Tag: CD-HIT

Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article  CAS  PubMed  Google Scholar  Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article  CAS  PubMed  Google Scholar  Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….

Ethics and animal welfare statement All infectious work with RESTV, including sample inactivation, was performed in the Containment Level 4 laboratory (CL4) in accordance with the policies and protocols outlined by the Canadian Science Centre for Human and Animal Health Institutional Biosafety Committee. All animal work was performed in strict…

Introduction Brucellosis is a zoonotic disease caused by Brucella spp., a gram-negative facultative intracellular coccobacillus.1 These microorganisms can infect livestock, wildlife, and humans, causing significant public concern and substantial agricultural economic loss. Currently, at least six novel Brucella species have been identified: Brucella pinnipedialis, Brucella ceti,2 Brucella papionis,3 Brucella microti,4…

Otto, S. P. & Whitton, J. Polyploid incidence and evolution. Annu. Rev. Genet. 34, 401–437 (2000). Article  CAS  PubMed  Google Scholar  Van de Peer, Y., Maere, S. & Meyer, A. The evolutionary significance of ancient genome duplications. Nat. Rev. Genet. 10, 725–732 (2009). Article  PubMed  Google Scholar  Comai, L. The…

Putnam, N. H. et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 317, 86–94 (2007). Article  ADS  CAS  PubMed  Google Scholar  Chapman, J. A. et al. The dynamic genome of Hydra. Nature 464, 592–596 (2010). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Srivastava, M….

Steffen, W. et al. Planetary boundaries: guiding human development on a changing planet. Science 347, 1259855 (2015). Article  PubMed  Google Scholar  Kanter, D. R. et al. Nitrogen pollution policy beyond the farm. Nat. Food 1, 27–32 (2020). Article  ADS  Google Scholar  Tian, H. et al. A comprehensive quantification of global…

Hammad, M. et al. A novel end-to-end deep learning approach for cancer detection based on microscopic medical images. Biocybern. Biomed. Eng. 42(3), 737–748 (2022). Article  Google Scholar  Hammad, M. et al. Efficient multimodal deep-learning-based covid-19 diagnostic system for noisy and corrupted images. J. King Saud Univ.-Sci. 34(3), 101898 (2022). Article …

Transcript Assembly for Multiple Species Using StringTie and Orthogroup Discovery using OrthoFinder 0 Hi all, I am running a workflow to identify single copy orthogroups from RNAseq data including 9 species in a family of non-model organisms. All 9 species are closely related enough that they can be aligned to…

Van Valen, L. A new evolutionary law. Evol. Theory 1, 1–30 (1973). Google Scholar  Woolhouse, M. E. J., Webster, J. P., Domingo, E., Charlesworth, B. & Levin, B. R. Biological and biomedical implications of the co-evolution of pathogens and their hosts. Nat. Genet. 32, 569–577 (2002). Article  CAS  PubMed  Google…

Commission, S. P. Pharmacopoeia of the People’s Republic of China (Pharmacopoeia of the People’s Republic of China, 2020). Google Scholar  Sun, X. & Sun, F. Shennong Materia Medica Classic (People’s Health Publishing House, 1963). Google Scholar  Huang, C. Flora of China Vol. 43 (Science Press, 1997). Google Scholar  Hu, J….

Fierer, N. & Jackson, R. B. The diversity and biogeography of soil bacterial communities. Proc. Natl. Acad. Sci. USA. 103, 626–631 (2006). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Gao, C. & Guo, L. Progress on microbial species diversity, community assembly and functional traits. Biodivers. Sci. 30, 22429 (2022)….

Murray, C. J. et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399, 629–655 (2022). Article  CAS  Google Scholar  Brito, I. L. et al. Mobile genes in the human microbiome are structured from global to individual scales. Nature 535, 435–439 (2016). Article  ADS  CAS  PubMed …

Egan, E. S., Fogel, M. A. & Waldor, M. K. Divided genomes: negotiating the cell cycle in prokaryotes with multiple chromosomes. Mol. Microbiol. 56, 1129–1138 (2005). Article  CAS  PubMed  Google Scholar  Harrison, P. W., Lower, R. P., Kim, N. K. & Young, J. P. Introducing the bacterial ‘chromid’: not a…

