Categories
Tag: ClinVar
Form 1 ClinVar RCV survey
Download: pdf | pdf ClinVar RCV Page Survey 2022 Start of Block: Default Question Block OMB Approval Info OMB Control Number: 0925-0648 Expiration Date: 06/30/2024 Public reporting burden for this collection of information is estimated to average 5 minutes per response, including the time for reviewing instructions, searching existing data…
Error getting the genome on clinvaR
Error getting the genome on clinvaR 1 Hi, I am trying to use clinvaR following this vignette (here ) but when I try to download and Import 1000 Genomes VCF, I get an error: Cannot open specified tabix file: ftp.1000genomes.ebi.ac.uk/vol1/ftp/release/20130502/ALL.chr15.phase3_shapeit2_mvncall_integrated_v5a.20130502.genotypes.vcf.gz Error in read.table(text = paste(output, collapse = “\n”), header =…
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) AND Lymphoma – ClinVar
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) AND Lymphoma Based on: 1 submission [Details] Record status: current Accession: RCV000790860.7 Allele description NM_000546.6(TP53):c.743G>A (p.Arg248Gln) Gene: TP53:tumor protein p53 [Gene – OMIM – HGNC] Variant type: single nucleotide variant Cytogenetic location: 17p13.1 Genomic location: Preferred name: NM_000546.6(TP53):c.743G>A (p.Arg248Gln) Other names: p.R248Q:CGG>CAG HGVS: NC_000017.11:g.7674220C>T NG_017013.2:g.18331G>A NM_000546.6:c.743G>AMANE SELECT NM_001126112.3:c.743G>A…
Unlocking the human genome: Innovative machin
image: LoGoFunc identifies harmful (left) and harmless (right) genetic variations in the Vasopressin V2 receptor protein using a structure predicted by AlphaFold2. This helps explain how genetic changes affect proteins. view more Credit: Stein et al., Genome Medicine New York, NY [December 14, 2023]—In a novel study, researchers from the…
Genetic basis of osteogenesis imperfecta from a single tertiary centre in South Africa
We used ES, gene panel testing, and a single variant test to achieve a diagnostic yield of 100% for patients with OI in this study. The patient demographic is representative of the Western Cape Province, with Tygerberg Hospital being the largest tertiary referral centre in the province. Since it is…
Discrepancy between the downloaded clinvar, dbNSFP and website
Discrepancy between the downloaded clinvar, dbNSFP and website 0 Hi All, I encountered discrepancies in clinvar annotations, leading to inconsistencies: Discrepancies between locally downloaded datasets from clinvar and dbNSFP_CLINSIG and their respective web versions were noted. For instance, the variant (chr2:21006288:C:A) was labeled as Pathogenic in the downloaded datasets but…
Indigenous Australian genomes show deep structure and rich novel variation
Inclusion and ethics The DNA samples analysed in this project form part of a collection of biospecimens, including historically collected samples, maintained under Indigenous governance by the NCIG11 at the John Curtin School of Medical Research at the Australian National University (ANU). NCIG, a statutory body within ANU, was founded…
Bioinformatics Engineer – Lifelancer | Career Page
What you will do Work with other engineers and scientists to build Isos platform, applying AI to biological systems. Design, develop and maintain bioinformatics pipelines for the ingestion, management and analysis of biological datasets, especially -omics, imaging, and clinical data. Perform data analysis and data quality assurance according to best…
GenomeConnect | LinkedIn
GenomeConnect is an online patient registry where individuals can securely share their genetic and health information. This information is shared with databases such as ClinVar and can be used by researchers and healthcare providers to better understand the relationship between genetics and health. GenomeConnect also gives participants the option to…
Criteria for better assessment of rare genetic variants that can lead to hereditary colorectal cancer
APC gene, APC protein, and criteria boundaries and genotype-phenotype correlations. Representation of the APC gene (bottom) and its main protein product (middle) on the reference sequence NM_000038.6 (non-coding exon 1 not shown). The figure shows on the top the boundaries for the application of PVS1, BS3 and BP1 and genotype-phenotype…
ClinVar and DGV
Hello, we are using UCSC in micro array reading support to help us evaluate CNVs but, this morning, the DGV and ClinVar databases have disappeared. The cause of this is an update and then everything will go back to the way it was before or will it stay that way…
Human hg38 chr6:31,165,200-31,165,800 UCSC Genome Browser v457
Custom Tracks ac4C-RIP-seq peaks, hESC CTL-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC CTL-2hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-2hidedensesquishpackfull Mapping and Sequencing Base Positionhidedensefull p14 Fix Patcheshidedensesquishpackfull p14 Alt Haplotypeshidedensesquishpackfull Assemblyhidedensesquishpackfull Centromereshidedensesquishpackfull Chromosome Bandhidedensesquishpackfull Clone Endshidedensesquishpackfull Exome Probesetshidedensesquishpackfull FISH Cloneshidedensesquishpackfull Gaphidedensesquishpackfull GC Percenthidedensefull GRC Contigshidedensefull GRC Incidenthidedensesquishpackfull Hg19…
