Categories
Tag: conda
How to Analyze Coronavirus RNA with Python (Part 2: Installing Biopython) | by Proto Bioengineering | Feb, 2024
The Biopython logo Biopython is a set of tools for doing all sorts of genomics tasks: reading DNA and RNA, aligning sequences, analyzing similarities between sequences, and more. This is the second part in a series on analyzing coronavirus RNA with Python. Here we’ll install Biopython and use it to…
python – Within Jetbrain DataSpell Jupyter Notbook IPython.Display.SVG Images are not displayed fully/cut off
I am using Dataspell to work in a Jupyter Notebook with an conda environment. When I try to display a IPython.display.SVG graphic, it is not rendered correctly and parts are cut off. I am following along this tutorial. When I use the SVG function imported from from IPython.display import SVG…
Diving into PyTorch: A Beginner’s Tale of Contribution | by Weinheimergracia | Dec, 2023
Hey there, fellow code wranglers and AI enthusiasts! I’m Cami, your friendly neighborhood tech explorer, and I’m about to take you on a wild ride through my latest adventure: contributing to PyTorch without being an expert in it. Yes, you read that right! My Unexpected Journey into PyTorch So, I…
‘Resources’ object has no attribute ‘tmpdir’
Snakemake error AttributeError: ‘Resources’ object has no attribute ‘tmpdir’ 0 I have built a Snakemake pipeline which has been designed for paired-end reads. I have made a trial with single-end reads, and got this error. I am not sure it is related to the change of reads design, and to…
How to setup the pipeline of the RNA-Seq FASTQ file processing (macOS version)
This is a guide for preparing for importing RNA-Seq FASTQ files to Subio Platform on a Mac computer. If you use a Windows10 machine, please go to the guide for Windows10. Subio Platform utilizes the following tools to process the RNA-Seq FASTQ files. fastp to trim adapters and filter low-quality…
Unix and Shell Scripting for Bioinformatics course
News:Unix and Shell Scripting for Bioinformatics course 0 Dear all, There are still a few seats available for our online course on Unix and Shell Scripting for Bioinformatics! Dates: 15-19 January 2024 Course Overview: Dive into the world of high-throughput biology Master essential Unix commands for data analysis Connect to…
Unable to install bioconda and bowtie
Unable to install bioconda and bowtie 0 ➜ ~ conda install -c “bioconda/label/cf201901” bowtie Collecting package metadata (current_repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Collecting package metadata (repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. PackagesNotFoundError: The following packages…
[llvm-bugs] [Bug 75428] clang crash when build IPEX code.
Issue 75428 Summary clang crash when build IPEX code. Labels clang Assignees Reporter xuhancn The error msg: “`cmd Stack dump: 0. Program arguments: /usr/bin/clang++ -DAT_PARALLEL_OPENMP=1 -DUSE_C10D_GLOO -DUSE_DISTRIBUTED -DUSE_RPC -DUSE_TENSORPIPE -Dintel_ext_pt_cpu_EXPORTS -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/aten -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/utils -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/jit -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/jit -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/utils -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/mkl-dnn/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/tpp -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/libxsmm/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/build/Release/csrc/cpu/csrc/cpu/cpu_third_party/ideep/mkl-dnn/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/include -I/home/xu/anaconda3/envs/ipex_cpu/include/python3.12 -I/home/xu/anaconda3/envs/ipex_cpu/include -I/home/xu/anaconda3/envs/ipex_cpu/lib/python3.12/site-packages/torch/include/torch/csrc/api/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/mkl-dnn/src/../include -isystem /home/xu/anaconda3/envs/ipex_cpu/lib/python3.12/site-packages/torch/include -fPIC…
Linux: segmentation fault (core dumped)
Linux: segmentation fault (core dumped) 0 Hey everyone, When trying to download any programs using “conda install -c bioconda” I get the following error: Segmentation fault (core dumped) I am not sure what this means or how to go about fixing it. Any input is appreciated! conda miniconda3 Linux •…
How to use protologger in Mac Terminal
How to use protologger in Mac Terminal 0 Hey there folks, I’ve been trying conda recently however I’m still struggling, I have come to encounter protologger git hub, and also galaxy, but was wondering if I’m able to perform batch upload of genome in protologger? since they need both 16S…
What Is JAX in Machine Learning
What Is JAX? JAX, short for “Just Another Extension” or “JAX Autograd”, is an open-source Python library that provides a powerful and efficient framework for high-performance machine learning and scientific computing. Developed by the Google Brain team, JAX bridges the gap between traditional numerical computing libraries and machine learning frameworks…
Navigating TensorFlow Configuration in RStudio: A Guide for Diverse Environments | by Kamrul | Dec, 2023
1. Installing the Right Python Version Recommended Version: Python 3.10.x Optimal balance between new features and stability. Compatible with TensorFlow and avoids many common issues. Installation: Visit the Python website and select a 3.10.x version. Verification: python –version Troubleshooting: Ensure Python is correctly added to your system PATH. 2. Installing…
