Tag: conda

How to Analyze Coronavirus RNA with Python (Part 2: Installing Biopython) | by Proto Bioengineering | Feb, 2024

The Biopython logo Biopython is a set of tools for doing all sorts of genomics tasks: reading DNA and RNA, aligning sequences, analyzing similarities between sequences, and more. This is the second part in a series on analyzing coronavirus RNA with Python. Here we’ll install Biopython and use it to…

Continue Reading How to Analyze Coronavirus RNA with Python (Part 2: Installing Biopython) | by Proto Bioengineering | Feb, 2024

python – Within Jetbrain DataSpell Jupyter Notbook IPython.Display.SVG Images are not displayed fully/cut off

I am using Dataspell to work in a Jupyter Notebook with an conda environment. When I try to display a IPython.display.SVG graphic, it is not rendered correctly and parts are cut off. I am following along this tutorial. When I use the SVG function imported from from IPython.display import SVG…

Continue Reading python – Within Jetbrain DataSpell Jupyter Notbook IPython.Display.SVG Images are not displayed fully/cut off

Diving into PyTorch: A Beginner’s Tale of Contribution | by Weinheimergracia | Dec, 2023

Hey there, fellow code wranglers and AI enthusiasts! I’m Cami, your friendly neighborhood tech explorer, and I’m about to take you on a wild ride through my latest adventure: contributing to PyTorch without being an expert in it. Yes, you read that right! My Unexpected Journey into PyTorch So, I…

Continue Reading Diving into PyTorch: A Beginner’s Tale of Contribution | by Weinheimergracia | Dec, 2023

‘Resources’ object has no attribute ‘tmpdir’

Snakemake error AttributeError: ‘Resources’ object has no attribute ‘tmpdir’ 0 I have built a Snakemake pipeline which has been designed for paired-end reads. I have made a trial with single-end reads, and got this error. I am not sure it is related to the change of reads design, and to…

Continue Reading ‘Resources’ object has no attribute ‘tmpdir’

How to setup the pipeline of the RNA-Seq FASTQ file processing (macOS version)

This is a guide for preparing for importing RNA-Seq FASTQ files to Subio Platform on a Mac computer. If you use a Windows10 machine, please go to the guide for Windows10. Subio Platform utilizes the following tools to process the RNA-Seq FASTQ files. fastp to trim adapters and filter low-quality…

Continue Reading How to setup the pipeline of the RNA-Seq FASTQ file processing (macOS version)

Unix and Shell Scripting for Bioinformatics course

News:Unix and Shell Scripting for Bioinformatics course 0 Dear all, There are still a few seats available for our online course on Unix and Shell Scripting for Bioinformatics! Dates: 15-19 January 2024 Course Overview: Dive into the world of high-throughput biology Master essential Unix commands for data analysis Connect to…

Continue Reading Unix and Shell Scripting for Bioinformatics course

Unable to install bioconda and bowtie

Unable to install bioconda and bowtie 0 ➜ ~ conda install -c “bioconda/label/cf201901” bowtie Collecting package metadata (current_repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. Collecting package metadata (repodata.json): done Solving environment: failed with initial frozen solve. Retrying with flexible solve. PackagesNotFoundError: The following packages…

Continue Reading Unable to install bioconda and bowtie

[llvm-bugs] [Bug 75428] clang crash when build IPEX code.

Issue 75428 Summary clang crash when build IPEX code. Labels clang Assignees Reporter xuhancn The error msg: “`cmd Stack dump: 0. Program arguments: /usr/bin/clang++ -DAT_PARALLEL_OPENMP=1 -DUSE_C10D_GLOO -DUSE_DISTRIBUTED -DUSE_RPC -DUSE_TENSORPIPE -Dintel_ext_pt_cpu_EXPORTS -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/aten -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/utils -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/jit -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/jit -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/utils -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/mkl-dnn/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/csrc/cpu/tpp -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/libxsmm/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/build/Release/csrc/cpu/csrc/cpu/cpu_third_party/ideep/mkl-dnn/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/include -I/home/xu/anaconda3/envs/ipex_cpu/include/python3.12 -I/home/xu/anaconda3/envs/ipex_cpu/include -I/home/xu/anaconda3/envs/ipex_cpu/lib/python3.12/site-packages/torch/include/torch/csrc/api/include -I/home/xu/conda_spaces/ipex_cpu/frameworks.ai.pytorch.ipex-cpu/third_party/ideep/mkl-dnn/src/../include -isystem /home/xu/anaconda3/envs/ipex_cpu/lib/python3.12/site-packages/torch/include -fPIC…

Continue Reading [llvm-bugs] [Bug 75428] clang crash when build IPEX code.

Linux: segmentation fault (core dumped)

Linux: segmentation fault (core dumped) 0 Hey everyone, When trying to download any programs using “conda install -c bioconda” I get the following error: Segmentation fault (core dumped) I am not sure what this means or how to go about fixing it. Any input is appreciated! conda miniconda3 Linux •…

Continue Reading Linux: segmentation fault (core dumped)

How to use protologger in Mac Terminal

How to use protologger in Mac Terminal 0 Hey there folks, I’ve been trying conda recently however I’m still struggling, I have come to encounter protologger git hub, and also galaxy, but was wondering if I’m able to perform batch upload of genome in protologger? since they need both 16S…

Continue Reading How to use protologger in Mac Terminal

What Is JAX in Machine Learning

What Is JAX? JAX, short for “Just Another Extension” or “JAX Autograd”, is an open-source Python library that provides a powerful and efficient framework for high-performance machine learning and scientific computing. Developed by the Google Brain team, JAX bridges the gap between traditional numerical computing libraries and machine learning frameworks…

Continue Reading What Is JAX in Machine Learning

Navigating TensorFlow Configuration in RStudio: A Guide for Diverse Environments | by Kamrul | Dec, 2023

1. Installing the Right Python Version Recommended Version: Python 3.10.x Optimal balance between new features and stability. Compatible with TensorFlow and avoids many common issues. Installation: Visit the Python website and select a 3.10.x version. Verification: python –version Troubleshooting: Ensure Python is correctly added to your system PATH. 2. Installing…