Sheridan, P. O. et al. Gene duplication drives genome expansion in a major lineage of Thaumarchaeota. Nat. Commun. 11, 1–12 (2020). Article  Google Scholar  Sheridan, P. O., Meng, Y., Williams, T. A. & Gubry-Rangin, C. Recovery of Lutacidiplasmatales archaeal order genomes suggests convergent evolution in Thermoplasmatota. Nat. Commun. 13, 1–13…

Abstract Bacterial infections often involve virulence factors that play a crucial role in the pathogenicity of bacteria. Accurate detection of virulence factor genes (VFGs) is essential for precise treatment and prognostic management of hypervirulent bacterial infections. However, there is a lack of rapid and accurate methods for VFG identification from…

Nematode materials and species identification Mi, Mj, and Mg were collected from farmlands in Wuhan city of Hubei province, Longyan city of Fujian province, and Changsha city of Hunan Provinces, respectively. Two Ma samples were collected from farmlands in Shenyang city of Liaoning province and Shiping city of Yunnan province….

Introduction The non-random packaging of chromatin within the nucleus is a universal feature of eukaryotic genomes. The three-dimensional (3D) spatial organization of chromatin could be partitioned at different levels based on the interaction frequency between two given loci in the genome. Advances in sequencing technologies have led to the identification…

Isolation of phyllosphere isolates All bacterial strains were isolated in June 2021 from the flag leaves of four wheat cultivars (Sheriff, Heerup, Rembrandt and Kvium) grown in an experimental field in Høje Taastrup, near Copenhagen, Denmark. Wheat flag leaves were picked, pooled, and either washed or blended prior to dilution…

Cloning Supplementary Table 1 shows the synthetic gene, DNA and RNA oligonucleotide sequences used in this study. The synthetic genes encoding B.fragilis Cas6, CorA, NrN and C. botulinum SAM lyase purchased as g-blocks (IDT) were codon-optimized for expression in E. coli C43 (DE3) via the vector pEhisV5TEV, which encodes eight…

Zhang L, Wang F, Wang L, Wang W, Liu B, Liu J, Chen M, He Q, Liao Y, Yu X, et al. Prevalence of chronic kidney disease in China: a cross-sectional survey. Lancet. 2012;379:815–22. Article  PubMed  Google Scholar  Collaboration GBDCKD. Global, regional, and national burden of chronic kidney disease, 1990–2017:…

We have developed a comprehensive pipeline to extract pseudo-barcode regions from raw sequencing data. All of the extracted data is then utilized for subsequent clustering and demultiplexing. In regard to the extracted pseudo-barcode regions, HycDemux integrates an unsupervised hybrid approach to achieve accurate and efficient clustering, in which the nucleotides-based…

Siguier, P., Gourbeyre, E., Varani, A., Ton-Hoang, B. & Chandler, M. Everyman’s guide to bacterial insertion sequences. Microbiol. Spectr. 3, MDNA3-0030-2014 (2015). Article  PubMed  Google Scholar  He, S. et al. The IS200/IS605 family and “peel and paste” single-strand transposition mechanism. Microbiol. Spectr. 3, MDNA3-0039-2014 (2015). Article  ADS  Google Scholar  Kapitonov,…

How to sort cd-hit-est cluster file 1 I have a cluster file from cd-hit-est having thousands of clusters and one of the cluster look like this: >Cluster 1 0 22nt, >4972_98_CAATTGCAGCGACGCGCCCATT… * 1 21nt, >2017_373_CGGTGCAGCGACGCGCCCATT… at +/85.71% 2 21nt, >6627_68_CAGTGCAACGACGCGCCCATT… at +/85.71% 3 21nt, >3668_146_CAGTGCGGCGACGCGCCCATT… at +/85.71% 4 21nt, >17_8379_CAGTGCAGCGACGCGCCCATT……

I have a code that processes the cd-hit-est cluster file. The code looks like this: #!/usr/bin/awk -f />Cluster/{ getline a=$3 b=$3 gsub(/[.]/,””,a) gsub(/[>0-9_.]/,””,b) print a “\n” b } One of the clusters in cluster file looks like this >Cluster 9 0 22nt, >35067_10_CCAATTCACTTGTCCCGCCCCC… * 1 21nt, >2636_236_CCACCACTTGTCCCGCCCCCC… at +/85.71% 2…