python – PyTorch Installation Question:PyTorch 0.4.1 – CUDA 9.2 on Windows 11
My understanding of deep learning is limited, so I hope to learn it through PyTorch. I prefer to start with an older version of PyTorch. I downloaded and installed CUDA 9.2 on Windows 11 , and my CUDA driver version is CUDA 12.1 nvcc -V nvcc: NVIDIA (R) Cuda compiler…
bash – Running task once in a slurm script with job array
I am running a couple of jobs in parallel using the following slurm script: #!/bin/bash #SBATCH –job-name=”example” #SBATCH –account=”st-me-1″ #SBATCH –array=0-9 #SBATCH –nodes=1 #SBATCH –ntasks-per-node=8 #SBATCH –time=1:00:00 #SBATCH –mem=32000mb # Change directory into the job dir cd $SLURM_SUBMIT_DIR # Load conda environment source ~/.bashrc # Activate conda environment conda activate…
Can’t train deep learning models using GPU in PyTorch even with a graphics card? (2023/12 latest version) | by Michael Chen | Dec, 2023
As a Windows user, I’m often plagued by environmental issues. These problems have also led many friends around me to give up on their learning journey. Hence, today I want to share about setting up the environment on Windows to enable PyTorch to utilize GPU for training models. If you…
sparklyr – Databricks Connect v2
Last updated: Thu Dec 7 16:28:19 2023 Intro Databricks Connect enables the interaction with Spark clusters remotely. It is based on Spark Connect, which enables remote connectivity thanks to its new decoupled client-server architecture. This allows users to interact with the Spark cluster without having to run the jobs from…
GROMACS MD Simulation – proteomics
I received this error when using the GROMACS initial setup tool WARNING: No ICDs were found. Either, Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or Make your system-wide implementation visible by installing ocl-icd-system conda package. jennaj December 7, 2023, 9:27pm 2 Hi @Vibha_Rao That is…
Some issue about itsxpress2 plugin in QIIME2-202309 – Community Plugin Support
ZhangSR (June) December 7, 2023, 6:36am 1 Hi~ When I updated the ITSxpress within QIIME2-202309 following the updated tutorial here github.com/USDA-ARS-GBRU/itsxpress-tutorial/blob/master/ITSxpress-tutorial.md, there were some confusions. I updated the itsxpress by conda install -c bioconda itsxpress and then qiime dev refresh-cache under the QIIME2 environment I failed to call itsxpress by…
JupyterHub server spawning never completes; new JupyerHub admin – JupyterHub
Hello, I’ve recently started a position responsible for a JupyterHub installation as part of an HPC environment; the old team left without leaving much in the way of documentation, and I’ve never worked on JupyterHub before, so please bear with me. When launching JupyterHub, the system will stay on the…
How to use Nextflow to call scripts from different environments?
How to use Nextflow to call scripts from different environments? 0 I have the following conda environments: wf-preprocess_env wf-assembly_env Each environment has unique dependencies installed. I have 3 scripts: preprocess.py which I use with wf-preprocess_env environment assembly.py and assembly-long.py which I use with wf-assembly_env How can I use Nextflow to…
Calculate GC content for entire chromosome
If you’re comfortable using Python, I’ve created a script that calculates the GC content and GC-skew for each contig, scaffold, or chromosome in a fasta file. This is specifically designed for generating data for a circos plot. To use the script, make sure you have Biopython installed in your conda…
error when installing gistic2 using conda
error when installing gistic2 using conda 0 Dear all, How to fix the error when using conda to install the gistic2? I already use conda to create a new directory/environment, and then conda install -hcc gistic2 as the conda website shows anaconda.org/HCC/gistic2 conda install -c hcc gistic2 Collecting package metadata…
Panic: Could not run ‘torchvision::roi_pool’ with arguments from the ‘CUDA’ backend – Jetson Nano
Hi, Team! I have such errors, when I run my code in docker container: root@de87551d73cf:/app/src# ./main WARN[0032] CUDA is valid WARN[0044] CUDA is valid INFO[0044] Forwarding… [W TensorImpl.h:1156] Warning: Named tensors and all their associated APIs are an experimental feature and subject to change. Please do not use them for…
Issue with Accessing Thermo Data in Pylammps – LAMMPS Installation
Dear members of the LAMMPS mailing list, I have been attempting to build and install the LAMMPS Python interface (Pylammps) to leverage the advantages of accessing thermos data. However, I am encountering the following error: Based on my understanding from the documentation, if I set up a simulation with a…
Function ‘SubBackward0’ returned nan values in its 1th output – autograd
I am trying to implement a model where the forward function calls to an external function that computes the values using the model’s parametes. class R_model(torch.nn.Module): def __init__(self,) : super().__init__() self.Kx = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Ky = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Kz = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) def forward(self): return generate_r(Kx=self.Kx, Ky=self.Ky,…
linux – How to install sox for PyTorch audio?