Continue Reading Navigating TensorFlow Configuration in RStudio: A Guide for Diverse Environments | by Kamrul | Dec, 2023

python – PyTorch Installation Question:PyTorch 0.4.1 – CUDA 9.2 on Windows 11

My understanding of deep learning is limited, so I hope to learn it through PyTorch. I prefer to start with an older version of PyTorch. I downloaded and installed CUDA 9.2 on Windows 11 , and my CUDA driver version is CUDA 12.1 nvcc -V nvcc: NVIDIA (R) Cuda compiler…

Continue Reading python – PyTorch Installation Question:PyTorch 0.4.1 – CUDA 9.2 on Windows 11

bash – Running task once in a slurm script with job array

I am running a couple of jobs in parallel using the following slurm script: #!/bin/bash #SBATCH –job-name=”example” #SBATCH –account=”st-me-1″ #SBATCH –array=0-9 #SBATCH –nodes=1 #SBATCH –ntasks-per-node=8 #SBATCH –time=1:00:00 #SBATCH –mem=32000mb # Change directory into the job dir cd $SLURM_SUBMIT_DIR # Load conda environment source ~/.bashrc # Activate conda environment conda activate…

Continue Reading bash – Running task once in a slurm script with job array

Can’t train deep learning models using GPU in PyTorch even with a graphics card? (2023/12 latest version) | by Michael Chen | Dec, 2023

As a Windows user, I’m often plagued by environmental issues. These problems have also led many friends around me to give up on their learning journey. Hence, today I want to share about setting up the environment on Windows to enable PyTorch to utilize GPU for training models. If you…

Continue Reading Can’t train deep learning models using GPU in PyTorch even with a graphics card? (2023/12 latest version) | by Michael Chen | Dec, 2023

sparklyr – Databricks Connect v2

Last updated: Thu Dec 7 16:28:19 2023 Intro Databricks Connect enables the interaction with Spark clusters remotely. It is based on Spark Connect, which enables remote connectivity thanks to its new decoupled client-server architecture. This allows users to interact with the Spark cluster without having to run the jobs from…

Continue Reading sparklyr – Databricks Connect v2

GROMACS MD Simulation – proteomics

I received this error when using the GROMACS initial setup tool WARNING: No ICDs were found. Either, Install a conda package providing a OpenCL implementation (pocl, oclgrind, intel-compute-runtime, beignet) or Make your system-wide implementation visible by installing ocl-icd-system conda package. jennaj December 7, 2023, 9:27pm 2 Hi @Vibha_Rao That is…

Continue Reading GROMACS MD Simulation – proteomics

Some issue about itsxpress2 plugin in QIIME2-202309 – Community Plugin Support

ZhangSR (June) December 7, 2023, 6:36am 1 Hi~ When I updated the ITSxpress within QIIME2-202309 following the updated tutorial here github.com/USDA-ARS-GBRU/itsxpress-tutorial/blob/master/ITSxpress-tutorial.md, there were some confusions. I updated the itsxpress by conda install -c bioconda itsxpress and then qiime dev refresh-cache under the QIIME2 environment I failed to call itsxpress by…

Continue Reading Some issue about itsxpress2 plugin in QIIME2-202309 – Community Plugin Support

JupyterHub server spawning never completes; new JupyerHub admin – JupyterHub

Hello, I’ve recently started a position responsible for a JupyterHub installation as part of an HPC environment; the old team left without leaving much in the way of documentation, and I’ve never worked on JupyterHub before, so please bear with me. When launching JupyterHub, the system will stay on the…

Continue Reading JupyterHub server spawning never completes; new JupyerHub admin – JupyterHub

How to use Nextflow to call scripts from different environments?

How to use Nextflow to call scripts from different environments? 0 I have the following conda environments: wf-preprocess_env wf-assembly_env Each environment has unique dependencies installed. I have 3 scripts: preprocess.py which I use with wf-preprocess_env environment assembly.py and assembly-long.py which I use with wf-assembly_env How can I use Nextflow to…

Continue Reading How to use Nextflow to call scripts from different environments?

Calculate GC content for entire chromosome

If you’re comfortable using Python, I’ve created a script that calculates the GC content and GC-skew for each contig, scaffold, or chromosome in a fasta file. This is specifically designed for generating data for a circos plot. To use the script, make sure you have Biopython installed in your conda…

Continue Reading Calculate GC content for entire chromosome

error when installing gistic2 using conda

error when installing gistic2 using conda 0 Dear all, How to fix the error when using conda to install the gistic2? I already use conda to create a new directory/environment, and then conda install -hcc gistic2 as the conda website shows anaconda.org/HCC/gistic2 conda install -c hcc gistic2 Collecting package metadata…

Continue Reading error when installing gistic2 using conda

Panic: Could not run ‘torchvision::roi_pool’ with arguments from the ‘CUDA’ backend – Jetson Nano

Hi, Team! I have such errors, when I run my code in docker container: root@de87551d73cf:/app/src# ./main WARN[0032] CUDA is valid WARN[0044] CUDA is valid INFO[0044] Forwarding… [W TensorImpl.h:1156] Warning: Named tensors and all their associated APIs are an experimental feature and subject to change. Please do not use them for…

Continue Reading Panic: Could not run ‘torchvision::roi_pool’ with arguments from the ‘CUDA’ backend – Jetson Nano

Issue with Accessing Thermo Data in Pylammps – LAMMPS Installation

Dear members of the LAMMPS mailing list, I have been attempting to build and install the LAMMPS Python interface (Pylammps) to leverage the advantages of accessing thermos data. However, I am encountering the following error: Based on my understanding from the documentation, if I set up a simulation with a…

Continue Reading Issue with Accessing Thermo Data in Pylammps – LAMMPS Installation

Function ‘SubBackward0’ returned nan values in its 1th output – autograd

I am trying to implement a model where the forward function calls to an external function that computes the values using the model’s parametes. class R_model(torch.nn.Module): def __init__(self,) : super().__init__() self.Kx = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Ky = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) self.Kz = torch.nn.Parameter(torch.randint(-200, -100, (1,)).float()*0.0001) def forward(self): return generate_r(Kx=self.Kx, Ky=self.Ky,…

Continue Reading Function ‘SubBackward0’ returned nan values in its 1th output – autograd

linux – How to install sox for PyTorch audio?

I want to run PyTorch code on Linux. I start a virtual machine on AWS with AMI Deep Learning PyTorch, but, surprisingly, PyTorch is not installed. So I run: python3 -m pip install torch torchaudio When I load a WAV file, I get this error: RuntimeError: Couldn’t find appropriate backend…

Continue Reading linux – How to install sox for PyTorch audio?

