Tag: CpG

2023 gene therapy research STAR Grant winners announced

At PacBio, enabling the promise of genomics to better human health cuts right to the core of everything we do.That’s why in 2023 we created the STAR (Student Travel Awarded Researcher) Grant program. This exciting funding opportunity is intended to assist up-and-coming researchers in genomics-aligned fields with sequencing services and…

Continue Reading 2023 gene therapy research STAR Grant winners announced

Detection of DNA methylation signatures through the lens of genomic imprinting

Animals and samples The study included 10 pigs, 8 pigs were bred at the INRAE experimental farm (doi.org/doi.org/10.15454/1.5572415481185847E12) and 2 pigs come from breeding organizations in accordance with the French and European legislation on animal welfare. The animals belong to the same family, except for one LW animal. Animals were…

Continue Reading Detection of DNA methylation signatures through the lens of genomic imprinting

Causality-enriched epigenetic age uncouples damage and adaptation

Gladyshev, V. N. et al. Molecular damage in aging. Nat. Aging 1, 1096–1106 (2021). Article  PubMed  PubMed Central  Google Scholar  Sziráki, A., Tyshkovskiy, A. & Gladyshev, V. N. Global remodeling of the mouse DNA methylome during aging and in response to calorie restriction. Aging Cell 17, e12738 (2018). Article  PubMed …

Continue Reading Causality-enriched epigenetic age uncouples damage and adaptation

De novo variants underlying monogenic syndromes with intellectual disability in a neurodevelopmental cohort from India

Russell PSS, Nagaraj S, Vengadavaradan A, Russell S, Mammen PM, Shankar SR, et al. Prevalence of intellectual disability in India: a meta-analysis. World J Clin Pediatr. 2022;11:206–14. Article  PubMed  PubMed Central  Google Scholar  Winnepenninckx B, Rooms L, Kooy RF. Mental retardation: a review of the genetic causes. Br J Dev…

Continue Reading De novo variants underlying monogenic syndromes with intellectual disability in a neurodevelopmental cohort from India

Sequential deregulation of histone marks, chromatin accessibility and gene expression in response to PROTAC-induced degradation of ASH2L

Loss of ASH2L prevents cell proliferation We have studied the molecular and cellular consequences of Ash2l loss in mouse embryo fibroblasts (MEFs) with floxed Ash2l alleles and an inducible Cre-ER recombinase (iMEF-Ash2lfl/fl-Cre-ER). While the knockout of Ash2l was rapid, the downstream effects, including the decrease in promoter-associated H3K4me3, altered gene…

Continue Reading Sequential deregulation of histone marks, chromatin accessibility and gene expression in response to PROTAC-induced degradation of ASH2L

3 Biotech Stocks Most Wall Street Analysts Are Bullish About

The scenario for the biotech industry in 2024 looks upbeat after a challenging ride in 2023. New drug approvals, pipeline development, and an increase in mergers & acquisitions (M&A) activity boosted investor sentiment in the last couple of months, even though an uncertain macroeconomic environment was a headwind. Pharma and…

Continue Reading 3 Biotech Stocks Most Wall Street Analysts Are Bullish About

Genomic hypomethylation in cell-free DNA predicts responses to checkpoint blockade in lung and breast cancer

Lung cancer ICB cohort Advanced non-small cell lung carcinoma patients who were treated with anti-PD-1/PD-L1 monotherapy at Samsung Medical Center, Seoul, Republic of Korea were enrolled for this study. The present study has been reviewed and approved by the Institutional Review Board (IRB) of the Samsung Medical Center (IRB no….

Continue Reading Genomic hypomethylation in cell-free DNA predicts responses to checkpoint blockade in lung and breast cancer

Whole-genome sequencing reveals the molecular implications of the stepwise progression of lung adenocarcinoma

Whole-genome sequencing (WGS) analysis of early and advanced adenocarcinomas Whole-genome short read and long read sequencing datasets of 76 lung cancer specimens were analyzed. The datasets included newly generated data for 48 early small-sized lung adenocarcinoma cases (collectively called “Early-Ad” hereafter). These cases included 26 AIS (9 and 17 cases…

Continue Reading Whole-genome sequencing reveals the molecular implications of the stepwise progression of lung adenocarcinoma

Transcription factor-mediated direct cellular reprogramming yields cell-type specific DNA methylation signature

iISC-BOs exhibit a CpG methylation signature that closely resembles ISC-BOs Genomic DNA was extracted from MEFs, iISC-BOs, and ISC-BOs, and high-resolution methylome analysis was performed using the PBAT method (Fig. 1A). The genome-wide methylation states of cytosine-containing sequences such as CpG, CHH, and CHG were compared among the samples. The data…

Continue Reading Transcription factor-mediated direct cellular reprogramming yields cell-type specific DNA methylation signature