I want to run PyTorch code on Linux. I start a virtual machine on AWS with AMI Deep Learning PyTorch, but, surprisingly, PyTorch is not installed. So I run: python3 -m pip install torch torchaudio When I load a WAV file, I get this error: RuntimeError: Couldn’t find appropriate backend…
Can’t install hisat2 with miniconda
Can’t install hisat2 with miniconda 0 I’ve been trying to install hisat2 with Miniconda but I keep getting this error. Miniconda is updated and seemingly installed. Also I’m on Mac OS. Please Advise. Channels: bioconda default defaults conda-forge Platform: osx-arm64 Collecting package metadata (repodata.json): done Solving environment: failed PackagesNotFoundError: The…
Previous PyTorch Versions | PyTorch
Installing previous versions of PyTorch We’d prefer you install the latest version, but old binaries and installation instructions are provided below for your convenience. Commands for Versions >= 1.0.0 v2.1.0 Conda OSX # conda conda install pytorch==2.1.0 torchvision==0.16.0 torchaudio==2.1.0 -c pytorch Linux and Windows # CUDA 11.8 conda install pytorch==2.1.0…
qiime2 illegal instruction – Technical Support
Andrea_G (Andrea Gatti) November 28, 2023, 2:19pm 1 Hello, I have to start working on a cluster and I tired to install Qiime2 in a conda environment, but I was reported with an error during Qiime2 installation, specifying: Preparing transaction: done Verifying transaction: – SafetyError: The package for r-base located…
Pytorch for CUDA12.0 – PyTorch Live
Found conflicts! Looking for incompatible packages.This can take several minutes. Press CTRL-C to abort.failed UnsatisfiableError: The following specifications were foundto be incompatible with the existing python installation in your environment: Specifications: pytorch → python[version=‘>=2.7,<2.8.0a0|>=3.10,<3.11.0a0|>=3.11,<3.12.0a0|>=3.8,<3.9.0a0|>=3.9,<3.10.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] torchaudio → python[version=‘>=3.10,<3.11.0a0|>=3.11,<3.12.0a0|>=3.9,<3.10.0a0|>=3.8,<3.9.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] torchvision → python[version=‘>=2.7,<2.8.0a0|>=3.10,<3.11.0a0|>=3.8,<3.9.0a0|>=3.9,<3.10.0a0|>=3.11,<3.12.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] Your python: python=3.12 If python is on the left-most side…
Unable to Use JupyterLab in Development Combining JupyterLab and JupyterHub – JupyterHub
Hello, thank you for providing such a wealth of resources in the community, which has made my development process quite smooth. Problem description:I’d like to inquire about integrating JupyterLab and JupyterHub for managing group-related tasks. I’ve downloaded both repositories locally and used pip install -e “.[dev,test]” within the JupyterLab project….
Is not compatible with the current PyTorch installation
Eunhae_Lee (Eunhae Lee) November 28, 2023, 7:28am 1 Hello, I’m using Mobaxterm to access a server to work on training a model when I try to run the command to launch it, I have his error: NVIDIA GeForce RTX 3090 with CUDA capability sm_86 is not compatible with the current…
python – How can I solve conflict issue installing pymc3?
I’ve tried to install pymc3 but the dependency issue still remained. C:\Users\sykan>conda install -c conda-forge pymc3 Channels: – conda-forge – defaults Platform: win-64 Collecting package metadata (repodata.json): done Solving environment: \ warning libmamba Added empty dependency for problem type SOLVER_RULE_UPDATE failed LibMambaUnsatisfiableError: Encountered problems while solving: – nothing provides vc…
Cineca-ai – HPC Cineca
Version: 2.02 (G100) Availability: GALILEO100 Target: all Official web site: gitlab.www.hpc.cineca.it/sorland2/cineca-ai Related Commands: If you wish to activate the default environment: $ conda activate $CINECA_AI_ENV – If you wish to create a personal conda env with your installations, you can use the local conda channel to access…
finished abnormally, OS return value: 21
SPAdes error: finished abnormally, OS return value: 21 1 I’m having trouble using SPAdes. I’m using SPAdes to do paired end data assembly and I’m getting an unusual stop. error code: finished abnormally, OS return value: 21 Do you know how to resolve this issue? Environment: conda, SPAdes genome assembler…
python – Different behavior in the same conda-pytorch env on different GPUs
Want to improve this question? Add details and clarify the problem by editing this post. I have a project that uses conda env with old pytorch version. It works smoothly if I use Nvidia V100, but it won’t run on other GPUs (I’ve tried RTX3080, TeslaA10, RTX2080TI, TeslaA2, TeslaT4) using…
Building Pytorch for Conda from source with GLIBCXX_USE_CXX11_ABI=1
GdMacmillan (Gordon MacMillan) November 26, 2023, 4:17pm 1 Before I begin, I’ve checked the topics similar to this one and they all have linking issues and PR’s that are outdated. I am attempting to compile the libtorch binaries and build pytorch from source with GLIBCXX_USE_CXX11_ABI=1 The reason for this, I…
Jetson Orin, TensorRT, CUDA 11.8 for PyTorch 2.0.0 – Jetson AGX Orin
I’m I going crazy here or is it impossible to get this combination to work. docs.nvidia.com Support Matrix :: NVIDIA Deep Learning TensorRT Documentation These support matrices provide a look into the supported platforms, features, and hardware capabilities of the NVIDIA TensorRT 8.6.1 APIs, parsers, and layers. I need cuda…
python – PyTorch distributed from two ec2 instances hangs
# env_vars.sh on rank 0 machine #!/bin/bash export MASTER_PORT=23456 export MASTER_ADDR=… # same as below, private ip of machine 0 export WORLD_SIZE=2 export GLOO_SOCKET_IFNAME=enX0 export RANK=0 # env_vars.sh on rank 1 machine #!/bin/bash export MASTER_PORT=23456 export MASTER_ADDR=… # same as above export WORLD_SIZE=2 export GLOO_SOCKET_IFNAME=enX0 export RANK=1 # on rank…
Head of the Medical Bioinformatics platform (m/f/d) – Kiel