NM_000391.4(TPP1):c.379C>T (p.Arg127Ter) AND Angelman syndrome – ClinVar
NM_000391.4(TPP1):c.379C>T (p.Arg127Ter) AND Angelman syndrome Based on: 1 submission [Details] Record status: current Accession: RCV001804926.2 Allele description [Variation Report for NM_000391.4(TPP1):c.379C>T (p.Arg127Ter)] NM_000391.4(TPP1):c.379C>T (p.Arg127Ter) Gene: TPP1:tripeptidyl peptidase 1 [Gene – OMIM – HGNC] Variant type: single nucleotide variant Cytogenetic location: 11p15.4 Genomic location: Preferred name: NM_000391.4(TPP1):c.379C>T (p.Arg127Ter) Other names: p.R127*:CGA>TGA…
tRNA therapeutics for genetic diseases
Huang, X. et al. The landscape of mRNA nanomedicine. Nat. Med. 28, 2273–2287 (2022). Article CAS Google Scholar Rohner, E., Yang, R., Foo, K. S., Goedel, A. & Chien, K. R. Unlocking the promise of mRNA therapeutics. Nat. Biotechnol. 40, 1586–1600 (2022). Article CAS Google Scholar Brown, A., Shao, S.,…
a dockerized workflow integrating ClinVar and InterVar germline sequence variant classification
%PDF-1.4 % 102 0 obj <> endobj 114 0 obj <>stream Skia/PDF m121 Google Docs Renderer application/pdf AutoGVP: a dockerized workflow integrating ClinVar and InterVar germline sequence variant classification 2023-12-02T04:08:22-08:00 2023-12-02T04:08:22-08:00 2023-12-02T04:08:22-08:00 uuid:a67b2864-1dd1-11b2-0a00-100a275d6100 uuid:a67b2869-1dd1-11b2-0a00-aa0000000000 endstream endobj 101 0 obj <> endobj 2 0 obj <> endobj 73 0 obj <> endobj…
AutoGVP: a dockerized workflow integrating ClinVar and InterVar germline sequence variant classification
Abstract With the increasing rates of exome and whole genome sequencing, the ability to classify large sets of germline sequencing variants using up-to-date American College of Medical Genetics – Association for Molecular Pathology (ACMG-AMP) criteria is crucial. Here, we present Automated Germline Variant Pathogenicity (AutoGVP), a tool that integrates germline…
Coming Soon! Updates to the ClinVar Website
In order to support the inclusion of submitted somatic variation data, we are updating the ClinVar website. In early 2024, you will begin to see some changes. What will change? Variant (VCV) record pages will have an updated look and feel: Simpler layout with no tabs New sections will display…
EMBL’s European Bioinformatics Institute (EMBL-EBI) in 2023 | Nucleic Acids Research
Abstract The European Molecular Biology Laboratory’s European Bioinformatics Institute (EMBL-EBI) is one of the world’s leading sources of public biomolecular data. Based at the Wellcome Genome Campus in Hinxton, UK, EMBL-EBI is one of six sites of the European Molecular Biology Laboratory (EMBL), Europe’s only intergovernmental life sciences organisation. This…
Estimating the proportion of nonsense variants undergoing the newly described phenomenon of manufactured splice rescue
Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17:405–24. Article PubMed Google Scholar Abou…
How to overlap patient VCF with ClinVar database annotation using bedtools?
How to overlap patient VCF with ClinVar database annotation using bedtools? 1 Hello, I’m trying to help a colleague who is trying to add ClinVar databases clinical significance column to VCF samples that she analysed. More specifically, we are trying to add overlapping/common variant annotation so that if the variant…
Allelic hierarchy for USH2A influences auditory and visual phenotypes in South Korean patients
Genotypes of USH2A-related disorders We identified 14 biallelic variants in USH2A, either homozygous or compound heterozygous, in a trans configuration. The segregation of these variants was confirmed by Sanger sequencing. Overall, 18 mutant alleles were implicated in the diagnosis of USH2A-related phenotypes, including c.251G > A:p.Cys84Tyr, c.2209C > T:p.Arg737*, c.2802 T > G:p.Cys934Trp, c.4372C > T:p.Arg1578Cys, c.4858C > T:p.Gln1620*, c.7120 + 1475A > G, c.8232G > C:p.Trp2744Cys,…
deCODE Genetics Finds 4% of Icelanders Carry an Actionable Genotype
Scientists at deCODE genetics, a subsidiary of Amgen, have been focusing on actionable genotypes detected in the Icelandic population. Recently, the researchers found that approximately 1 in 25 Icelanders carried an actionable genotype and that carrying such a genotype was associated with a reduced life span. This research is published…
Exploring the Impact of Actionable Genotypes on Lifespan
Scientists at deCODE genetics, a subsidiary of Amgen, have conducted groundbreaking research on actionable genotypes in the Icelandic population. The study, published in The New England Journal of Medicine, reveals that carrying an actionable genotype is linked to a reduced lifespan, a fact that has significant implications for precision medicine…
Genome mining yields putative disease-associated ROMK variants with distinct defects
Fig 2. ROMK mutations from TOPMed and ClinVar show varying growth defects in yeast in low potassium medium. (A) Schematic of a yeast-based assay to assess the activity of a human potassium channel. A yeast strain lacking endogenous potassium transporters, Trk1 and Trk2, is viable, yet unable to grow on…
ROMK mutations from TOPMed and ClinVar show varying growth defects in yeast in low potassium medium.