Cultivations and harvest Cupriavidus necator strain DSMZ 428 was grown in Ralstonia Minimal Media (RMM) with 100 mM HEPES pH 7.5 under chemostat conditions in a Photon Systems Instruments Multi-Cultivator MC-1000 OD. Each reactor tube was set up to a volume of 55 mL, OD600 0.05 and 3.5 g/L fructose. Once growth ceased,…

Brocks, J. J. et al. The rise of algae in Cryogenian oceans and the emergence of animals. Nature 548, 578–581 (2017). Article  ADS  CAS  PubMed  Google Scholar  Leliaert, F. Green algae: Chlorophyta and Streptophyta. In Encyclopedia of microbiology 457–468 (Academic Press, 2019). Zhang, Z. et al. Origin and evolution of…

How to predict/annotate whether some type strains has a certain type of enzyme? 0 Hello, While it might be a naive question, but I really need your help if possible. I want to predict whether some type strains (like Methanofollis liminatans GKZPZ) has a certain type of enzyme (anaerobic carbon-monoxide…

Joye, S. B. The geology and biogeochemistry of hydrocarbon seeps. Annu. Rev. Earth Pl. Sci. 48, 205–231 (2020). Article  ADS  CAS  Google Scholar  Al-Shayeb, B. et al. Borgs are giant genetic elements with potential to expand metabolic capacity. Nature 610, 731–736 (2022). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar …

Lin Q, De Vrieze J, Li C, Li J, Li J, Yao M, et al. Temperature regulates deterministic processes and the succession of microbial interactions in anaerobic digestion process. Water Res. 2017;123:134–43. Article  CAS  PubMed  Google Scholar  Coban O, De Deyn GB, van der Ploeg M. Soil microbiota as game-changers…

Study participants and data collection The study participants were recruited from 2014 to 2016 during their annual health check-ups at the University of Tokyo Hospital. The individuals included both male and female Japanese individuals aged from 20 to 75 years. The exclusion criteria were as follows: established diagnosis of diabetes,…

Hi, I’m trying to install provean and use it on my local machine. I get the following error. error: BLAST database name is missing. Please edit provean.sh file to add the name. I am configuring provean by this command line: ./configure –prefix=/home/elham123456/linux/provean-1.1.5 PSIBLAST=/home/elham123456/linux/provean-1.1.5/ncbi-blast-2.14.0+/bin/psiblast BLASTDBCMD=/home/elham123456/linux/provean-1.1.5/ncbi-blast-2.14.0+/bin/blastdbcmd CDHIT=/home/elham123456/linux/provean-1.1.5/cd-hit/bin/cd-hit BLAST_DB=/home/elham123456/linux/provean-1.1.5/nr_sep_2012/nr and it is my…

Shrivastava, A. K. & Srivastava, S. Sugarcane: Physiological and molecular approaches for improving abiotic stress tolerance and sustaining crop productivity. (ed. Narendra Tuteja et al.) 885–992 (Wiley Blackell, Weinheim, 2012). Reyes, J. A. O., Casas, D. E., Gandia, J. L. & Delfin, E. F. Agricultural Research Updates Vol. 35 (ed…

Klepzig KD, Adams AS, Handelsman J, Raffa KF. Symbioses: a key driver of insect physiological processes, ecological interactions, evolutionary diversification, and impacts on humans. Environ Entomol. 2009;38:67–77. CAS  PubMed  Google Scholar  Dale C, Moran NA. Molecular interactions between bacterial symbionts and their hosts. Cell. 2006;126:453–65. CAS  PubMed  Google Scholar  Salem…

Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67 (2010). Article  CAS  PubMed  Google Scholar  Andersson, A. F. & Banfield, J. F. Virus population dynamics and acquired virus resistance in natural microbial communities. Science 320, 1047–1050 (2008). Article  CAS  PubMed  Google…

Introduction SARS-CoV-2 is the most lethal virus among all human coronavirus (HCoV) and is responsible for causing severe respiratory tract infections.1,2 It was first reported in Wuhan, China, at the end of December 200193–5 and found to be highly transmissible (Basic reproduction number ranging from 0.9 to 6.53).4,6 The genome…