Das Universitätsklinikum Schleswig-Holstein (UKSH) verbindet internationale Spitzenforschung mit interdisziplinärer Krankenversorgung. Wir sind einziger Maximalversorger und größter Arbeitgeber des Landes. Unsere mehr als 14.500 Mitarbeiter*innen stellen eine höchst individuelle Versorgung sicher – unverzichtbar für die Menschen in Schleswig-Holstein.The Institute of Clinical Molecular Biology (IKMB)The Medical Faculty together with the Institute of…
How to run python experiments with Slurm and Conda? | by Hitesh Vaidya | Nov, 2023
source: getyarn.io/yarn-clip/368e3529-f540-4cfa-af28-d40a2ca2b99d As data scientists and researchers, efficiently managing multiple machine learning experiments is fundamental to our work. Tools like Slurm and Conda offer powerful capabilities that streamline the execution of experiments on high-performance computing clusters while ensuring environment consistency and reproducibility. In this blog, we will take a look…
Python Tools for Genomic Data Analysis: From Sequences to Structures | by Bao Tram Duong | Nov, 2023
Analyzing genomic data, from sequences to structures, is a critical aspect of bioinformatics. Python has a rich ecosystem of tools and libraries specifically designed for genomic data analysis. Here’s an overview of key tools and libraries for various stages of genomic data analysis: Description: Biopython is a comprehensive open-source collection…
SLURM: RuntimeError: CUDA error: CUDA-capable device(s) is/are busy or unavailable – distributed
I am trying to train EG3D on a slurm cluster using multiple gpus. But am getting the following error: File “/home/dmpribak/ondemand/data/sys/myjobs/projects/default/4/train.py”, line 395, in main launch_training(c=c, desc=desc, outdir=opts.outdir, dry_run=opts.dry_run) File “/home/dmpribak/ondemand/data/sys/myjobs/projects/default/4/train.py”, line 105, in launch_training torch.multiprocessing.spawn(fn=subprocess_fn, args=(c, temp_dir), nprocs=c.num_gpus) File “/home/dmpribak/.conda/envs/eg3d3/lib/python3.11/site-packages/torch/multiprocessing/spawn.py”, line 246, in spawn return start_processes(fn, args, nprocs, join,…
Bug in element-wise multiplication of `torch.sparse_csr_tensor`s on GPU – 0’s in result considered significant
🐛 Describe the bug Problem:The problem occurs when using the PyTorch version 2.1.1. The result of element-wise multiplication between two torch.sparse_csr_tensors consider 0s as significant values and retain them in their sparse form. This is not the expected behavior. Moreover, this bug occurs only when the operation is run on…
: error while loading shared libraries: libcrypto.so.1.0.0:
bcftools error: : error while loading shared libraries: libcrypto.so.1.0.0: 1 I’m having trouble installing bcftools using conda and mamba run the following code : conda install -c bioconda bcftools but there is Errors in the results bcftools error while loading shared libraries: libcrypto.so.1.0.0: cannot open shared object file: No such…
[Hiring] QA Engineer Release Manager @Lifebit Biotech Ltd at Lifebit Biotech Ltd
Nov 22, 2023 – Lifebit Biotech Ltd is hiring a remote QA Engineer Release Manager. 📍Location: Europe. At Lifebit, we carve our own path. We’re open-source pioneers and our driving mission is to revolutionise bioinformatics and biomedical data analysis forever. Our product, Lifebit CloudOS, is the world’s first federated genomics…
Building a Neural Network with PyTorch
Building your first neural network could seem like a formidable undertaking, but deep learning frameworks like PyTorch have made the task more accessible than ever. In this article, I’ll explain how to build a neural network using PyTorch—even if you’re brand new to neural networks. We at Gcore recently developed…
Multiple Conda Environments – The Littlest JupyterHub
mwrowe November 21, 2023, 11:27pm 1 I am running a TLJH server on AWS. Some of the Jupyter notebooks I am hosting have very different requirements. Rather than adding all of those (potentially conflicting) requirements into the default base environment at /opt/tljh/user, I would like to make multiple environments available,…
HDF5 brew issue // conda installation issue
I have used kallisto in the past, but now am struggling to get bootstrapping to work on a new computer (MacBook M1). I have searched through the issues that others encountered and tried three different methods of installation, but still no luck. Could you please help or direct me to…
JupyterHubSingleUser – Failed to connect to my Hub at http://127.0.0.1:8081/hub/api – JupyterHub – Jupyter Community Forum
After updating the base notebook image to Quay (base-notebook:2023-10-31) getting these connection errors in single user server spawn. Earlier used version jupyter/base-notebook:2023-04-14 this working without any errors. (python3.10 version used in working docker image) Environment:Used helm chart version “3.0.3” to deploy the 4.0.2 version of application on AWS EKS Cluster….
kubernetes – Issues with respect to JupyterHub’s volume mount and custom-built images
We have JupyterHub setup on Kubernetes (AWS, kops, self-managed, z2jh.jupyter.org/en/stable/). The JupyterHub setup involves us using custom built images for our environments. We have some internal packages installed inside those images that are essential for our developers to work. Please note that these are legacy systems that cannot be modified…
BaseRecalibrator takes forever to run. Any suggestions?