(A) Schematic of a yeast-based assay to assess the activity of a human potassium channel. A yeast strain lacking endogenous potassium transporters, Trk1 and Trk2, is viable, yet unable to grow on medium containing low potassium, unless a human potassium channel (e.g., Kir2.1 or ROMK) is expressed. Because of impaired…
Circular extrachromosomal DNA promotes tumor heterogeneity in high-risk medulloblastoma
Statistical methods Statistical tests, test statistics and P values are indicated where appropriate in the main text. Categorical associations were established using the chi-squared test of independence if n > 5 for all categories and Fisherʼs exact test otherwise. For both tests, the Python package scipy.stats v1.5.3 implementation was used64. Multiple hypothesis corrections…
Zebrafish danRer11 chr6:43,426,661-43,433,266 UCSC Genome Browser v456
DANIO-CODE Track Hub 3P-seq trackshidedensesquishpackfull CAGE-seq trackshidedensesquishpackfull ChIP-seq trackshidedensesquishpackfull RNA-seq trackshidedensefull Cell Typeshidedensesquishpackfull Consensus promotershidedensesquishpackfull Conservation and CRISPR targetshideshow COPEs and pooled DOPEshideshow Enhancer validationhideshow HiC trackshidedensefull Stages_Typeshidedensesquishpackfull Mapping and Sequencing Base Positionhidedensefull Assemblyhidedensesquishpackfull Gaphidedensesquishpackfull GC Percenthidedensefull GRC Incidenthidedensesquishpackfull INSDChidedensesquishpackfull RefSeq Acchidedensesquishpackfull Restr Enzymeshidedensesquishpackfull Short Matchhidedensesquishpackfull …
vcf – VEP annotation INFO field Ensembl IDs and locations
I have a vcf file that I annoteted with VEP, for human data. I have run VEP to annotate my files with some additional parameters (as shown below in the ##VEP-command-line). However, my output is rather strange (mainly the INFO column). ##VEP=”v108″ time=”2023-04-27 15:13:08″ cache=”workflow/resources/variants/cache_vep/homo_sapiens/108_GRCh38″ ensembl-funcgen=108.56bb136 ensembl-variation=108.a885ada ensembl-io=108.58d13c1 ensembl=108.d8a9c80 1000genomes=”phase3″…
Senior Scientist Bioinformatics – AZNJP00026759 Hays Working for your tomorrow
Location – Cambridge, UK Outside IR35 Duration – 12 months Make a more meaningful impact to patients’ lives around the globe. When we put unexpected teams in the same room, we unleash bold thinking with the power to inspire life-changing medicines. In-person working give us the platform we need to…
List of variants in gene BDH1
List of variants in gene BDH1 – ClinVar Miner The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University…
ftsj3 Summary
Gene Symbol: ftsj3 Gene Name: FtsJ RNA methyltransferase homolog 3 Synonyms: ( Nomenclature history ) Gene Function: Putative SAM-dependent rRNmethyltransferase SPB1 Protein Function : Probable…
Mouse mm10 chr4:22,481,383-22,489,763 UCSC Genome Browser v455
Custom Tracks Adiposehidedensesquishpackfull Cerebellumhidedensesquishpackfull Cortexhidedensesquishpackfull Liverhidedensesquishpackfull Lunghidedensesquishpackfull Sintesthidedensesquishpackfull Spleenhidedensesquishpackfull mouse_7_core ATAC Adipose Rep1hidedensefull ATAC Adipose Rep2hidedensefull ATAC Cerebellum Rep1hidedensefull ATAC Cerebellum Rep2hidedensefull ATAC Colon Rep1hidedensefull ATAC Colon Rep2hidedensefull ATAC Cortex Rep1hidedensefull ATAC Cortex Rep2hidedensefull ATAC Heart Rep1hidedensefull ATAC Heart Rep2hidedensefull ATAC Liver Rep1hidedensefull ATAC Liver Rep2hidedensefull ATAC…
Bi-allelic truncating variants in CASP2 underlie a neurodevelopmental disorder with lissencephaly
Di Donato N, Chiari S, Mirzaa GM, Aldinger K, Parrini E, Olds C, et al. Lissencephaly: expanded imaging and clinical classification. Am J Med Genet A. 2017;173:1473–88. Article PubMed PubMed Central Google Scholar Guerrini R, Dobyns WB. Malformations of cortical development: clinical features and genetic causes. Lancet Neurol. 2014;13:710–26. Article …
List of variants in gene FGFR2 studied for female reproductive system neoplasm
Minimum submission review status: ★☆☆☆ criteria provided ★★★☆ reviewed by expert panel ★★★★ practice guideline Collection method: clinical testing curation literature only research other Minimum conflict level: multiple submissions, potential for conflict synonymous conflict (e.g. benign vs non-pathogenic) confidence conflict (e.g. benign vs likely benign) benign or likely benign vs…
Genentech hiring Principal Bioinformatics Scientist II in Santa Clara, California, United States
The Position Principal Bioinformatics Scientist We are seeking a highly skilled and experienced Principal Bioinformatics Scientist specializing in Next Generation Sequencing (NGS) to join our research team. As a Computational Biologist in NGS, you will lead and contribute to cutting-edge projects focused on analyzing and interpreting NGS data, playing a…
Activity 3 instructions-1 – Name: _____________________________ Gene name: ______________________
Name: _____________________________ Gene name: ______________________ Activity 3 instructions. You have two patients who have undergone Whole Exome Sequencing analysis. Their genetic results came back and both patients have a genetic variant in the same medically actionable gene. Patient #1 has a different variant than Patient #2. Use publicly available databases…
E-IT hiring Bioinformatics Business Analyst in United States
Company Description E-IT Professionals Corp. (EIT) is an award-winning IT consulting, recruitment, management, and staffing organization founded in 1999. EIT is comprised of around 320 Information Technology Consultants and boasts revenues approaching $21M overall. Our dedicated team of professionals in the US and India serves clients from various geographies. We…
Children’s Mercy makes progress advancing pediatric genomics
To diagnose and solve pediatric diseases, Children’s Mercy Kansas City’s has been performing whole-genome sequencing tests. Recently the hospital announced that it is the first healthcare organization to bring genetic testing bedside, says Dr. Tomi Pastinen, director of Center for Pediatric Genomic Medicine. Meanwhile, the cost of genetic and genomic testing has…