Psyllid sampling, tissue collection and DNA isolation Adult D. citri newly emerged (five days old) was initially harvested from Citrus Tachibana uninfected CLas in 2020 at Guangxi province, China, and was successively reared on Murraya paniculata at Guangxi Special Crops Research Institute for more than 15 generations. All cages and…

Frequency of a unique sequence in a fasta file 4 Hi, I have a FASTA file containing sequences with id as header . The header for all sequence are unique but some sequences are similar to each other. (all.fasta) To get a FASTA file of unique sequences, I used gt-sequniq…

Formenti, G. et al. The era of reference genomes in conservation genomics. Trends Ecol. Evol. 37, 197–202 (2022). Article  CAS  PubMed  Google Scholar  Lee, H. et al. Third-generation sequencing and the future of genomics. bioRxiv, 048603 (2016). Irestedt, M. et al. A guide to avian museomics: Insights gained from resequencing…

CDHIT para and cdhit slow speed 1 I am writing to seek assistance regarding the usage of CD-HIT software for clustering a dataset of 135,000 nucleotide sequences. Currently, I am working on a cluster with 16 CPUs, and the maximum time limit available on this cluster is one week. I…

Chang, E. S. et al. Genomic insights into the evolutionary origin of Myxozoa within Cnidaria. Proc. Natl Acad. Sci. USA 112, 14912–14917 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  Boero, F. et al. Inconsistent Evolution and Paedomorphosis among the Hydroids and Medusae of the Athecatae/Anthomedusae and the Thecatae/Leptomedusae (Cnidaria,…

Billings, W. Adaptations and origins of alpine plants. Arct. Alp. Res. 6, 129–142 (1974). Article  Google Scholar  Agakhanjanz, O. & Breckle, W. Origin and evolution of the mountain flora in middle Asia and neighbouring mountain regions. in Arctic and Apine Biodiversity: Patterns, Causes and Ecosystem Consequences (eds. Chapin, F. &…

Booth, B. C. & Marchant, H. J. Parmales, a new order of marine chrysophytes, with desriptions of three new genera and seven new species. J. Phycol. 23, 245–260 (1987). Article  Google Scholar  Ichinomiya, M. et al. Diversity and oceanic distribution of the Parmales (Bolidophyceae), a picoplanktonic group closely related to…

Conway Morris, S. The predictability of evolution: glimpses into a post-Darwinian world. Naturwissenschaften 96, 1313–1337 (2009). Article  ADS  CAS  PubMed  Google Scholar  Stern, D. L. The genetic causes of convergent evolution. Nat. Rev. Genet. 14, 751–764 (2013). Article  CAS  PubMed  Google Scholar  Christiansen, K. Convergence and parallelism in cave entomobryinae….

Lughadha, E. N. et al. Counting counts: revised estimates of numbers of accepted species of flowering plants, seed plants, vascular plants and land plants with a review of other recent estimates. Phytotaxa 272, 82–88 (2016). Article  Google Scholar  Group, A. P. An update of the Angiosperm Phylogeny Group classification for…

Purohit, J., Kumar, A., Hynniewta, M. & Satyawada, R. R. Karyomorphological studies in guar (Cyamopsis tetragonoloba (Linn.) Taub.)—An important gum yielding plant of Rajasthan, India. Cytologia 76(2), 163–169 (2011). Article  Google Scholar  Gillett, J. B. Indigofera (Microcharis) in tropical Africa with the related genera Cyamopsis and Rhynchotropis. H.M.S.O Kew Bull.,…

Alexander DH, Lange K (2011) Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC Bioinforma 12:246. doi.org/10.1186/1471-2105-12-246 Article  Google Scholar  Anderegg WRL, Flint A, Huang C-Y, Flint L, Berry JA, Davis FW et al. (2015) Tree mortality predicted from drought-induced vascular damage. Nat Geosci 8:367–371 Article  CAS  Google Scholar …

Revsbech, N. P. et al. Determination of ultra-low oxygen concentrations in oxygen minimum zones by the STOX sensor. Limnol. Oceanogr.: Methods. 7, 371-381. (2009). Wright, J. J., Konwar, K. M. & Hallam, S. J. Microbial ecology of expanding oxygen minimum zones. Nat. Rev. Microbiol. 10, 381–394 (2012). Article  CAS  PubMed …