BaseRecalibrator takes forever to run. Any suggestions? 1 Hello, I am trying to run BaseRecalibrator tool from GATK package and it takes forever (more than 4 days per one bam file). The command I’m using is: gatk BaseRecalibrator -I NG-01_1_S1_dedup_bwa.bam -R /rumi/shams/genomes/hg38/hg38.fa –known-sites Mills_and_1000G_gold_standard.indels.hg38.vcf.gz –known-sites 1000G_phase1.snps.high_confidence.hg38.vcf.gz –known-sites Homo_sapiens_assembly38.dbsnp138.vcf -O NG-01_1_S1_dedup_bwa_BSQR.table…
Nccl_external fails while trying to compile pytroch from source – torch.compile
Hello, I’m trying to compile pytorch from source and encountering the following build error. $ CC=gcc-10 CXX=g++-10 python setup.py develop … [5995/6841] Linking CXX executable bin/HashStoreTest Warning: Unused direct dependencies: /home/netfpga/research/collective/pytorch/build/lib/libc10.so /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_intel_lp64.so.1 /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_gnu_thread.so.1 /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_core.so.1 /lib/x86_64-linux-gnu/libdl.so.2 /home/netfpga/anaconda3/envs/pytorch_base/lib/libgomp.so.1 [5996/6841] Performing build step for ‘nccl_external’ FAILED: nccl_external-prefix/src/nccl_external-stamp/nccl_external-build nccl/lib/libnccl_static.a /home/netfpga/research/collective/pytorch/build/nccl_external-prefix/src/nccl_external-stamp/nccl_external-build /home/netfpga/research/collective/pytorch/build/nccl/lib/libnccl_static.a cd /home/netfpga/research/collective/pytorch/third_party/nccl/nccl &&…
Pflowtts Pytorch – Open Source Agenda
P-Flow: A Fast and Data-Efficient Zero-Shot TTS through Speech Prompting Authors : Sungwon Kim, Kevin J Shih, Rohan Badlani, Joao Felipe Santos, Evelina Bhakturina,Mikyas Desta1, Rafael Valle, Sungroh Yoon, Bryan Catanzaro Affiliations: NVIDIA Status : Generated first sample (Check LJSpeech_Sample_100_epochs.wav) on 11/16/2023. Unofficial implementation of the paper P-Flow: A Fast…
How To Use Machine Learning In Python
Introduction Machine learning has revolutionized the way we approach problem-solving, data analysis, and decision-making. It is a branch of artificial intelligence that focuses on enabling computers to learn from data and improve their performance over time. With the growing availability of data and computing power, machine learning has become increasingly…
Pytorch 2.1 on slurm – PyTorch Forums
Hello, I upraded my pytorch to 2.1 and there seem to be issues when I am running it on GPU on the slurm cluster I use. File “/storage/home/hcoda1/6/user123/VIT/model_reg_square.py”, line 292, in <module> y_pred = model(x_masked, attn_mask) File “/storage/home/hcoda1/6/user123/.conda/envs/myenv/lib/python3.10/site-packages/torch/nn/modules/module.py”, line 1518, in _wrapped_call_impl return self._call_impl(*args, **kwargs) File “/storage/home/hcoda1/6/user123/.conda/envs/myenv/lib/python3.10/site-packages/torch/nn/modules/module.py”, line 1527, in…
01 Pytorch Basics?action=login – Notebook by Faizudeen Olanrewaju Kajogbola (faaizz)
How to run the code This tutorial is an executable Jupyter notebook hosted on Jovian (don’t worry if these terms seem unfamiliar; we’ll learn more about them soon). You can run this tutorial and experiment with the code examples in a couple of ways: using free online resources (recommended) or…
Building from source a pytorch wheel file with all the dependencies and Cuda+Cudnn included; Linux+Python 3.7, Cuda=11.2+Cudnn=8.1
I want to build torch v1.12.1 from source and create wheel with all the dependencies included into the wheel file . Additionally, to force the inclusion of all the Cuda and Cudnn -related stuff from my system into the wheel file. Similar task goes for torchvision v0.13.1.I have Ubuntu 22.04…
Pytorch and Cuda 12.3 – CUDA Setup and Installation
vivekvp November 15, 2023, 8:00am 1 Hello, I checked the Pytorch Start Locally Page and it shows Conda and Cuda 12.1 should work. For me, not a lot of luck CUDA not availableCUDA_VISIBLE_DEVICES: NoneUsing device: cputensor([[0.6572, 0.5879, 0.8894],[0.2627, 0.2033, 0.7407],[0.6683, 0.4645, 0.3171],[0.4389, 0.4759, 0.6664],[0.3716, 0.5192, 0.6393]])Torch version: 2.0.1 but when…
CUDA not available after installing PyTorch v1.8.0 via conda
Greetings,I am building a fine-grained image classifier with an already-implemented architecture which requires PyTorch v1.8.0. After following the installation tutorial in Previous PyTorch Versions | PyTorch and running: conda install pytorch==1.8.0 torchvision==0.9.0 torchaudio==0.8.0 cudatoolkit=11.1 -c pytorch -c conda-forge Everything installs correctly but PyTorch is not compiled for GPUs and torch.cuda.is_available()…
Software Engineer – open source
Who we are Quansight has its roots in the Python data science community. Our founders have had significant involvement in creating and maintaining NumPy, SciPy, Jupyter, Spyder, Dask, Conda, Numba, and other projects, as well as PyData NumFOCUS, and Anaconda. Our mission is to connect companies to open-source communities to…
How to update JupyterLab on Jupyterhub – JupyterLab
b0b November 12, 2023, 6:35pm 1 Hi All, I need to have a Docker image that runs Anaconda3 + Jupyterlab + Jupyterhub. I have following versions: Anaconda3-2022.10-Linux-x86_64 Jupyterhub v 4.0.2 JupyterLab v3.4.4 The problem is that I cannot update JupyterLab to more recent version, at least 3.6.6. If I do…
python – Docker with Rstudio & conda virtual env – unable to load R packages
I have this dockerfile: # Use the rocker/rstudio image with R version 4.1.2 FROM rocker/rstudio:4.1.2 # Install deps RUN apt-get update && apt-get install -y \ wget \ bzip2 \ bash-completion \ libxml2-dev \ zlib1g-dev \ libxtst6 \ libxt6 \ libhdf5-dev \ libcurl4-openssl-dev \ libssl-dev \ libfontconfig1-dev \ libcairo2-dev \…
Will sagemath return to the Fedora 39 repository?