Comparative study on the mutation spectrum of L-MYC and C-MYC genes of blood cfDNA in patients with ovarian cancer and healthy females
doi: 10.1111/jog.15808. Online ahead of print. Affiliations Expand Affiliations 1 Centre for Interdisciplinary Biomedical Research, Adesh University, Bathinda, India. 2 Department of Clinical Biochemistry, Govt. College for Women, M. A. Road, Srinagar, Cluster University Srinagar, Kashmir, India. Item in Clipboard Saba Shabir et al. J Obstet Gynaecol Res. 2023. Show details…
The mutational signature of hypertrophic cardiomyopathy
Introduction Hypertrophic cardiomyopathy (HCM), characterized by asymmetric hypertrophy of the ventricular wall, is a condition where the heart becomes thickened without a distinct inducement.1,2 Epidemiological investigation shows that the estimated prevalence rate of HCM in the general population is 1:500.3,4 The clinical manifestations vary greatly, with no symptoms and mild…
Characterizing genetic variation in the regulation of the ER stress response through computational and cis-eQTL analyses
doi: 10.1093/g3journal/jkad229. Online ahead of print. Affiliations Expand Affiliation 1 Department of Human Genetics, University of Utah School of Medicine, Salt Lake City, Utah, 84112, USA. Item in Clipboard Nikki D Russell et al. G3 (Bethesda). 2023. Show details Display options Display options Format AbstractPubMedPMID doi: 10.1093/g3journal/jkad229. Online ahead of print….
a database of gene-disease associations
rs377577594 A 0.710 CausalMutation CLINVAR Identifying recurrent mutations in cancer reveals widespread lineage diversity and mutational specificity. 26619011 2016 rs377577594 0.710 GeneticVariation BEFREE We took advantage of DNMT3A (R882C) mutation-carrying AML cell strain, that is, OCI-AML3, assessing its migration ability in vitro and in vivo. 27724883 2016 rs377577594 A 0.710…
OBM Genetics | Whole Genome Sequencing in Era of Newborn Screening
Abstract After the completion of the human genome project, there have been many advances in the field of genetics. With next generation sequencing, patients can undergo genomic analysis through whole exome or whole genome testing. These comprehensive tests can shorten the diagnostic odyssey and guide medical management and thereby potentially…
Coming Soon to ClinVar! Somatic Variants & Changes to the XML – NCBI Insights
Do you rely on ClinVar XML files for your application or analytical pipeline? We are significantly updating ClinVar’s XML format to support the inclusion of new somatic variation data provided by submitters. In the coming months, you may need to make changes to your tool or pipeline code to continue…
Wide diagnostic and genotypic spectrum in patients with suspected mitochondrial disease | Orphanet Journal of Rare Diseases
Macken WL, Vandrovcova J, Hanna MG, Pitceathly RDS. Applying genomic and transcriptomic advances to mitochondrial medicine. Nat Rev Neurol. 2021;17(4):215–30. doi.org/10.1038/s41582-021-00455-2 Article PubMed Google Scholar Gorman GS, Chinnery PF, DiMauro S, Hirano M, Koga Y, McFarland R, et al. Mitochondrial diseases. Nat Rev Dis Primers. 2016;2(1). doi.org/10.1038/nrdp.2016.80 Barcia G, Assouline…
Match variants from RNAseq with known databases
Match variants from RNAseq with known databases 0 Hi all, I’ve managed to call variants from RNAseq using existing tools out there (Strelka2, HC). Now I want to compare my variants with subsets of known variants coming from specific datasets. Here’s the question: variants are reported only on the forward…
PTEN-induced kinase 1 gene single-nucleotide variants as biomarkers in adjuvant chemotherapy for colorectal cancer: a retrospective study | BMC Gastroenterology
Tissue samples A total of 84 analytic samples from surgical or biopsy specimens were collected from 84 patients who underwent radical surgery for CRC at Saitama Medical University International Medical Center between January and December 2016. One case was excluded because the specimen was too small; therefore, we used a…
Weirdness in annotation (missing allele frequencies)
Hello everyone! I am trying to get the gnomad allele frequencies of variants in the VCF files (I share the screenshot of one example which allele frequency I want to have). I used the following protocols and operations: protocols=”gnomad211_genome,gnomad211_exome,clinvar_20221231,dbnsfp42a,avsnp150,refGene” operations=”f,f,f,f,f,g” I have two sets of AF values, I believe one…
Whole exome sequencing and transcriptome analysis in two unrelated patients with novel SET mutations
Moeschler JB, Shevell M, Committee on G. Comprehensive evaluation of the child with intellectual disability or global developmental delays. Pediatrics. 2014;134:e903–18. PubMed Google Scholar Patel DR, Cabral MD, Ho A, Merrick J. A clinical primer on intellectual disability. Transl Pediatr. 2020;9:S23–35. PubMed PubMed Central Google Scholar Baker K, Devine RT,…
Diagnostic genome sequencing improves diagnostic yield: a prospective single-centre study in 1000 patients with inherited eye diseases
Introduction Although protein-coding regions represent only 1–2% of the human genome, they harbour an estimated 85% of annotated pathogenic variants.1 2 Despite these numbers, genome sequencing (GS) usually achieves a higher diagnostic yield than sequencing approaches that focus on exonic regions, not least because of its more homogeneous coverage3 4…
DeepMind AI Hunts Down the DNA Mutations Behind Genetic Disease
Proteins are like Spider-Man in the multiverse. The underlying story is the same: each building block of a protein is based on a three-letter DNA code. However, change one letter, and the same protein becomes a different version of itself. If we’re lucky, some of these mutants can still perform…
Curation in ClinVar
Expert curation of variants Expert curated variants are submitted to ClinVar by ClinGen-approved expert panels. Read more about expert panels in ClinVar. NCBI staff do not curate variant classifications. Our staff work closely with submitters to ensure that each record submitted to ClinVar reflects the submitter’s assertion about the variant….