Can’t install hisat2 with miniconda

Can’t install hisat2 with miniconda 0 I’ve been trying to install hisat2 with Miniconda but I keep getting this error. Miniconda is updated and seemingly installed. Also I’m on Mac OS. Please Advise. Channels: bioconda default defaults conda-forge Platform: osx-arm64 Collecting package metadata (repodata.json): done Solving environment: failed PackagesNotFoundError: The…

Continue Reading Can’t install hisat2 with miniconda

Previous PyTorch Versions | PyTorch

Installing previous versions of PyTorch We’d prefer you install the latest version, but old binaries and installation instructions are provided below for your convenience. Commands for Versions >= 1.0.0 v2.1.0 Conda OSX # conda conda install pytorch==2.1.0 torchvision==0.16.0 torchaudio==2.1.0 -c pytorch Linux and Windows # CUDA 11.8 conda install pytorch==2.1.0…

Continue Reading Previous PyTorch Versions | PyTorch

qiime2 illegal instruction – Technical Support

Andrea_G (Andrea Gatti) November 28, 2023, 2:19pm 1 Hello, I have to start working on a cluster and I tired to install Qiime2 in a conda environment, but I was reported with an error during Qiime2 installation, specifying: Preparing transaction: done Verifying transaction: – SafetyError: The package for r-base located…

Continue Reading qiime2 illegal instruction – Technical Support

Pytorch for CUDA12.0 – PyTorch Live

Found conflicts! Looking for incompatible packages.This can take several minutes. Press CTRL-C to abort.failed UnsatisfiableError: The following specifications were foundto be incompatible with the existing python installation in your environment: Specifications: pytorch → python[version=‘>=2.7,<2.8.0a0|>=3.10,<3.11.0a0|>=3.11,<3.12.0a0|>=3.8,<3.9.0a0|>=3.9,<3.10.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] torchaudio → python[version=‘>=3.10,<3.11.0a0|>=3.11,<3.12.0a0|>=3.9,<3.10.0a0|>=3.8,<3.9.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] torchvision → python[version=‘>=2.7,<2.8.0a0|>=3.10,<3.11.0a0|>=3.8,<3.9.0a0|>=3.9,<3.10.0a0|>=3.11,<3.12.0a0|>=3.7,<3.8.0a0|>=3.6,<3.7.0a0|>=3.5,<3.6.0a0’] Your python: python=3.12 If python is on the left-most side…

Continue Reading Pytorch for CUDA12.0 – PyTorch Live

Unable to Use JupyterLab in Development Combining JupyterLab and JupyterHub – JupyterHub

Hello, thank you for providing such a wealth of resources in the community, which has made my development process quite smooth. Problem description:I’d like to inquire about integrating JupyterLab and JupyterHub for managing group-related tasks. I’ve downloaded both repositories locally and used pip install -e “.[dev,test]” within the JupyterLab project….

Continue Reading Unable to Use JupyterLab in Development Combining JupyterLab and JupyterHub – JupyterHub

Is not compatible with the current PyTorch installation

Eunhae_Lee (Eunhae Lee) November 28, 2023, 7:28am 1 Hello, I’m using Mobaxterm to access a server to work on training a model when I try to run the command to launch it, I have his error: NVIDIA GeForce RTX 3090 with CUDA capability sm_86 is not compatible with the current…

Continue Reading Is not compatible with the current PyTorch installation

python – How can I solve conflict issue installing pymc3?

I’ve tried to install pymc3 but the dependency issue still remained. C:\Users\sykan>conda install -c conda-forge pymc3 Channels: – conda-forge – defaults Platform: win-64 Collecting package metadata (repodata.json): done Solving environment: \ warning libmamba Added empty dependency for problem type SOLVER_RULE_UPDATE failed LibMambaUnsatisfiableError: Encountered problems while solving: – nothing provides vc…

Continue Reading python – How can I solve conflict issue installing pymc3?

Cineca-ai – HPC Cineca

Version: 2.02 (G100) Availability: GALILEO100 Target: all Official web site: gitlab.www.hpc.cineca.it/sorland2/cineca-ai Related Commands: If you wish to activate the default environment:        $ conda activate $CINECA_AI_ENV   – If you wish to create a personal conda env with your installations, you can use the local conda channel to access…

Continue Reading Cineca-ai – HPC Cineca

finished abnormally, OS return value: 21

SPAdes error: finished abnormally, OS return value: 21 1 I’m having trouble using SPAdes. I’m using SPAdes to do paired end data assembly and I’m getting an unusual stop. error code: finished abnormally, OS return value: 21 Do you know how to resolve this issue? Environment: conda, SPAdes genome assembler…

Continue Reading finished abnormally, OS return value: 21

python – Different behavior in the same conda-pytorch env on different GPUs

Want to improve this question? Add details and clarify the problem by editing this post. I have a project that uses conda env with old pytorch version. It works smoothly if I use Nvidia V100, but it won’t run on other GPUs (I’ve tried RTX3080, TeslaA10, RTX2080TI, TeslaA2, TeslaT4) using…

Continue Reading python – Different behavior in the same conda-pytorch env on different GPUs

Building Pytorch for Conda from source with GLIBCXX_USE_CXX11_ABI=1

GdMacmillan (Gordon MacMillan) November 26, 2023, 4:17pm 1 Before I begin, I’ve checked the topics similar to this one and they all have linking issues and PR’s that are outdated. I am attempting to compile the libtorch binaries and build pytorch from source with GLIBCXX_USE_CXX11_ABI=1 The reason for this, I…

Continue Reading Building Pytorch for Conda from source with GLIBCXX_USE_CXX11_ABI=1

Jetson Orin, TensorRT, CUDA 11.8 for PyTorch 2.0.0 – Jetson AGX Orin

I’m I going crazy here or is it impossible to get this combination to work. docs.nvidia.com Support Matrix :: NVIDIA Deep Learning TensorRT Documentation These support matrices provide a look into the supported platforms, features, and hardware capabilities of the NVIDIA TensorRT 8.6.1 APIs, parsers, and layers. I need cuda…