bgregs (Brian Snyder) November 11, 2023, 5:12pm 1 I upgraded from Fedora 38 to 39 without paying close attention to the warnings about incompatible packages on my system (rookie mistake). After upgrading, I realized that sagemath is not in the Fedora 39 repository. Is this permanent or could sagemath come…
python – anaconda install pymc3 & tensorflow failed
I’m setting up Python environment for my new computer, when I try to use conda install pymc3 (or tensorflow), there always have a problem when solving the environment. (base) PS C: Users lzzhu>pymc3condainstall Channels: – defaults Platform: win-64 Collecting package metadata (repodata.json): done Solving environment: warning libmamba Added empty dependency…
Invalid indirect expansion error on Slurm
In attempting to run juicer.sh on a Slurm cluster, I am met with an “indirect expansion” error. Is there any quick fix? Here are the steps taken: downloaded the source code of the latest stable release, v.1.6 added a command within the master script activating a conda environment with the…
Regarding the error of MD run with CHARMM36 force field – User discussions
Praveen November 9, 2023, 11:28am 1 GROMACS version: 2023GROMACS modification: No Question:I am working in the MD simulation on GROMACS 2023 with Protein+Lipid (as ligand) complex. I have encountered an error, and I already tried all available option to perform MD run with Python version 3.7 and both versions of…
python – Issue Installing TensorFlow or PyTorch
I am trying to Install TensorFlow or PyTorch. I tried doing in a normal project and also a virtual project. These are the errors I get and i tried a bunch of different versions and reading documentation. pip install torch pip3 install torch –no-cache-dir pip install “tensorflow<2.11” pip install tensorflow==2.0…
phylogeny analysis
phylogeny analysis 1 Hi flock, I was working on phylogenetic analysis from whole-genome datasets, unfortunately I’m facing a challenge in running the plink2treemix.py script. I’m using python 3.8 version in 4.18.0-511.el8.x86_64 Linux server. I have attached the error for your reference, and I appreciate your contribution in solving the attached…
ILIAD: a suite of automated Snakemake workflows for processing genomic data for downstream applications | BMC Bioinformatics
Pipeline architecture and configuration file Genomic data processing poses a challenge for genetic research studies because it involves multiple program dependency installations, vast numbers of samples with raw data from various next-generation sequencing (NGS) platforms, and inconsistent genetic variant ID and/or positions among datasets. The Iliad suite of genomic data…
Nextflow bwa-mem2 pipeline/channel question
Hello, I’m trying to write a simple bwa script for my research, but it keeps failing. I have two questions in this post. The first code can be executed, but only the first paired fastq files are processed. Google search tells me it’s because the index_ch is a queue channel…
PyTorch Model to detect Pneumonia using Snowpark Container Service and Snowflake ML Features | by Karuna Nadadur | Snowflake | Nov, 2023
Author : Karuna Nadadur Co Author : Murali Gandhirajan Healthcare Delivery is undergoing rapid changes and evolution as health systems and clinics adopt digital technologies to effectively serve patients. As digital technologies get widely deployed in the patient care delivery ecosystem, it generates vast amounts of patient data. Most of…
bam file missing barcode and UMI info
Hi, I used STARsolo but my bam files, below, are missing barcode and UMI info: (/scratch/work/malonzm1/.conda_envs/scvi-env) [malonzm1@login3]/scratch/cs/pan-autoimmune/data/star/scRNAseq/GSE151177/SRR11848679% samtools view SRR11848679Aligned.out.bam|head -n5 NB500961:910:HJ5TWBGXC:1:23304:10007:9225 0 chr1 6100902 255 55M * 0 0 TTCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1 NB500961:910:HJ5TWBGXC:1:13111:23716:1741 0 chr1 6100902 255 4S51M * 0 0 GAGATTCGGAGCCCACACTGTTTCCCACTCAGCTTTGTGCTAATATCCAAGGTCC…
