemia, hyperandrogenism, infertility, and sterility.1,2 First identified in 1935, PCOS was also recognized as Stein–Leventhal syndrome.3 Diagnosis of…
Multivariate data analysis with R and vegan
News:course – Multivariate data analysis with R and vegan 0 Hi all, registration is now open for the 2nd edition of the course “Multivariate data analysis with R and vegan“. Dates: online, April, 24-28 This course will offer participants a practical introduction to some of the most useful functions available…
nf-core/circrna: a portable workflow for the quantification, miRNA target prediction and differential expression analysis of circular RNAs | BMC Bioinformatics
Sanger HL, Klotz G, Riesner D, Gross HJ, Kleinschmidt AK. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. Proc Natl Acad Sci. 1976;73(11):3852–6. doi.org/10.1073/pnas.73.11.3852. Article CAS Google Scholar Arnberg AC, Van Ommen G-JB, Grivell LA, Van Bruggen EFJ, Borst P. Some yeast mitochondrial RNAs…
Evaluation of automated techniques for extraction of circulating cell-free DNA for implementation in standardized high-throughput workflows
Huebner, H. et al. Filtration based assessment of CTCs and Cell Search® based assessment are both powerful predictors of prognosis for metastatic breast cancer patients. BMC Cancer 18, 204. doi.org/10.1186/s12885-018-4115-1 (2018). Article Google Scholar Banys-Paluchowski, M., Krawczyk, N. & Fehm, T. Liquid biopsy in breast cancer. Geburtshilfe Frauenheilkd 80, 1093–1104….
Breadth of SARS-CoV-2 neutralization and protection induced by a nanoparticle vaccine
Animals and immunizations The study protocol and all veterinarian procedures were approved by the Bioqual IACUC per a memorandum of understanding with the Duke IACUC, and were performed based on standard operating procedures. Macaques studied were housed and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited…
Inferring and perturbing cell fate regulomes in human brain organoids
Experimental methods Stem cell and organoid culture We used six human iPS cell lines (Hoik1, Wibj2, Kucg2 from the HipSci resource47; 409B2 from the RIKEN BRC cell bank; 01F49i-N-B7 (B7) from Institute of Molecular and Clinical Ophthalmology Basel; and WTC from the Allen Institute) and three human ES cell lines (H1-PAX6YFP…
A Phase 3, Open-Label, Randomized Study of Futibatinib Versus Gemcitabine-Cisplatin Chemotherapy as First-Line Treatment of Patients with Advanced Cholangiocarcinoma Harboring FGFR2 Gene Rearrangements
Official Trial Title A phase 3, open-label, randomized study of futibatinib versus germcitabine-cisplatin chemotherapy as first-line treatment of patients with advanced cholagiocarcinoma harboring FGFR2 gene rearrangements (FOENIX-CCA3) Study Description The University of Virginia is participating in a global clinical research study for adults ages 18 years of age, and over…
Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3
In vitro reconstitution of Escherichia coli CRISPR-Cas3 interference E. coli CRISPR-Cas3 is generally well-characterized type I CRISPR complexes in vitro and in vivo32,33,37,38. However, recombinant EcoCas3 protein is difficult to purify because of poor solubility and propensity to aggregate at 37 °C25,26,30,39. Co-expression of HtpG chaperon40 and/or low temperature growth at…
Live-seq enables temporal transcriptomic recording of single cells
Biological materials RAW264.7, 293T and HeLa cells were obtained from ATCC. RAW264.7 cells with Tnf-mCherry reporter and relA-GFP fusion protein (RAW-G9 clone) were kindly provided by I.D.C. Fraser (National Institutes of Health). The IBA cell line derived from the stromal vascular fraction of interscapular brown adipose tissue of young male…
between results of RNAseq and absence/presence of Type3 Secretion System
Correlation between two different datasets: between results of RNAseq and absence/presence of Type3 Secretion System 1 Dear All, I have a “How would you solve” kind of question. I have two sets of tables : 1. Log2FoldChange table and 2. Effectors Table. Firstly, the Log2FoldChange table was obtained by performing…
(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData
(Single-cell RNA seq; R – Seurat) Re-clustering after removing cells using SubsetData 0 I have a question regarding re-clustering after removing cells using SubsetData (R – Seurat package). I am in the process of analyzing a relatively large single-cell dataset (16 separate samples of ~5-10k cells each). In our first…
C698R mutation in Lrsam1 gene impairs nerve regeneration in a CMT2P mouse model
Animal generation The Lrsam1C698R knock-in mice were generated on a C57Bl/6J background using the CRISPR/Cas9 technique. Briefly, single-cell zygotes from C57BL/6J mice were microinjected with mRNA encoding Cas9 and a guide sequence (5′-ACAGCAGCAGACGTGGCCAC-3′ at 20 ng/µl) to target the exon 26 of Lrsam1. A single stranded DNA oligo carrying the C698R mutation…
Single-cell analyses define a continuum of cell state and composition changes in the malignant transformation of polyps to colorectal cancer
Mapping molecular changes across malignant transformation We generated single-cell data for 81 samples collected from eight FAP and seven non-FAP donors (Fig. 1a and Supplementary Tables 1 and 2). For each tissue, we performed matched scATAC-seq and snRNA-seq (10x Genomics). We obtained high-quality single-cell chromatin accessibility profiles for 447,829 cells…
Helsinn Expands US R&D Capabilities on Heels of BridgeBio Licensing Deal
Helsinn Group is expanding its global research and development capacity with the launch of a new dedicated hub in the U.S. The new R&D facility is a product of Helsinn’s new licensing deal with BridgeBio and will operate under Helsinn Therapeutics (U.S.). It will be instrumental in furthering the company’s projected increase in clinical activities to…
tReasure: R-based GUI package analyzing tRNA expression profiles from small RNA sequencing data | BMC Bioinformatics
tReasure (tRNA Expression Analysis Software Utilizing R for Easy use) is a graphical user interface (GUI) tool for the analysis of tRNA expression profiles from deep-sequencing data of small RNAs (small RNA-seq) using R packages. The whole analysis workflow, including the uploading of FASTQ files of small RNA-seq, quantification of…
Solved 28) What structure below provides an “anticodon”?