Continue Reading Jetson Orin, TensorRT, CUDA 11.8 for PyTorch 2.0.0 – Jetson AGX Orin

python – PyTorch distributed from two ec2 instances hangs

# env_vars.sh on rank 0 machine #!/bin/bash export MASTER_PORT=23456 export MASTER_ADDR=… # same as below, private ip of machine 0 export WORLD_SIZE=2 export GLOO_SOCKET_IFNAME=enX0 export RANK=0 # env_vars.sh on rank 1 machine #!/bin/bash export MASTER_PORT=23456 export MASTER_ADDR=… # same as above export WORLD_SIZE=2 export GLOO_SOCKET_IFNAME=enX0 export RANK=1 # on rank…

Continue Reading python – PyTorch distributed from two ec2 instances hangs

Head of the Medical Bioinformatics platform (m/f/d) – Kiel

Das Universitätsklinikum Schleswig-Holstein (UKSH) verbindet internationale Spitzenforschung mit interdisziplinärer Krankenversorgung. Wir sind einziger Maximalversorger und größter Arbeitgeber des Landes. Unsere mehr als 14.500 Mitarbeiter*innen stellen eine höchst individuelle Versorgung sicher – unverzichtbar für die Menschen in Schleswig-Holstein.The Institute of Clinical Molecular Biology (IKMB)The Medical Faculty together with the Institute of…

Continue Reading Head of the Medical Bioinformatics platform (m/f/d) – Kiel

How to run python experiments with Slurm and Conda? | by Hitesh Vaidya | Nov, 2023

source: getyarn.io/yarn-clip/368e3529-f540-4cfa-af28-d40a2ca2b99d As data scientists and researchers, efficiently managing multiple machine learning experiments is fundamental to our work. Tools like Slurm and Conda offer powerful capabilities that streamline the execution of experiments on high-performance computing clusters while ensuring environment consistency and reproducibility. In this blog, we will take a look…

Continue Reading How to run python experiments with Slurm and Conda? | by Hitesh Vaidya | Nov, 2023

Python Tools for Genomic Data Analysis: From Sequences to Structures | by Bao Tram Duong | Nov, 2023

Analyzing genomic data, from sequences to structures, is a critical aspect of bioinformatics. Python has a rich ecosystem of tools and libraries specifically designed for genomic data analysis. Here’s an overview of key tools and libraries for various stages of genomic data analysis: Description: Biopython is a comprehensive open-source collection…

Continue Reading Python Tools for Genomic Data Analysis: From Sequences to Structures | by Bao Tram Duong | Nov, 2023

SLURM: RuntimeError: CUDA error: CUDA-capable device(s) is/are busy or unavailable – distributed

I am trying to train EG3D on a slurm cluster using multiple gpus. But am getting the following error: File “/home/dmpribak/ondemand/data/sys/myjobs/projects/default/4/train.py”, line 395, in main launch_training(c=c, desc=desc, outdir=opts.outdir, dry_run=opts.dry_run) File “/home/dmpribak/ondemand/data/sys/myjobs/projects/default/4/train.py”, line 105, in launch_training torch.multiprocessing.spawn(fn=subprocess_fn, args=(c, temp_dir), nprocs=c.num_gpus) File “/home/dmpribak/.conda/envs/eg3d3/lib/python3.11/site-packages/torch/multiprocessing/spawn.py”, line 246, in spawn return start_processes(fn, args, nprocs, join,…

Continue Reading SLURM: RuntimeError: CUDA error: CUDA-capable device(s) is/are busy or unavailable – distributed

Bug in element-wise multiplication of `torch.sparse_csr_tensor`s on GPU – 0’s in result considered significant

🐛 Describe the bug Problem:The problem occurs when using the PyTorch version 2.1.1. The result of element-wise multiplication between two torch.sparse_csr_tensors consider 0s as significant values and retain them in their sparse form. This is not the expected behavior. Moreover, this bug occurs only when the operation is run on…

Continue Reading Bug in element-wise multiplication of `torch.sparse_csr_tensor`s on GPU – 0’s in result considered significant

: error while loading shared libraries: libcrypto.so.1.0.0:

bcftools error: : error while loading shared libraries: libcrypto.so.1.0.0: 1 I’m having trouble installing bcftools using conda and mamba run the following code : conda install -c bioconda bcftools but there is Errors in the results bcftools error while loading shared libraries: libcrypto.so.1.0.0: cannot open shared object file: No such…

Continue Reading : error while loading shared libraries: libcrypto.so.1.0.0:

[Hiring] QA Engineer Release Manager @Lifebit Biotech Ltd at Lifebit Biotech Ltd

Nov 22, 2023 – Lifebit Biotech Ltd is hiring a remote QA Engineer Release Manager. 📍Location: Europe. At Lifebit, we carve our own path. We’re open-source pioneers and our driving mission is to revolutionise bioinformatics and biomedical data analysis forever. Our product, Lifebit CloudOS, is the world’s first federated genomics…

Continue Reading [Hiring] QA Engineer Release Manager @Lifebit Biotech Ltd at Lifebit Biotech Ltd

Building a Neural Network with PyTorch

Building your first neural network could seem like a formidable undertaking, but deep learning frameworks like PyTorch have made the task more accessible than ever. In this article, I’ll explain how to build a neural network using PyTorch—even if you’re brand new to neural networks. We at Gcore recently developed…

Continue Reading Building a Neural Network with PyTorch

Multiple Conda Environments – The Littlest JupyterHub

mwrowe November 21, 2023, 11:27pm 1 I am running a TLJH server on AWS. Some of the Jupyter notebooks I am hosting have very different requirements. Rather than adding all of those (potentially conflicting) requirements into the default base environment at /opt/tljh/user, I would like to make multiple environments available,…

Continue Reading Multiple Conda Environments – The Littlest JupyterHub

HDF5 brew issue // conda installation issue

I have used kallisto in the past, but now am struggling to get bootstrapping to work on a new computer (MacBook M1). I have searched through the issues that others encountered and tried three different methods of installation, but still no luck. Could you please help or direct me to…

Continue Reading HDF5 brew issue // conda installation issue

JupyterHubSingleUser – Failed to connect to my Hub at http://127.0.0.1:8081/hub/api – JupyterHub – Jupyter Community Forum

After updating the base notebook image to Quay (base-notebook:2023-10-31) getting these connection errors in single user server spawn. Earlier used version jupyter/base-notebook:2023-04-14 this working without any errors. (python3.10 version used in working docker image) Environment:Used helm chart version “3.0.3” to deploy the 4.0.2 version of application on AWS EKS Cluster….