python 3.x – llama2 running pytorch produces a “failed to create process”
I am trying to run llama2 on my local machine. I have followed the documentation available on the github repository github.com/facebookresearch/llama thank you in advance for your support install anaconda clone the llama repository github.com/facebookresearch/llama download the models create a virtual environment named llama2 install pytorch on Anaconda conda install…
Activate cuda support for Pytorch / pipenv
I followed this answer to install Pytorch with cuda support in my pipenv (running on a Windows machine). My Pipfile looks like this: […] [[source]] name = “pytorch” url = “https://download.pytorch.org/whl/cu118” verify_ssl = false [packages] […] torch = {index = “pytorch”,version = “==2.1.0”} torchvision = {index = “pytorch”,version = “==0.16.0”}…
sequence alignment – I can’t make mafft run inside my program
This is easy because MAFFT is installed via Conda, but you have not activated that Conda environment, thus it will not give you access to the program. If you type … conda activate labinf mafft This will now work. To activate this inside a shell script you simply include the…
Torch doesn’t detect GPU on Azure VM – windows
Hi everyone, It’s my first time trying to use torch with a GPU and I’m struggling. I’m using an Azure Virtual Machine (NCasT4_v3-series) which requires manual configuration as detailed here: learn.microsoft.com/en-us/azure/virtual-machines/windows/n-series-driver-setup. This was apparently successful. Then I had to download and install CUDA 12.1 from here: developer.nvidia.com/cuda-downloads. This also seemed…
picrust2 installation error on mac m2
I am trying to install Picrust2 on a mac m2 and am getting installation errors regarding incompatible packages (perhaps a type or missing channel). Looking for: [‘picrust2=2.5.2’] bioconda/osx-arm64 124.0 B @ 154.0 B/s 0.8s…
rpy2 package
rpy2 package 0 Hello, What is your opinion on the use of rpy2 for executing an R script within a Conda environment from a Python script? I’m currently facing a scenario where I have an R script and the requirement to run it within a Conda environment through a Python…
Installing SageMath on macOS Big Sur 11.1
Hi, I also posted recently about some of my attempts to get Sage running on my Big Sur apple M1 macbook pro here a few days ago: groups.google.com/g/sage-devel/c/_vYkTlLRWWY In particular, > Binaries for Sage 9.2 from the Sage download website > will not work for macOS 11 Big Sur. … I…
Snakemake issue with wrappers
I have issues when running a wrapper of BWA mem with Snakemake. The error message “No module named ‘snakemake_wrapper_utils’” appear (see below). However, when checking if the package is installed in Python, I found the following: import snakemake_wrapper_utils print(snakemake_wrapper_utils.__version__) 0.1.0 Did anyone have this problem? Would you know why there…
How to replace the private image forcely? – Zero to JupyterHub on Kubernetes
Hello, members 1. Quetions. I’m creating a custom image for Z2JH. When I update the private image, I want to replace the image.(It means I want to use the new image in Z2JH).But I don’t know how to force-pull the image.Does anyone know how to do it? configuration. singleuser: image:…
Pytorch CPU OOM kills ssh server on linux
I’ve run into a problem that pytorch (tested with 2.0.1+cu117) does not fail gracefully when CPU OOM occurs. Specifically, I lose all ssh connections and Xserver access to the VM or bare metal machine. I’ve not tested if this occurs on any other os. the only solution I’ve found is…
Failed to download IlluminaHumanMethylationEPICv2anno.20a1.hg38
Failed to download IlluminaHumanMethylationEPICv2anno.20a1.hg38 1 I am currently working on illumina EPIC v1 and v2 data. When trying to annotate the v2 data I am unable to download the annotation package (note: the manifest package works fine). I get the error that the download failed and that ‘rhdf5filters’ is old….