IJNS | Free Full-Text | Whole-Genome Sequencing Can Identify Clinically Relevant Variants from a Single Sub-Punch of a Dried Blood Spot Specimen
1. Introduction Newborn screening (NBS) plays a vital role in healthcare systems for the prompt identification of individuals who may develop one of a set of rare, but severe health conditions [1]. In the UK, for example, dried blood spot (DBS) specimens are routinely collected at 4–5 days of age…
AlphaMissense revolutionizes genetic mutation analysis for disease prediction
In a recent article published in the journal Science, researchers presented AlphaMissense, a highly accurate protein structuring model adapted from AlphaFold (AF) to predict and characterize human proteome-wide missense variants’ pathogenicity at a single amino acid substitution level. Study: Accurate proteome-wide missense variant effect prediction with AlphaMissense. Image Credit: ArtemisDiana / Shutterstock It…
NM_005546.4(ITK):c.1741C>T (p.Arg581Trp) AND Autoinflammatory syndrome – ClinVar
NM_005546.4(ITK):c.1741C>T (p.Arg581Trp) AND Autoinflammatory syndrome Based on: 1 submission [Details] Record status: current Accession: RCV002263636.3 Allele description [Variation Report for NM_005546.4(ITK):c.1741C>T (p.Arg581Trp)] NM_005546.4(ITK):c.1741C>T (p.Arg581Trp) Gene: ITK:IL2 inducible T cell kinase [Gene – OMIM – HGNC] Variant type: single nucleotide variant Cytogenetic location: 5q33.3 Genomic location: Preferred name: NM_005546.4(ITK):c.1741C>T (p.Arg581Trp) HGVS:…
Consistency of BRCA1 and BRCA2 Variant Classifications Among Clinical Diagnostic Laboratories.
Abstract BACKGROUND: Genetic tests of the cancer predisposition genes BRCA1 and BRCA2 inform significant clinical decisions for both physicians and patients. Most uncovered variants are benign, and determining which few are pathogenic (disease-causing) is sometimes challenging and can potentially be inconsistent among laboratories. The ClinVar database makes de-identified clinical variant…
ClinVar Partners with ClinGen to Review & Curate Submitted Records
Do you currently use or submit clinical variation data? NCBI now has a new mechanism to improve ClinVar data quality. Since ClinVar’s founding over 10 years ago, the amount of information in this free resource has expanded dramatically with submissions from research and clinical laboratories all over the world. Because…
Myriad Genetics Issues 2022 Environmental, Social and Governance Report
SALT LAKE CITY, Sept. 19, 2023 (GLOBE NEWSWIRE) — Myriad Genetics, Inc., (NASDAQ: MYGN), a leader in genetic testing and precision medicine, today released its second annual Environmental, Social and Governance report, highlighting key efforts that reflect its commitment to conduct operations as a responsible, equitable and sustainable partner in…
An AI tool classifies millions of missense mutation effects
Google Deepmind has developed a brand-new AI model to categorize missense variations. The researchers reveal in a study published in “Science” that it classified 89% of all 71 million potential missense variations as either likely harmful or likely benign. Most missense mutations found in the human genome are not known…
AlphaMissense Classifies Mutation Pathogenicity | Inside Precision Medicine
Credit: iStock/agsandrew A new, freely available AI catalog has classified the potential effects of millions of missense genetic mutations, which could help establish the cause of diseases such as cystic fibrosis, sickle-cell anemia, and cancer. The AlphaMissense resource from Google DeepMind categorized 89% of all 71 million possible missense variants….