Data sets To create data sets of sequences corresponding to compartments of photosynthetic plastids, we searched the UniProt database for proteins annotated as localized in the chloroplast. Importantly, the UniProt keyword ’Chloroplast’ includes not only chloroplasts of green algae and land plants but also plastids of Rhodophyta, haptophytes and the…

Bowtie2 alignment on metagenomics – sum same sequence 0 Hello, I have multiple metagenomic assemblies. I have obtained the ffn file of the orfs, then merged them together and clustered them using cd-hit-est. when I use bowtie2 to map these sequences against reads, bowtie2 records multiple mappings (as it should)…

Whitman, W. B., Coleman, D. C. & Wiebe, W. J. Prokaryotes: the unseen majority. Proc. Natl Acad. Sci. USA 95, 6578–6583 (1998). Article  CAS  PubMed  PubMed Central  Google Scholar  Herndl, G. J. & Reinthaler, T. Microbial control of the dark end of the biological pump. Nat. Geosci. 6, 718–724 (2013)….

de La Torre, S., Snowdon, C. T. & Bejarano, M. Effects of human activities on wild pygmy marmosets in Ecuadorian Amazonia. Biol. Conserv. 94, 153–163 (2000). Article  Google Scholar  Turvey, S. T. & Crees, J. J. Extinction in the Anthropocene. Curr. Biol. 29, R982–R986 (2019). Article  CAS  PubMed  Google Scholar …

Ma, Y. et al. Gut microbiota adaptation to high altitude in indigenous animals. Biochem. Biophys. Res. Commun. 516, 120–126 (2019). Article  CAS  PubMed  Google Scholar  Guo, N. et al. Seasonal dynamics of diet-gut microbiota interaction in adaptation of yaks to life at high altitude. NPJ Biofilms Microbiomes 7, 38 (2021)….

Vincent, F., Sheyn, U., Porat, Z., Schatz, D. & Vardi, A. Visualizing active viral infection reveals diverse cell fates in synchronized algal bloom demise. Proc. Natl Acad. Sci. USA 118, e2021586118 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  Suttle, C. A. Marine viruses — major players in the global…

Blume-Werry G, Krab EJ, Olofsson J, Sundqvist MK, Väisänen M, Klaminder J. Invasive earthworms unlock arctic plant nitrogen limitation. Nat Commun. 2020;11:1766. Article  CAS  PubMed  PubMed Central  Google Scholar  Xing Y, Meng X, Wang L, Zhang J, Wu Z, Gong X, et al. Effects of benzotriazole on copper accumulation and…

Ahsan, D. A., Naser, M. N., Bhaumik, U., Hazra, S. & Bhattacharya, S. B. Migration, Spawning Patterns and Conservation of Hilsa Shad (Tenualosa ilisha) in Bangladesh and India. Publ. by Acad. Found. India, New Delhi Int. Union Conserv. Nat. Nat. Resour. 95 (2014). De, D. et al. Nutritional profiling of…

van Giesen, L., Kilian, P. B., Allard, C. A. H. & Bellono, N. W. Molecular basis of chemotactile sensation in octopus. Cell 183, 594–604.e14 (2020). Article  PubMed  PubMed Central  Google Scholar  Noviello, C. M. et al. Structure and gating mechanism of the α7 nicotinic acetylcholine receptor. Cell 184, 2121–2134 (2021)….

Handa IT, Aerts R, Berendse F, Berg MP, Bruder A, Butenschoen O, et al. Consequences of biodiversity loss for litter decomposition across biomes. Nature. 2014;509:218–21. Article  CAS  PubMed  Google Scholar  Roux S, Adriaenssens EM, Dutilh BE, Koonin EV, Kropinski AM, Krupovic M, et al. Minimum information about an uncultivated virus…

Suttle, C. A. Environmental microbiology: Viral diversity on the global stage. Nat. Microbiol. 1, 16205 (2016). Article  CAS  PubMed  Google Scholar  Schulz, F. et al. Giant virus diversity and host interactions through global metagenomics. Nature 578, 432–436 (2020). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Dutilh, B. E., Reyes,…

O’Neill J. The Review on Antimicrobial Resistance—tackling drug-resistant infections globally: final report and recommendations. 2016. Murray CJ, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. The Lancet. 2022;399:629–55. Article  CAS  Google Scholar  Laxminarayan R….