python – cuda and pytorch version not installed on anaconda
my gpu is GeForce 940MX and my OS is Win 10. in anaconda3 i want to have my gpu for computation. at first i have to install cuda on my system. so i try to install cuda 9.2 and then i create a new environment and try this code according…
PackagesNotFoundError on conda for pytorch
I want to install Pytorch 1.12 version, the CUDA version is 11.3, the python version is 3.9.18. Using the command as the following: conda install -c conda.anaconda.org/conda-forge/ pytorch==1.12.0 torchvision==0.13.0 torchaudio==0.12.0 cudatoolkit=11.3 -c pytorch But, it reports the error: (DL) C:\Users\daiyij>conda install -c conda.anaconda.org/conda-forge/ pytorch==1.12.0 torchvision==0.13.0 torchaudio==0.12.0 cudatoolkit=11.3 -c pytorch Collecting…
python – PyTorch Dataset is being passed a Subset instead of the original Polars DataFrame
I have a custom Dataset class which returns a sequence from a Polars DataFrame. class SequenceDataset(Dataset): def __init__(self, dataframe): self.data = dataframe def __len__(self): return len(self.data) def __getitem__(self, index): row = self.data.row(index, named=True) return row[‘sequence’] When I do a random split: sequence_dataset = SequenceDataset(train) seed_generator = torch.Generator().manual_seed(7) train, validation =…
Torch not compiled with CUDA enabled – CUDA Setup and Installation
Hi, I’m working on the Ubuntu 20.04 with GTX 1080 Ti. I created a conda env and assign the python=3.9. Later i installed cudatoolkit 11.8 with the commandconda install -c “nvidia/label/cuda-11.8.0” cuda-toolkitand installed pytorch withconda install pytorch torchvision torchaudio pytorch-cuda=11.8 -c pytorch -c nvidia. But then the sequence of commands:…
[Error] importing pymc3 with theano-pymc: ‘numpy’ has no attribute ‘bool’ – v3
Hi, I was trying to install pymc3 v3.11.4 on Anaconda 23.9.0 with Python v3.8.10 on Ubuntu 22.04.3 LTS.Therefore I am using the module theano-pymc but when trying to import pymc3, I’m getting the error >>> import pymc3 /home/julian/anaconda3/envs/python3.8.10_/lib/python3.8/site-packages/theano/scalar/basic.py:2412: FutureWarning: In the future `np.bool` will be defined as the corresponding NumPy…
python – Error in snakemake when running conda envs in container
I am facing an issue when running snakemake with a container and conda. Let me explain better. I am developing a workflow (locally) in snakemake, where some rules use a conda env (defined in /envs/env.yaml) and other rules use wrappers (so they also are based on conda envs). An example…
Precompiling IJulia times out – Kernels
I’m having an issue starting Julia kernels and the Pluto interface when using the jupyter/datascience-notebook image as a base to build my own image. The issues occur when running locally on my Macbook (M1) and when used on a JupyterHub hosted on GCP. When using the jupyter/datascience-notebook image “as is”,…
Custom Z2JH image creation using jupyter-repo2docker – Zero to JupyterHub on Kubernetes
Hello, members. 1. Goal I would like to create a custom image for Z2JH using jupyter-repo2docker command. jupyter-repo2docker github.com/norvig/pytudes works fine. 2. Question Does Z2JH use jupyter-repo2docker for creating a support images (ex. jupyter/pyspark-notebook) ? Is Z2JH base_image jupyter/base-notebook? Does anyone know how to avoid this error? (Maybe macOS docker…
huggingface transformers – Hugging face: Unable to find tune Whisper using Seq2SeqTrainer on kaggle
I made a copy of this kaggle notebook: www.kaggle.com/code/imtiazprio/fast-whisper-large-v2-fine-tuning-with-lora Which had ran successfully as you can see from its output. But now I’m running the same notebook by copying it on my account it shows me this error. ————————————————————————— RuntimeError Traceback (most recent call last) Cell In[16], line 2 1…
Dockerfile for Jupyter Notebook with PySpark, Deequ, and PyTorch
A Dockerfile that sets up a Jupyter Notebook environment with PySpark, Deequ, and PyTorch. This function provides a Dockerfile that sets up a Jupyter Notebook environment with PySpark, Deequ, and PyTorch. The Dockerfile is based on the jupyter/base-notebook image and installs the necessary packages using conda. It sets the environment…
flask-openapi3
Generate REST API and OpenAPI documentation for your Flask project. Flask OpenAPI3 is a web API framework based on Flask. It uses Pydantic to verify data and automatic generation of interaction documentation: Swagger, ReDoc and RapiDoc. The key features are: Easy to code: Easy to use and easy to learn…
Installing Tensorflow and Pytorch with GPU/CUDA access: Question
This question does not appear to be about programming within the scope defined in the help center. Pytorch Installed the following versions in Ubuntu Nvidia Driver >=535 Cuda 12.2 ( Global Initialization) 1st Method: Tensorflow (Problem Starts when installing Tensorflow) Above mentioned nvidia drivers Above…
conda – Installing in miniconda `torchvision==0.4.1` and `pytorch==1.3.0`
I am trying to install torchvision==0.4.1 and pytorch==1.3.0 in a virtual conda environment. After I write conda install pytorch==1.3.0 torchvision==0.4.1 -c pytorch the following response occurs. Collecting package metadata (current_repodata.json): / WARNING conda.models.version:get_matcher(556): Using .* with relational operator is superfluous and deprecated and will be removed in a future version…
How to Install PyTorch on Ubuntu 22.04
Introduction PyTorch is a machine-learning framework that includes a library of tools used to build and train deep learning models. It’s highly extensible and integrates with Python to enable the fast computation of tasks. Follow the steps in this guide to install PyTorch on a Ubuntu 22.04 Server. Prerequisites Installation…
Unable to install Kmergenie
Unable to install Kmergenie 3 Hello there, I’m trying to install KmerGenie following the README file. I downloaded the kmergeni-1.6892.tar.gz, unzipped it and did make under the folder, but it didn’t work. It shows like the following julibio@DESKTOP-OTF949V ~/curso-bio/kmergenie/kmergenie-1.7051/kmergenie-1.7051 $ make cd ntCard && ./configure && make checking for a…
python – Pytorch won’t install on Windows 11
I need Pytorch for LLAMA AI, but Pytorch won’t install. I’m currently getting this error when I try to install Pytorch 2.1.0 on windows 11 CPU with pip for Python. ERROR: Could not find a version that satisfies the requirement torch (From versions: None) ERROR: No matching distribution found for…