A catalogue of genetic mutations to help pinpoint the cause of diseases
New AI tool classifies the effects of 71 million ‘missense’ mutations Uncovering the root causes of disease is one of the greatest challenges in human genetics. With millions of possible mutations and limited experimental data, it’s largely still a mystery which ones could give rise to disease. This knowledge is…
DeepMind is using AI to pinpoint the causes of genetic disease
With the rise of gene sequencing, doctors can now decode people’s genomes and then scour the DNA data for possible culprits. Sometimes, the cause is clear, like the mutation that leads to cystic fibrosis. But in about 25% of cases where extensive gene sequencing is done, scientists will find a…
Finding Unique values on specific INFO field of the VCF file (dbNSFP, vep annotated multisample VCF)
Hello everyone! I searched the forum but coundn`t find a question that is like mine I have a multisample annotated VCF file (with dbNSFP plugin) to which I have filtered using VEP, like so: /scratch/ensembl-vep-109/ensembl-vep/filter_vep –force_overwrite –input_file {1} –output_file /home/filtering/2/2_{1/.}.vcf –only_matched –filter “(clinvar_clnsig is Pathogenic) or (clinvar_clnsig is Likely_pathogenic) After…
Finding Unique values on specific INFO field of the VCF file
Finding Unique values on specific INFO field of the VCF file 0 Hello everyone! I searched the forum but coundn`t find a question that is like mine I have a VCF file to which I have filtered using VEP, like so: /scratch/ensembl-vep-109/ensembl-vep/filter_vep –force_overwrite –input_file {1} –output_file /home/filtering/2/2_{1/.}.vcf –only_matched –filter “(clinvar_clnsig…
NCBI ClinVar XML update to accomodate somatic variants
News:NCBI ClinVar XML update to accomodate somatic variants 0 If you use NCBI ClinVar XML files for your application or analytical pipeline, you may need to make changes to your tool or pipeline code by 2024 because we will be significantly updating ClinVar’s XML format to support new somatic variation…
Coming Soon to ClinVar! Somatic Variants & Changes to the XML
Do you rely on ClinVar XML files for your application or analytical pipeline? We are significantly updating ClinVar’s XML format to support the inclusion of new somatic variation data provided by submitters. In the coming months, you may need to make changes to your tool or pipeline code to continue…
SNPred outperforms other ensemble-based SNV pathogenicity predictors and elucidates the challenges of using ClinVar for evaluation of variant classification quality.
Abstract Background: Current single nucleotide variants (SNVs) pathogenicity prediction tools assess various properties of genetic variants and provide a likelihood of causing a disease. This information aids in variant prioritization – the process of narrowing down the list of potential pathogenic variants, and, therefore, facilitating diagnostics. Assessing the effectiveness of…
Homogentisate 1,2-dioxygenase (HGD) gene variants in young Egyptian patients with alkaptonuria
In the current study, we evaluated the clinical and genetic characteristics of four unrelated Egyptian families suffering from alkaptonuria. All patients presented with isolated dark urine at a median age of 6 months and were confirmed to have a high level of homogentisic acid in urine by qualitative GC/MS evaluation of…
Pipeline to analyse variant calls against clinvar and gnomad
I am looking for a freelancer to help me build a pipeline for variant calls analysis against clinvar and gnomad. The project requires both single-sample and multi-sample analysis. Skills and Experience: – Proficiency in variant calls analysis – Experience with clinvar and gnomad databases – Strong knowledge of bioinformatics and…
Challenging interpretation of germline TP53 variants based on the experience of a national comprehensive cancer centre
Subjects TP53 gene was investigated in 880 consecutive oncology patients referred for molecular genetic testing at our national centres (Department of Laboratory Medicine, Semmelweis University and Department of Molecular Genetics, National Institute of Oncology) between 2021 and 2022. This cohort consisted of patients with potential hereditary tumour predisposition. Their genetic…
GATK AnnotateVcfWithBamDepth returns zero DP for all variants in VCF
Dear all, I am using GATK (v4.1.9.0) AnnotateVcfWithBamDepth to get the DP for all variants in ClinVar VCF in a retina RNA-seq BAM file. However, the tool returns zero depth for all variants in the VCF, even though I checked multiple variants in IGV and I saw that they are…
NM_000379.4(XDH):c.1510A>G (p.Met504Val) AND Hereditary xanthinuria type 1 – ClinVar
NM_000379.4(XDH):c.1510A>G (p.Met504Val) AND Hereditary xanthinuria type 1 Based on: 1 submission [Details] Record status: current Accession: RCV002479628.1 Allele description [Variation Report for NM_000379.4(XDH):c.1510A>G (p.Met504Val)] NM_000379.4(XDH):c.1510A>G (p.Met504Val) Gene: XDH:xanthine dehydrogenase [Gene – OMIM – HGNC] Variant type: single nucleotide variant Cytogenetic location: 2p23.1 Genomic location: Preferred name: NM_000379.4(XDH):c.1510A>G (p.Met504Val) HGVS: NC_000002.12:g.31375472T>C…
Confusion about transcript ablation
I’m analyzing the WES data of a patient, after calling variants by GATK, I use Ensembl Variant Effect Predictor (VEP) to annotate my vcf file. Here is one record from the output file: #Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra chr11_64341844_GTTGTGGTCTGAGGTCTTGGGCCATCAGTGATGTCACAACCAGATGGCCCAAGACCCCAGACCACAACCCCATGTCTGGT/- chr11:64341844-64341923- ENSG00000278359…
Unraveling variant misclassification: Insights from ClinVar and HGMD databases
Cardiac Comprehensive Kit analyzes 292 genes and covers major inherited cardiovascular disorders. Genes Tested AARS2, ABCA1, ABCC6, ABCC9, ABCG5, ABCG8, ACAD9, ACADVL, ACTA1, ACTA2, ACTC1, ACTN2, ACVR1, ACVR2B, ACVRL1, ADAMTS2, AFF4, AGK, AKAP9, AKT3, ALDH18A1, ALMS1, ALPK3, ANK2, ANKRD1, APOA5, APOB, APOE, ATP6V0A2, ATP6V1A, ATP6V1E1, B3GALT6, B4GALT7, BAG3, BGN,…
East Asian people found to have more variants in DDC gene: Study | Highest frequency for cause of AADC deficiency in all ethic groups
People in East Asia have a higher frequency of variants in the DDC gene — the cause of aromatic l-amino acid decarboxylase (AADC) deficiency — than do those in any other ethnic groups across the world, a new study has found. Interestingly, while Koreans had the lowest carrier frequency among East…
The complete sequence of a human Y chromosome
Skaletsky, H. et al. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, 825–837 (2003). Article ADS CAS PubMed Google Scholar Miga, K. H. et al. Centromere reference models for human chromosomes X and Y satellite arrays. Genome Res. 24, 697–707 (2014)….