Continue Reading JupyterHubSingleUser – Failed to connect to my Hub at http://127.0.0.1:8081/hub/api – JupyterHub – Jupyter Community Forum

kubernetes – Issues with respect to JupyterHub’s volume mount and custom-built images

We have JupyterHub setup on Kubernetes (AWS, kops, self-managed, z2jh.jupyter.org/en/stable/). The JupyterHub setup involves us using custom built images for our environments. We have some internal packages installed inside those images that are essential for our developers to work. Please note that these are legacy systems that cannot be modified…

Continue Reading kubernetes – Issues with respect to JupyterHub’s volume mount and custom-built images

BaseRecalibrator takes forever to run. Any suggestions?

BaseRecalibrator takes forever to run. Any suggestions? 1 Hello, I am trying to run BaseRecalibrator tool from GATK package and it takes forever (more than 4 days per one bam file). The command I’m using is: gatk BaseRecalibrator -I NG-01_1_S1_dedup_bwa.bam -R /rumi/shams/genomes/hg38/hg38.fa –known-sites Mills_and_1000G_gold_standard.indels.hg38.vcf.gz –known-sites 1000G_phase1.snps.high_confidence.hg38.vcf.gz –known-sites Homo_sapiens_assembly38.dbsnp138.vcf -O NG-01_1_S1_dedup_bwa_BSQR.table…

Continue Reading BaseRecalibrator takes forever to run. Any suggestions?

Nccl_external fails while trying to compile pytroch from source – torch.compile

Hello, I’m trying to compile pytorch from source and encountering the following build error. $ CC=gcc-10 CXX=g++-10 python setup.py develop … [5995/6841] Linking CXX executable bin/HashStoreTest Warning: Unused direct dependencies: /home/netfpga/research/collective/pytorch/build/lib/libc10.so /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_intel_lp64.so.1 /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_gnu_thread.so.1 /home/netfpga/anaconda3/envs/pytorch_base/lib/libmkl_core.so.1 /lib/x86_64-linux-gnu/libdl.so.2 /home/netfpga/anaconda3/envs/pytorch_base/lib/libgomp.so.1 [5996/6841] Performing build step for ‘nccl_external’ FAILED: nccl_external-prefix/src/nccl_external-stamp/nccl_external-build nccl/lib/libnccl_static.a /home/netfpga/research/collective/pytorch/build/nccl_external-prefix/src/nccl_external-stamp/nccl_external-build /home/netfpga/research/collective/pytorch/build/nccl/lib/libnccl_static.a cd /home/netfpga/research/collective/pytorch/third_party/nccl/nccl &&…

Continue Reading Nccl_external fails while trying to compile pytroch from source – torch.compile

Pflowtts Pytorch – Open Source Agenda

P-Flow: A Fast and Data-Efficient Zero-Shot TTS through Speech Prompting Authors : Sungwon Kim, Kevin J Shih, Rohan Badlani, Joao Felipe Santos, Evelina Bhakturina,Mikyas Desta1, Rafael Valle, Sungroh Yoon, Bryan Catanzaro Affiliations: NVIDIA Status : Generated first sample (Check LJSpeech_Sample_100_epochs.wav) on 11/16/2023. Unofficial implementation of the paper P-Flow: A Fast…

Continue Reading Pflowtts Pytorch – Open Source Agenda

How To Use Machine Learning In Python

Introduction Machine learning has revolutionized the way we approach problem-solving, data analysis, and decision-making. It is a branch of artificial intelligence that focuses on enabling computers to learn from data and improve their performance over time. With the growing availability of data and computing power, machine learning has become increasingly…

Continue Reading How To Use Machine Learning In Python

Pytorch 2.1 on slurm – PyTorch Forums

Hello, I upraded my pytorch to 2.1 and there seem to be issues when I am running it on GPU on the slurm cluster I use. File “/storage/home/hcoda1/6/user123/VIT/model_reg_square.py”, line 292, in <module> y_pred = model(x_masked, attn_mask) File “/storage/home/hcoda1/6/user123/.conda/envs/myenv/lib/python3.10/site-packages/torch/nn/modules/module.py”, line 1518, in _wrapped_call_impl return self._call_impl(*args, **kwargs) File “/storage/home/hcoda1/6/user123/.conda/envs/myenv/lib/python3.10/site-packages/torch/nn/modules/module.py”, line 1527, in…

Continue Reading Pytorch 2.1 on slurm – PyTorch Forums

01 Pytorch Basics?action=login – Notebook by Faizudeen Olanrewaju Kajogbola (faaizz)

How to run the code This tutorial is an executable Jupyter notebook hosted on Jovian (don’t worry if these terms seem unfamiliar; we’ll learn more about them soon). You can run this tutorial and experiment with the code examples in a couple of ways: using free online resources (recommended) or…

Continue Reading 01 Pytorch Basics?action=login – Notebook by Faizudeen Olanrewaju Kajogbola (faaizz)

Building from source a pytorch wheel file with all the dependencies and Cuda+Cudnn included; Linux+Python 3.7, Cuda=11.2+Cudnn=8.1

I want to build torch v1.12.1 from source and create wheel with all the dependencies included into the wheel file . Additionally, to force the inclusion of all the Cuda and Cudnn -related stuff from my system into the wheel file. Similar task goes for torchvision v0.13.1.I have Ubuntu 22.04…

Continue Reading Building from source a pytorch wheel file with all the dependencies and Cuda+Cudnn included; Linux+Python 3.7, Cuda=11.2+Cudnn=8.1

Pytorch and Cuda 12.3 – CUDA Setup and Installation

vivekvp November 15, 2023, 8:00am 1 Hello, I checked the Pytorch Start Locally Page and it shows Conda and Cuda 12.1 should work. For me, not a lot of luck CUDA not availableCUDA_VISIBLE_DEVICES: NoneUsing device: cputensor([[0.6572, 0.5879, 0.8894],[0.2627, 0.2033, 0.7407],[0.6683, 0.4645, 0.3171],[0.4389, 0.4759, 0.6664],[0.3716, 0.5192, 0.6393]])Torch version: 2.0.1 but when…

Continue Reading Pytorch and Cuda 12.3 – CUDA Setup and Installation

CUDA not available after installing PyTorch v1.8.0 via conda

Greetings,I am building a fine-grained image classifier with an already-implemented architecture which requires PyTorch v1.8.0. After following the installation tutorial in Previous PyTorch Versions | PyTorch and running: conda install pytorch==1.8.0 torchvision==0.9.0 torchaudio==0.8.0 cudatoolkit=11.1 -c pytorch -c conda-forge Everything installs correctly but PyTorch is not compiled for GPUs and torch.cuda.is_available()…