Conserved and divergent gene regulatory programs of the mammalian neocortex

Nucleus preparation from frozen brain tissue for Chromium single-cell multiome ATAC and gene expression analysis M1 tissue was obtained from three human donors (male, aged 42, 29 and 58 years), three macaque donors (male, aged 6 (Macaca mulatta), 6 (M. mulatta) and 14 (Macaca fascicularis) years), three marmoset (Callithrix jacchus)…

Continue Reading Conserved and divergent gene regulatory programs of the mammalian neocortex

Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain

Mouse brain tissues All experimental procedures using live animals were approved by the Salk Institute Animal Care and Use Committee under protocol number 18-00006. Adult (P56) C57BL/6J male mice were purchased from the Jackson Laboratory at 7 weeks of age and maintained in the Salk animal barrier facility on 12-h dark–light…

Continue Reading Single-cell DNA methylome and 3D multi-omic atlas of the adult mouse brain

Topological structures and syntenic conservation in sea anemone genomes

Putnam, N. H. et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 317, 86–94 (2007). Article  ADS  CAS  PubMed  Google Scholar  Chapman, J. A. et al. The dynamic genome of Hydra. Nature 464, 592–596 (2010). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Srivastava, M….

Continue Reading Topological structures and syntenic conservation in sea anemone genomes

Benchmarking DNA isolation methods for marine metagenomics

Scheme of the study The overall pipeline of our study is presented in Fig. 1 and is described in detail in the methods section. We processed three types of samples: fresh water, sea sediment, and digestive system of a marine invertebrate M. gigas (“gut flora”). These samples were treated in triplicates…

Continue Reading Benchmarking DNA isolation methods for marine metagenomics

Comprehensive Review of Small Interfering RNAs (siRNAs)

Introduction Cancer, also called malignancy, is a group of diseases caused by the rapid multiplication and spread of malignant cells.1,2 According to statistics from the National Cancer Center, more than 100 types of cancer have been identified.3 The ability of malignant tumor cells to metastasize via the blood-lymphatic system and…

Continue Reading Comprehensive Review of Small Interfering RNAs (siRNAs)

DNA methylation modulated genetic variant effect on gene transcriptional regulation

Background: Expression quantitative trait locus (eQTL) analysis has emerged as an important tool in elucidating the link between genetic variants and gene expression, thereby bridging the gap between risk SNPs and associated diseases. We recently identified and validated a specific case where the methylation of a CpG site influences the…

Continue Reading DNA methylation modulated genetic variant effect on gene transcriptional regulation

Methylation Analysis Tutorial in R_part1

The code and approaches that I share here are those I am using to analyze TCGA methylation data. At the bottom of the page, you can find references used to make this tutorial. If you are coming from a computer background, please bear with a geneticist who tried to code…

Continue Reading Methylation Analysis Tutorial in R_part1

Longitudinal changes and variation in human DNA methylation analysed with the Illumina MethylationEPIC BeadChip assay and their implications on forensic age prediction

In this study, genome-wide methylation profiles of 128 blood samples were examined. Two blood DNA methylation profiles from 64 individuals were obtained using the Illumina EPIC850k array. Two blood DNA methylation profiles were generated from samples collected in 2007 and 2021, respectively. All samples passed the SeSAMe quality control. A…

Continue Reading Longitudinal changes and variation in human DNA methylation analysed with the Illumina MethylationEPIC BeadChip assay and their implications on forensic age prediction

Human hg38 chr6:31,165,200-31,165,800 UCSC Genome Browser v457

     Custom Tracks ac4C-RIP-seq peaks, hESC CTL-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC CTL-2hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-1hidedensesquishpackfull ac4C-RIP-seq peaks, hESC NAT10-KD-2hidedensesquishpackfull    Mapping and Sequencing Base Positionhidedensefull p14 Fix Patcheshidedensesquishpackfull p14 Alt Haplotypeshidedensesquishpackfull Assemblyhidedensesquishpackfull Centromereshidedensesquishpackfull Chromosome Bandhidedensesquishpackfull Clone Endshidedensesquishpackfull Exome Probesetshidedensesquishpackfull FISH Cloneshidedensesquishpackfull Gaphidedensesquishpackfull GC Percenthidedensefull GRC Contigshidedensefull GRC Incidenthidedensesquishpackfull Hg19…

Continue Reading Human hg38 chr6:31,165,200-31,165,800 UCSC Genome Browser v457

A chromosome-level genome assembly for the Silkie chicken resolves complete sequences for key chicken metabolic, reproductive, and immunity genes

Friedman-Einat, M. & Seroussi, E. Avian leptin: bird’s-eye view of the evolution of vertebrate energy-balance control. Trends Endocrinol. Metab. 30, 819–832 (2019). Article  CAS  PubMed  Google Scholar  International Chicken Genome Sequencing C. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695–716 (2004)….