Rare Disease Variants ID’d in Literature Not Always Found in Accessible Databases
Nearly a quarter of variants reported to be pathogenic for X-linked Creatine Transporter Deficiency in articles available in PubMed are not present in public variant databases, according to a new analysis in BMC Genomics. Researchers from the US National Institutes of Health and the Frederick National Laboratory for Cancer Research…
A Look Into Summer Research at DePauw University
This has been an exciting, eventful summer for DePauw science. Since the graduation of the class of 2023, many labs across campus have been hard at work pipetting, imaging, and surveying. Two labs, however, have been doing truly remarkable work within the Chemistry and Biochemistry department and the Biology department….
Identification of two novel variants of the DMD gene
Introduction Duchenne muscular dystrophy (DMD, OMIM#310200) is a severe X-linked recessive, inherited neuromuscular disorder, characterized by rapidly progressive muscle weakness and muscle wasting throughout the body.1 DMD is more common in males than females, with an incidence rate of 1:5000 and 1:50,000,000, respectively.2 Female heterozygotes theoretically have 50% normal cells…
Long-molecule scars of backup DNA repair in BRCA1- and BRCA2-deficient cancers
Pan-cancer WGS data sources GrCh37/hg19 BAM alignments for 2,489 primary tumour and matched normal whole-genome sequencing data were obtained as previously described18. In brief, 989 tumour–normal (T/N) pairs were obtained from The Cancer Genome Atlas (TCGA) Research Network (Genomic Data Commons at portal.gdc.cancer.gov/, accession: phs000178.v11.p8). Additional WGS data were obtained for 874 T/N pairs…
Clinvar This! | Read the Docs
Repository github.com/bihealth/clinvar-this Project Slug clinvar-this Last Built 5 months ago passed Maintainers Home Page github.com/bihealth/clinvar-this Badge reStructuredText .. image:: readthedocs.org/projects/clinvar-this/badge/?version=latest :target: clinvar-this.readthedocs.io/en/latest/?badge=latest :alt: Documentation Status Markdown [![Documentation Status](https://readthedocs.org/projects/clinvar-this/badge/?version=latest)](https://clinvar-this.readthedocs.io/en/latest/?badge=latest) HTML <a href=”https://clinvar-this.readthedocs.io/en/latest/?badge=latest”> <img src=”https://readthedocs.org/projects/clinvar-this/badge/?version=latest” alt=”Documentation Status” /> </a> Tags api, clinvar Short URLs clinvar-this.readthedocs.ioclinvar-this.rtfd.io Default Version latest ‘latest’ Version main Read more…
Genome-wide prediction of disease variant effects with a deep protein language model
This study did not require any ethical approval. ESM1b In this study, we have leveraged and expanded the use of ESM1b, a protein language model developed by MetaAI20. The code and pretrained parameters for ESM1b (and other ESM models) were taken from the model’s official GitHub repository at github.com/facebookresearch/esm. Throughout…
Intermountain Healthcare Jobs – Bioinformaticist Staff
Job Description: Bioinformaticist-Staff is responsible to advance and improve patient care and the process of delivering patient care through the use of patients’ genomics information and data; to further research, educational, and business opportunities in Bioinformatics; and to increase the knowledge and capabilities of personnel in genomic and OMICs data…
Nigerian Population Structure, Genetic Variation Uncovered in Whole-Genome Sequencing Study
NEW YORK – A team from the US, Nigeria, and the UK has started to tease out the extensive genetic diversity that exists within and between populations in Nigeria — work that is expected to lay the foundation for future genomic research and personalized medicine efforts in Africa. “This is…
NM_000475.5(NR0B1):c.521G>C (p.Arg174Pro) AND multiple conditions – ClinVar
Description This sequence change replaces arginine, which is basic and polar, with proline, which is neutral and non-polar, at codon 174 of the NR0B1 protein (p.Arg174Pro). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with…
Landscape of mSWI/SNF chromatin remodeling complex perturbations in neurodevelopmental disorders
Bailey, M. H. et al. Comprehensive characterization of cancer driver genes and mutations. Cell 173, 371–385 (2018). Article CAS PubMed PubMed Central Google Scholar Gabriele, M., Tobon, A. L., D’Agostino, G. & Testa, G. The chromatin basis of neurodevelopmental disorders: Rethinking dysfunction along the molecular and temporal axes. Prog. Neuropsychopharmacol….