Transcribed image text: 28) What structure below provides an “anticodon”? (2pts) OmicroRNA mRNA tRNA rRNA 29) Which of the following modifications is involved in the 3′ (three prime) end-processing of pre- (4pts) mRNA precursors in eukaryotic cells? Addition of a methlyguanosine cap Splicing out introns Addition of Poly-A tail Forming…
Metagenomics technology and microbial community diversity analysis methods
A large number of microorganisms in nature cannot be cultivated under laboratory conditions by pure culture methods, and the technical methods of traditional microbiology limit the research on environmental microorganisms. The rapid development of high-throughput omics technology has enabled humans to have an unprecedented understanding of the complex microbial communities…
Helsinn Group and BridgeBio Pharma Announce Update to Strategic Collaboration to Develop, Manufacture and Commercialize Infigratinib in Oncology Indications in the U.S.
Lugano, Switzerland and Palo Alto, CA – Helsinn Group (Helsinn), a fully integrated, global biopharma company with a diversified pipeline of innovative oncology assets and strong track-record of commercial execution, and BridgeBio Pharma, Inc. (Nasdaq: BBIO) (BridgeBio), a commercial-stage biopharmaceutical company that focuses on genetic diseases and cancers, announced an…
Identification of Hub Genes Associated with COPD Through Integrated Bi
Introduction Chronic obstructive pulmonary disease (COPD) will become the third leading cause of death worldwide.1,2 The incidence of COPD worldwide is 13.1%3 and is 13.7% in the Chinese population over 40 years of age.4 Emphysema is one of the most common phenotypes.1 Over the past few decades, we have conducted…
scrnaseq – Integrating scRNA-seq data using raw data
I believe when you say alignment, you mean aligning reads to a genome (sometimes to transcriptome) and count these to get count matrices. In the aforementioned paper, however, what is meant is “bringing different data sets to a level where they can be compared/integrated/…”. Basically scRNA-seq data are heavily prone…
The Evolving Treatment Landscape of Cholangiocarcinoma
Recent genomic profiling studies revealed that approximately 40% of patients with biliary tract cancers harbor actionable genomic mutations. The advances in the understanding and characterization of biliary tract cancers (BTCs), particularly intrahepatic cholangiocarcinoma (iCCA), and genomic profiling over the past decade have led to a rapid expansion of available treatment…
Summer Research Assistant/Associate, Center for Computational Biology
Tremendous opportunities for discovery have emerged in the biological sciences, requiring the combined power of theory, data analysis, and simulation. Researchers are being confronted by an explosion of information from genome sequencing, gene expression profiling, proteomics, electron microscopy and tomography, and multiple high-resolution imaging modalities both dynamic and static. The…
Mutational Analysis of Mitochondrial tRNA Genes
Introduction Diabetes is a very complex disease characterized by the presence of chronic hyperglycemia. Clinically, insulin-dependent type 1 and non-insulin-dependent type 2 are the main types of diabetes. Among them, type 2 diabetes mellitus (T2DM, [MIM125853]) is a common endocrine disorder affecting approximately 10% of adult population.1 In most cases,…
Gene mutation analysis in papillary thyroid carcinoma
Introduction Thyroid tumors are the most common malignant tumors of the endocrine system, and their incidence has been increasing in the recent decades. Currently, there are some target drugs that can effectively treat PTC, and next-generation sequencing (NGS) can be used for targeted therapy. In order to make better informed…