1. Introduction Fusarium fungi are world-wide producers of a range of mycotoxins. Deoxynivalenol (DON) belonging to the group B trichothecenes, is one of the most prevalent food-associated mycotoxins mainly produced by Fusarium graminearum and Fusarium culmorum, and frequently contaminates cereals and cereal products [1,2]. Almost half of a total of…

Pruesse, E. et al. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 35, 7188–7196 (2007). Article  CAS  PubMed  PubMed Central  Google Scholar  Glöckner, J. et al. Phylogenetic diversity and metagenomics of candidate division OP3. Environ. Microbiol. 12, 1218–1229…

Big BCV (Biological Coefficient of Variation) – no sense to continue the analysis of differential gene expression? 2 Is it possible to perform differential gene expression analysis on data with such dispersion, BCV and MDSplot? (Fig. A, B) y_disp_design <- estimateDisp(y_filtered, design = design) y_disp_design$common.dispersion 0.3251901 Is it possible to…

doi: 10.1093/nar/gkad158. Online ahead of print. Affiliations Expand Affiliations 1 Department of Computer Science, University of Maryland, College Park, 20742 MD, USA. 2 Center for Bioinformatics and Computational Biology, University of Maryland, College Park, MD 20742, USA. Item in Clipboard Tu Luan et al. Nucleic Acids Res. 2023. Show details Display options Display…

Pangenome: Gene presence and absence analysis 1 Hello. I would like to have an idea for gene presence and absence determination for pangenome analysis. I have built a pangenome from several yeast strains of interest by merging each CDS and eliminate the redundantly using CD-HIT. Then, I mapped Illumina reads…

Recombinant peptide production Recombinant expression of Xt3a, Xt3a-D1, Xt3a-D2 and IpTxA was performed using an E. coli expression system. A gene encoding the peptide was subcloned into an expression vector containing a coding region with poly-histidine purification tag as well as a solubility tag (MBP for Xt3a and SUMO for…

Rinke C, Schwientek P, Sczyrba A, Ivanova NN, Anderson IJ, Cheng J-F, et al. Insights into the phylogeny and coding potential of microbial dark matter nature. Nat Publ Group. 2013;499:431–7. CAS  Google Scholar  Brown CT, Hug LA, Thomas BC, Sharon I, Castelle CJ, Singh A, et al. Unusual biology across…

Zhang J, Liu Y, Zhang N, Hu B, Jin T, Xu H, et al. NRT1.1B is associated with root microbiota composition and nitrogen use in field-grown rice. Nat Biotechnol. 2019;37:676–84. Article  CAS  PubMed  Google Scholar  Philippot L, Raaijmakers JM, Lemanceau P, van der Putten WH. Going back to the roots:…

This research complies with all relevant ethical regulations approved by the Human Investigation Review Board of Albert Szent-Györgyi Clinical Centre of the University of Szeged and the National Biodiversity Authority (NBA) of India. Permission for the faecal sample collection was obtained from the Human Investigation Review Board of Albert Szent-Györgyi…

Animal studies Animal care and study protocols were approved by the AAALAC-accredited Institutional Animal Care and Use Committee of the College of Agricultural Life Sciences at the University of Wisconsin-Madison (UW-Madison). All experiments with mice were performed under protocols approved by the UW-Madison Animal Care and Use Committee (Protocol number…

Viral metagenomics is the study of viruses in environmental and biological samples by utilizing next generation sequencing that generates very large data sets. Viral metagenomics analyzes viral sequences to deduce the impact of viruses on the environment of human health. Unlike amplicon sequencing, metagenomics obtains and investigates genetic material directly…

Koonin, E. V. & Dolja, V. V. Virus world as an evolutionary network of viruses and capsidless selfish elements. Microbiol. Mol. Biol. Rev. 78, 278–303 (2014). Article  CAS  Google Scholar  Pritham, E. J., Putliwala, T. & Feschotte, C. Mavericks, a novel class of giant transposable elements widespread in eukaryotes and…