Evolutionary histories of breast cancer and related clones
Data reporting No statistical methods were used to determine the sample size. The experiments were not randomized. Pathologists were blinded to the genetic alterations in each sample during histopathological evaluation. Participants and materials We enroled 207 female patients with breast cancer who underwent surgery at the Kyoto University Hospital and…
Roche hiring Principal Bioinformatics Scientist in Mississauga, Ontario, Canada
The PositionPrincipal Bioinformatics ScientistWe are seeking a highly skilled and experienced Principal Bioinformatics Scientist specializing in Next Generation Sequencing (NGS) to join our research team. As a Computational Biologist in NGS, you will lead and contribute to cutting-edge projects focused on analyzing and interpreting NGS data, playing a pivotal role…
W,M,R nucleotides
W,M,R nucleotides 1 Hi all, I have a question regarding c. variants (e.g. c.224T>C, c.209G>W). If the variant is denoted as >R, M, or W what does the R, M, and W mean as those aren’t standard nucleotides? I tried looking this up on ClinVar, but couldn’t find anything? Thank…
reference annotation for the human and mouse genomes in 2023
D942–D949 Nucleic Acids Research, 2023, Vol. 51, Database issue Published online 24 November 2022 doi.org/10.1093/nar/gkac1071 GENCODE: reference annotation for the human and mouse genomes in 2023 Adam Frankish 1,* , Sı́lvia Carbonell-Sala2 , Mark Diekhans 3 , Irwin Jungreis 4,5 , Jane E. Loveland 1 , Jonathan M. Mudge1 ,…
Databases’ Variant Classifications Have Improved Over Time
The accuracy of variant classifications in databases has gotten with time, according to a new analysis appearing in Genome Medicine. Researchers from the University of California, Berkeley, examined changes in variant misclassification within archived versions of ClinVar and the Human Gene Mutation Database (HGMD) over six years, focusing in particular…
Re-evaluation and re-analysis of 152 research exomes five years after the initial report reveals clinically relevant changes in 18%
Cohort structure We collected sequencing data and information about age, sex, and phenotypes from 152 families (44 simplex with one, 79 multiplex with two, 24 with three, and five with four or more). The cohort characteristics are depicted in Fig. 2A (details in File S2 [12]). Most affected individuals were younger than…
Warning in 1st line in SnpEff files
Hello, I’ve got VCF files that I wish to annotate with SnpEff and then use SnpSift to add further annotations such as dbSNP, GWASCatalog, ClinVar, etc. I run SnpEff by typing the following command java -Xmx8g -jar snpEff.jar hg19 -chr -lof -hgvs -geneID -sequenceOntology -canon -csvStats sample_001.csv -stats sample_001.html input_001.vcf…
A framework for individualized splice-switching oligonucleotide therapy
Patients The WGS and clinical data of 235 patients with A-T were provided by the Global A-T Family Data Platform of ATCP. Our access to the data was approved by the Data Access Committee of ATCP. Selected patients with A-T enrolled at the Manton Center for Orphan Disease Research under…
Whole Genome Sequencing Boosts Diagnosis of Rare Disease in Infants
Whole genome sequencing captured almost twice as many genetic abnormalities that may be responsible for disease in infants, compared with a standard targeted test, researchers found. In the Genomic Medicine for Ill Neonates and Infants (GEMINI) study, the diagnostic yield of whole genome sequencing was 49%, compared with 27% with…
How to work with exome data
How to work with exome data 0 Hi everyone, I am new to working with exome data. The bioinformaticians have already given me analysed .tsv files. In these files I find information about the annotation of the variation and its meaning according to clinvar. The problem is when I try…
Failure in Annonatation with Annovar
Failure in Annonatation with Annovar 0 I am trying to perform an annotation with table_annovar.pl script, to annotate my variants in my .avinput file but It seems that the annotate_variation.pl script is being called within the table_annovar.pl script, and there is an error with the command being executed. Here is…
Whole genome and RNA sequencing analyses for 254 Taiwanese hepatocellular carcinomas | Biomarker Research
Clinical data The demographic data of the 254 HCC patients are presented in Table S1. We found that treatment received by HCC patients were associated with patient survival, as shown in Fig. S1. Somatic mutations The mutational landscape is shown in Fig. 1. The top 10 most common mutated genes were…
Genetic characterization of primary and metastatic high-grade serous ovarian cancer tumors reveals distinct features associated with survival
Characterization of genomic landscape We compared somatic variants, copy number alterations, and mutational burden between the primary and metastatic tumors of the ST and LT survival groups. Our cohort of patient tumors exhibited characteristics typical of those seen in previously sequenced HGSC tumors, such as nearly ubiquitous TP53 mutations, high…
View genomic variant #0000026722 – MSeqDR-LSDB Mitochondrial Disease Locus Specific Database
View genomic variant #0000026722 Chromosome 9 Allele Unknown Affects function (as reported) Not classified Affects function (by curator) Not classified Type – DNA change (genomic) (Relative to hg19 / GRCh37) g.6605141T>G Published as – GERP – Segregation – DB-ID GLDC_000222 MSCV – dbSNP ID – Frequency – Sources ; clinvar; Reference – Variant remarks – Genetic origin – Variant_disease – Average frequency (large NGS studies) Variant not found in online data…