Continue Reading CUDA not available after installing PyTorch v1.8.0 via conda

Software Engineer – open source

Who we are Quansight has its roots in the Python data science community. Our founders have had significant involvement in creating and maintaining NumPy, SciPy, Jupyter, Spyder, Dask, Conda, Numba, and other projects, as well as PyData NumFOCUS, and Anaconda. Our mission is to connect companies to open-source communities to…

Continue Reading Software Engineer – open source

How to update JupyterLab on Jupyterhub – JupyterLab

b0b November 12, 2023, 6:35pm 1 Hi All, I need to have a Docker image that runs Anaconda3 + Jupyterlab + Jupyterhub. I have following versions: Anaconda3-2022.10-Linux-x86_64 Jupyterhub v 4.0.2 JupyterLab v3.4.4 The problem is that I cannot update JupyterLab to more recent version, at least 3.6.6. If I do…

Continue Reading How to update JupyterLab on Jupyterhub – JupyterLab

python – Docker with Rstudio & conda virtual env – unable to load R packages

I have this dockerfile: # Use the rocker/rstudio image with R version 4.1.2 FROM rocker/rstudio:4.1.2 # Install deps RUN apt-get update && apt-get install -y \ wget \ bzip2 \ bash-completion \ libxml2-dev \ zlib1g-dev \ libxtst6 \ libxt6 \ libhdf5-dev \ libcurl4-openssl-dev \ libssl-dev \ libfontconfig1-dev \ libcairo2-dev \…

Continue Reading python – Docker with Rstudio & conda virtual env – unable to load R packages

Will sagemath return to the Fedora 39 repository?

bgregs (Brian Snyder) November 11, 2023, 5:12pm 1 I upgraded from Fedora 38 to 39 without paying close attention to the warnings about incompatible packages on my system (rookie mistake). After upgrading, I realized that sagemath is not in the Fedora 39 repository. Is this permanent or could sagemath come…

Continue Reading Will sagemath return to the Fedora 39 repository?

python – anaconda install pymc3 & tensorflow failed

I’m setting up Python environment for my new computer, when I try to use conda install pymc3 (or tensorflow), there always have a problem when solving the environment. (base) PS C: Users lzzhu>pymc3condainstall Channels: – defaults Platform: win-64 Collecting package metadata (repodata.json): done Solving environment: warning libmamba Added empty dependency…

Continue Reading python – anaconda install pymc3 & tensorflow failed

Invalid indirect expansion error on Slurm

In attempting to run juicer.sh on a Slurm cluster, I am met with an “indirect expansion” error. Is there any quick fix? Here are the steps taken: downloaded the source code of the latest stable release, v.1.6 added a command within the master script activating a conda environment with the…

Continue Reading Invalid indirect expansion error on Slurm

Regarding the error of MD run with CHARMM36 force field – User discussions

Praveen November 9, 2023, 11:28am 1 GROMACS version: 2023GROMACS modification: No Question:I am working in the MD simulation on GROMACS 2023 with Protein+Lipid (as ligand) complex. I have encountered an error, and I already tried all available option to perform MD run with Python version 3.7 and both versions of…

Continue Reading Regarding the error of MD run with CHARMM36 force field – User discussions

python – Issue Installing TensorFlow or PyTorch

I am trying to Install TensorFlow or PyTorch. I tried doing in a normal project and also a virtual project. These are the errors I get and i tried a bunch of different versions and reading documentation. pip install torch pip3 install torch –no-cache-dir pip install “tensorflow<2.11” pip install tensorflow==2.0…

Continue Reading python – Issue Installing TensorFlow or PyTorch

phylogeny analysis

phylogeny analysis 1 Hi flock, I was working on phylogenetic analysis from whole-genome datasets, unfortunately I’m facing a challenge in running the plink2treemix.py script. I’m using python 3.8 version in 4.18.0-511.el8.x86_64 Linux server. I have attached the error for your reference, and I appreciate your contribution in solving the attached…

Continue Reading phylogeny analysis

ILIAD: a suite of automated Snakemake workflows for processing genomic data for downstream applications | BMC Bioinformatics

Pipeline architecture and configuration file Genomic data processing poses a challenge for genetic research studies because it involves multiple program dependency installations, vast numbers of samples with raw data from various next-generation sequencing (NGS) platforms, and inconsistent genetic variant ID and/or positions among datasets. The Iliad suite of genomic data…

Continue Reading ILIAD: a suite of automated Snakemake workflows for processing genomic data for downstream applications | BMC Bioinformatics

Nextflow bwa-mem2 pipeline/channel question

Hello, I’m trying to write a simple bwa script for my research, but it keeps failing. I have two questions in this post. The first code can be executed, but only the first paired fastq files are processed. Google search tells me it’s because the index_ch is a queue channel…

Continue Reading Nextflow bwa-mem2 pipeline/channel question

PyTorch Model to detect Pneumonia using Snowpark Container Service and Snowflake ML Features | by Karuna Nadadur | Snowflake | Nov, 2023

Author : Karuna Nadadur Co Author : Murali Gandhirajan Healthcare Delivery is undergoing rapid changes and evolution as health systems and clinics adopt digital technologies to effectively serve patients. As digital technologies get widely deployed in the patient care delivery ecosystem, it generates vast amounts of patient data. Most of…

Continue Reading PyTorch Model to detect Pneumonia using Snowpark Container Service and Snowflake ML Features | by Karuna Nadadur | Snowflake | Nov, 2023

bam file missing barcode and UMI info

Hi, I used STARsolo but my bam files, below, are missing barcode and UMI info: (/scratch/work/malonzm1/.conda_envs/scvi-env) [malonzm1@login3]/scratch/cs/pan-autoimmune/data/star/scRNAseq/GSE151177/SRR11848679% samtools view SRR11848679Aligned.out.bam|head -n5 NB500961:910:HJ5TWBGXC:1:23304:10007:9225 0 chr1 6100902 255 55M * 0 0 TTCGGAGCCCCCACTGTTTCCCACTCAGCTTTGTGCTCAGATCCCAGGTCCCAAG AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NH:i:1 HI:i:1 AS:i:54 nM:i:0 NM:i:0 MD:Z:55 jM:B:c,-1 jI:B:i,-1 NB500961:910:HJ5TWBGXC:1:13111:23716:1741 0 chr1 6100902 255 4S51M * 0 0 GAGATTCGGAGCCCACACTGTTTCCCACTCAGCTTTGTGCTAATATCCAAGGTCC…