Miyakawa, T., Matsuzawa, H., Matsuhashi, M. & Sugino, Y. Cell wall peptidoglycan mutants of Escherichia coli K-12: existence of two clusters of genes, mra and mrb, for cell wall peptidoglycan biosynthesis. J. Bacteriol. 112, 950–958 (1972). Article  CAS  PubMed  PubMed Central  Google Scholar  Ayala, J. A., Garrido, T., De Pedro,…

Salje, J. Cells within cells: Rickettsiales and the obligate intracellular bacterial lifestyle. Nat. Rev. Microbiol. 19, 375–390 (2021). CAS  PubMed  Article  Google Scholar  Wang, S. & Luo, H. Dating Alphaproteobacteria evolution with eukaryotic fossils. Nat. Commun. 12, 3324 (2021). CAS  PubMed  PubMed Central  Article  Google Scholar  Strassert, J. F. H.,…

Zaremba-Niedzwiedzka, K. et al. Asgard archaea illuminate the origin of eukaryotic cellular complexity. Nature 541, 353–358 (2017). CAS  PubMed  Article  Google Scholar  Williams, T. A., Cox, C. J., Foster, P. G., Szöllősi, G. J. & Embley, T. M. Phylogenomics provides robust support for a two-domains tree of life. Nat. Ecol….

minimum number of protein sequences for a sequence logo 1 Hi, I’m interested in generating sequence logo of a series of defensin related proteins I’ve clustered using CD-Hit. There are aproximately 7600 sequences with about 2500 clusters, but many of them have few sequences per cluster. Which is the minimum…

Name Last modified Size Description Parent Directory   –   Figure1.png 2015-05-05 00:44 43K   Figure2.png 2015-05-05 00:44 42K   Figure3.png 2015-05-05 00:44 129K   Figure4.png 2015-05-05 00:44 30K   cd-hit-est.man 2020-06-16 12:13 5.6K   cd-hit-otu-miseq-Fig..> 2017-03-25 12:00 117K   cd-hit.man 2020-06-16 12:12 4.4K   cdhit-user-guide.pdf 2017-05-01 11:52 412K  …

1. Parte, A. C. LPSN–list of prokaryotic names with standing in nomenclature. Nucleic Acids Res. 42, D613-616 (2014). CAS  PubMed  Google Scholar  2. Krzyściak, W., Pluskwa, K. K., Jurczak, A. & Kościelniak, D. The pathogenicity of the Streptococcus genus. Eur. J. Clin. Microbiol. Infect. Dis. 32, 1361–1376 (2013). PubMed  PubMed…

Serratus alignment architecture Serratus (v0.3.0) (github.com/ababaian/serratus) is an open-source cloud-infrastructure designed for ultra-high-throughput sequence alignment against a query sequence or pangenome (Extended Data Fig. 1). Serratus compute costs are dependent on search parameters (expanded discussion available: github.com/ababaian/serratus/wiki/pangenome_design). The nucleotide vertebrate viral pangenome search (bowtie2, database size: 79.8 MB) reached processing rates…

1. Singh, A. et al. Phytochemical profile of sugarcane and its potential health aspects. Pharmacogn. Rev. 9, 45–54 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Eggleston, G. Positive aspects of cane sugar and sugar cane derived products in food and nutrition. J. Agric. Food Chem. 66, 4007–4012 (2018). CAS …

1. Oh, J. et al. Biogeography and individuality shape function in the human skin metagenome. Nature 514, 59–64 (2014). 2. Byrd, A. L., Belkaid, Y. & Segre, J. A. The human skin microbiome. Nat. Rev. Microbiol. 16, 143–155 (2018). CAS  PubMed  Google Scholar  3. Oh, J. et al. Temporal stability…

How to remove redundant sequences from fasta file ? 0 I’ve fasta file containing nucleotide sequences. How can I remove the redundant sequences?I’m trying to access cd-hit but web server is not available. Is there any other tool available for removing redundancy? I really appreciate any help or suggestion! redundant…

How to get a profile of consistent cd-hit clusters across different sequence files? 0 I have 10 different nucleotide sequence fasta files. I would like to run cd-hit on them and get a cluster abundance profile. If I run the fasta files on cd-hit separately, the clusters will not be…