Continue Reading bam file missing barcode and UMI info

python 3.x – llama2 running pytorch produces a “failed to create process”

I am trying to run llama2 on my local machine. I have followed the documentation available on the github repository github.com/facebookresearch/llama thank you in advance for your support install anaconda clone the llama repository github.com/facebookresearch/llama download the models create a virtual environment named llama2 install pytorch on Anaconda conda install…

Continue Reading python 3.x – llama2 running pytorch produces a “failed to create process”

Activate cuda support for Pytorch / pipenv

I followed this answer to install Pytorch with cuda support in my pipenv (running on a Windows machine). My Pipfile looks like this: […] [[source]] name = “pytorch” url = “https://download.pytorch.org/whl/cu118” verify_ssl = false [packages] […] torch = {index = “pytorch”,version = “==2.1.0”} torchvision = {index = “pytorch”,version = “==0.16.0”}…

Continue Reading Activate cuda support for Pytorch / pipenv

sequence alignment – I can’t make mafft run inside my program

This is easy because MAFFT is installed via Conda, but you have not activated that Conda environment, thus it will not give you access to the program. If you type … conda activate labinf mafft This will now work. To activate this inside a shell script you simply include the…

Continue Reading sequence alignment – I can’t make mafft run inside my program

Torch doesn’t detect GPU on Azure VM – windows

Hi everyone, It’s my first time trying to use torch with a GPU and I’m struggling. I’m using an Azure Virtual Machine (NCasT4_v3-series) which requires manual configuration as detailed here: learn.microsoft.com/en-us/azure/virtual-machines/windows/n-series-driver-setup. This was apparently successful. Then I had to download and install CUDA 12.1 from here: developer.nvidia.com/cuda-downloads. This also seemed…

Continue Reading Torch doesn’t detect GPU on Azure VM – windows

picrust2 installation error on mac m2

I am trying to install Picrust2 on a mac m2 and am getting installation errors regarding incompatible packages (perhaps a type or missing channel).  Looking for: [‘picrust2=2.5.2’] bioconda/osx-arm64                                 124.0 B @ 154.0 B/s  0.8s…

Continue Reading picrust2 installation error on mac m2

rpy2 package

rpy2 package 0 Hello, What is your opinion on the use of rpy2 for executing an R script within a Conda environment from a Python script? I’m currently facing a scenario where I have an R script and the requirement to run it within a Conda environment through a Python…

Continue Reading rpy2 package

Installing SageMath on macOS Big Sur 11.1

Hi, I also posted recently about some of my attempts to get Sage running on my Big Sur apple M1 macbook pro here a few days ago: groups.google.com/g/sage-devel/c/_vYkTlLRWWY In particular, > Binaries for Sage 9.2 from the Sage download website > will not work for macOS 11 Big Sur. … I…

Continue Reading Installing SageMath on macOS Big Sur 11.1

Snakemake issue with wrappers

I have issues when running a wrapper of BWA mem with Snakemake. The error message “No module named ‘snakemake_wrapper_utils’” appear (see below). However, when checking if the package is installed in Python, I found the following: import snakemake_wrapper_utils print(snakemake_wrapper_utils.__version__) 0.1.0 Did anyone have this problem? Would you know why there…

Continue Reading Snakemake issue with wrappers

How to replace the private image forcely? – Zero to JupyterHub on Kubernetes

Hello, members 1. Quetions. I’m creating a custom image for Z2JH. When I update the private image, I want to replace the image.(It means I want to use the new image in Z2JH).But I don’t know how to force-pull the image.Does anyone know how to do it? configuration. singleuser: image:…

Continue Reading How to replace the private image forcely? – Zero to JupyterHub on Kubernetes

Pytorch CPU OOM kills ssh server on linux

I’ve run into a problem that pytorch (tested with 2.0.1+cu117) does not fail gracefully when CPU OOM occurs. Specifically, I lose all ssh connections and Xserver access to the VM or bare metal machine. I’ve not tested if this occurs on any other os. the only solution I’ve found is…

Continue Reading Pytorch CPU OOM kills ssh server on linux

Failed to download IlluminaHumanMethylationEPICv2anno.20a1.hg38

Failed to download IlluminaHumanMethylationEPICv2anno.20a1.hg38 1 I am currently working on illumina EPIC v1 and v2 data. When trying to annotate the v2 data I am unable to download the annotation package (note: the manifest package works fine). I get the error that the download failed and that ‘rhdf5filters’ is old….

Continue Reading Failed to download IlluminaHumanMethylationEPICv2anno.20a1.hg38

python – cuda and pytorch version not installed on anaconda

my gpu is GeForce 940MX and my OS is Win 10. in anaconda3 i want to have my gpu for computation. at first i have to install cuda on my system. so i try to install cuda 9.2 and then i create a new environment and try this code according…

Continue Reading python – cuda and pytorch version not installed on anaconda

PackagesNotFoundError on conda for pytorch

I want to install Pytorch 1.12 version, the CUDA version is 11.3, the python version is 3.9.18. Using the command as the following: conda install -c conda.anaconda.org/conda-forge/ pytorch==1.12.0 torchvision==0.13.0 torchaudio==0.12.0 cudatoolkit=11.3 -c pytorch But, it reports the error: (DL) C:\Users\daiyij>conda install -c conda.anaconda.org/conda-forge/ pytorch==1.12.0 torchvision==0.13.0 torchaudio==0.12.0 cudatoolkit=11.3 -c pytorch Collecting…

Continue Reading PackagesNotFoundError on conda for pytorch

python – PyTorch Dataset is being passed a Subset instead of the original Polars DataFrame

I have a custom Dataset class which returns a sequence from a Polars DataFrame. class SequenceDataset(Dataset): def __init__(self, dataframe): self.data = dataframe def __len__(self): return len(self.data) def __getitem__(self, index): row = self.data.row(index, named=True) return row[‘sequence’] When I do a random split: sequence_dataset = SequenceDataset(train) seed_generator = torch.Generator().manual_seed(7) train, validation =…

Continue Reading python – PyTorch Dataset is being passed a Subset instead of the original Polars DataFrame

Torch not compiled with CUDA enabled – CUDA Setup and Installation

Hi, I’m working on the Ubuntu 20.04 with GTX 1080 Ti. I created a conda env and assign the python=3.9. Later i installed cudatoolkit 11.8 with the commandconda install -c “nvidia/label/cuda-11.8.0” cuda-toolkitand installed pytorch withconda install pytorch torchvision torchaudio pytorch-cuda=11.8 -c pytorch -c nvidia. But then the sequence of commands:…

Continue Reading Torch not compiled with CUDA enabled – CUDA Setup and Installation

[Error] importing pymc3 with theano-pymc: ‘numpy’ has no attribute ‘bool’ – v3

Hi, I was trying to install pymc3 v3.11.4 on Anaconda 23.9.0 with Python v3.8.10 on Ubuntu 22.04.3 LTS.Therefore I am using the module theano-pymc but when trying to import pymc3, I’m getting the error >>> import pymc3 /home/julian/anaconda3/envs/python3.8.10_/lib/python3.8/site-packages/theano/scalar/basic.py:2412: FutureWarning: In the future `np.bool` will be defined as the corresponding NumPy…

Continue Reading [Error] importing pymc3 with theano-pymc: ‘numpy’ has no attribute ‘bool’ – v3

python – Error in snakemake when running conda envs in container

I am facing an issue when running snakemake with a container and conda. Let me explain better. I am developing a workflow (locally) in snakemake, where some rules use a conda env (defined in /envs/env.yaml) and other rules use wrappers (so they also are based on conda envs). An example…

Continue Reading python – Error in snakemake when running conda envs in container

Precompiling IJulia times out – Kernels

I’m having an issue starting Julia kernels and the Pluto interface when using the jupyter/datascience-notebook image as a base to build my own image. The issues occur when running locally on my Macbook (M1) and when used on a JupyterHub hosted on GCP. When using the jupyter/datascience-notebook image “as is”,…

Continue Reading Precompiling IJulia times out – Kernels

Custom Z2JH image creation using jupyter-repo2docker – Zero to JupyterHub on Kubernetes

Hello, members. 1. Goal I would like to create a custom image for Z2JH using jupyter-repo2docker command. jupyter-repo2docker github.com/norvig/pytudes works fine. 2. Question Does Z2JH use jupyter-repo2docker for creating a support images (ex. jupyter/pyspark-notebook) ? Is Z2JH base_image jupyter/base-notebook? Does anyone know how to avoid this error? (Maybe macOS docker…

Continue Reading Custom Z2JH image creation using jupyter-repo2docker – Zero to JupyterHub on Kubernetes

huggingface transformers – Hugging face: Unable to find tune Whisper using Seq2SeqTrainer on kaggle

I made a copy of this kaggle notebook: www.kaggle.com/code/imtiazprio/fast-whisper-large-v2-fine-tuning-with-lora Which had ran successfully as you can see from its output. But now I’m running the same notebook by copying it on my account it shows me this error. ————————————————————————— RuntimeError Traceback (most recent call last) Cell In[16], line 2 1…

Continue Reading huggingface transformers – Hugging face: Unable to find tune Whisper using Seq2SeqTrainer on kaggle

Dockerfile for Jupyter Notebook with PySpark, Deequ, and PyTorch

A Dockerfile that sets up a Jupyter Notebook environment with PySpark, Deequ, and PyTorch. This function provides a Dockerfile that sets up a Jupyter Notebook environment with PySpark, Deequ, and PyTorch. The Dockerfile is based on the jupyter/base-notebook image and installs the necessary packages using conda. It sets the environment…

Continue Reading Dockerfile for Jupyter Notebook with PySpark, Deequ, and PyTorch

flask-openapi3

Generate REST API and OpenAPI documentation for your Flask project. Flask OpenAPI3 is a web API framework based on Flask. It uses Pydantic to verify data and automatic generation of interaction documentation: Swagger, ReDoc and RapiDoc. The key features are: Easy to code: Easy to use and easy to learn…

Continue Reading flask-openapi3

Installing Tensorflow and Pytorch with GPU/CUDA access: Question

This question does not appear to be about programming within the scope defined in the help center. Pytorch Installed the following versions in Ubuntu Nvidia Driver >=535 Cuda 12.2 ( Global Initialization) 1st Method: Tensorflow (Problem Starts when installing Tensorflow) Above mentioned nvidia drivers Above…

Continue Reading Installing Tensorflow and Pytorch with GPU/CUDA access: Question

conda – Installing in miniconda `torchvision==0.4.1` and `pytorch==1.3.0`

I am trying to install torchvision==0.4.1 and pytorch==1.3.0 in a virtual conda environment. After I write conda install pytorch==1.3.0 torchvision==0.4.1 -c pytorch the following response occurs. Collecting package metadata (current_repodata.json): / WARNING conda.models.version:get_matcher(556): Using .* with relational operator is superfluous and deprecated and will be removed in a future version…

Continue Reading conda – Installing in miniconda `torchvision==0.4.1` and `pytorch==1.3.0`

How to Install PyTorch on Ubuntu 22.04

Introduction PyTorch is a machine-learning framework that includes a library of tools used to build and train deep learning models. It’s highly extensible and integrates with Python to enable the fast computation of tasks. Follow the steps in this guide to install PyTorch on a Ubuntu 22.04 Server. Prerequisites Installation…

Continue Reading How to Install PyTorch on Ubuntu 22.04

Unable to install Kmergenie

Unable to install Kmergenie 3 Hello there, I’m trying to install KmerGenie following the README file. I downloaded the kmergeni-1.6892.tar.gz, unzipped it and did make under the folder, but it didn’t work. It shows like the following julibio@DESKTOP-OTF949V ~/curso-bio/kmergenie/kmergenie-1.7051/kmergenie-1.7051 $ make cd ntCard && ./configure && make checking for a…

Continue Reading Unable to install Kmergenie

python – Pytorch won’t install on Windows 11

I need Pytorch for LLAMA AI, but Pytorch won’t install. I’m currently getting this error when I try to install Pytorch 2.1.0 on windows 11 CPU with pip for Python. ERROR: Could not find a version that satisfies the requirement torch (From versions: None) ERROR: No matching distribution found for…

Continue Reading python – Pytorch won’t install on Windows 11