Continue Reading A chromosome-level genome assembly for the Silkie chicken resolves complete sequences for key chicken metabolic, reproductive, and immunity genes

Identification of intergenerational epigenetic inheritance by whole genome DNA methylation analysis in trios

Epigenetic changes are typically thought to be markers of cell differentiation or somatic changes caused by interactions with the environment16. However, recent studies have shown that some of these environmentally induced changes can be passed down from one generation to the next, demonstrating their heritability19,21,42,43. Though this mechanism has long…

Continue Reading Identification of intergenerational epigenetic inheritance by whole genome DNA methylation analysis in trios

MSL2 ensures biallelic gene expression in mammals

Materials Animals All of the mice were kept in the animal facility of the Max Planck Institute of Immunobiology and Epigenetics. The mice were maintained under specific-pathogen-free conditions, with 2 to 5 mice housed in individually ventilated cages (Techniplast). The cages were equipped with bedding material, nesting material, a paper…

Continue Reading MSL2 ensures biallelic gene expression in mammals

Georgetown School of Medicine’s Department of Immunology Hosts Talk About Therapeutic Vaccine for Autoimmune Diseases

The department of microbiology and immunology invited a Georgetown University professor to present his research on a new way to treat autoimmune diseases using therapeutic vaccines on Nov. 21.  Joseph Bellanti, a professor of microbiology and immunology and director of Georgetown’s International Center for Interdisciplinary Studies of Immunology, spoke about…

Continue Reading Georgetown School of Medicine’s Department of Immunology Hosts Talk About Therapeutic Vaccine for Autoimmune Diseases

DNA methylation change in blood cells of FB and CFS patients

Introduction Fibromyalgia (FM) and Chronic Fatigue Syndrome (CFS) are characterized by chronic pain, fatigue, and weakness. Patients with these symptoms also suffer from sleep abnormalities and report affected cognitive processes such as memory. The diagnosis of these two syndromes is challenging and is based on questionnaires that make the diagnosis…

Continue Reading DNA methylation change in blood cells of FB and CFS patients

Plants | Free Full-Text | The Development of Plant Genome Sequencing Technology and Its Conservation and Application in Endangered Gymnosperms

The PacBio RS II sequencer has been effectively utilized to generate a 1.27 Gb genome assembly of Dendrobium officinale [70]. By utilizing advanced sequencing technologies such as Illumina HiSeq, Nanopore, PacBio, and Hi-C, the results have revealed remarkable N50 values of 44 Mb and 65.35 Mb for Gardenia jasminoides and…

Continue Reading Plants | Free Full-Text | The Development of Plant Genome Sequencing Technology and Its Conservation and Application in Endangered Gymnosperms

What Is DNA Methylation? Definition & Overview

DNA methylation is a fundamental epigenetic modification mechanism that is crucial in regulating gene activity. It involves adding a methyl group to the DNA molecule, specifically to the cytosine base. This process is vital for various cellular functions, including regulating gene expression, where specific genes are activated or silenced based…

Continue Reading What Is DNA Methylation? Definition & Overview

H101 for cervical cancer | DDDT

Introduction Patients with persistent, recurrent, or metastatic (P/R/M) cervical carcinoma respond poorly to treatment despite the best available therapeutic regimens, with a 5-year survival of 17%.1 Most of them are heavily pretreated with chemotherapy and/or radiotherapy, and many patients experience complications related to treatment or advanced disease, which exclude them…

Continue Reading H101 for cervical cancer | DDDT

addPatternDensity to qsea object

i have qsea object contain 6 sample with 11 chromosome where i am trying to addPatternDensity which is by default 0.01 qseaSet <- addOffset(qseaSet, enrichmentPattern = “CpG”, maxPatternDensity = 0.1) when i am trying to change it like this with following values it through me error qseaSet <- addPatternDensity(qseaSet, pattern…

Continue Reading addPatternDensity to qsea object

Israel-based Fungit has a mission to feed billions of people around the world

“The global population is growing by a staggering 100 million per year,” explained Fungit Biosolutions. “By the year 2050, the world population is expected to grow by more than 3 billion and exceed 10 billion people. An increase in population directly translates into an immediate increase in demand for food.”…

Continue Reading Israel-based Fungit has a mission to feed billions of people around the world

Molecular complexity of diffuse large B-cell lymphoma: a molecular perspective and therapeutic implications

Agarwal P, Kabir FM, DeInnocentes P, Bird RC (2012) Tumor suppressor gene p16/INK4A/CDKN2A and its role in cell cycle exit, differentiation, and determination of cell fate. Tumor Suppressor Genes 3(10):27882 Google Scholar  Alaggio R, Amador C, Anagnostopoulos I, Attygalle AD, Araujo IBO, Berti E et al (2022) The 5th edition…

Continue Reading Molecular complexity of diffuse large B-cell lymphoma: a molecular perspective and therapeutic implications

Zacks Industry Outlook Highlights Gilead Sciences, CRISPR Therapeutics, ACADIA Pharmaceuticals, Dynavax and Ligand Pharmaceuticals

For Immediate Release Chicago, IL – November 24, 2023 – Today, Zacks Equity Research discusses Gilead Sciences, Inc. GILD, CRISPR Therapeutics AG CRSP, ACADIA Pharmaceuticals Inc. ACAD, Dynavax DVAX and Ligand Pharmaceuticals Inc. LGND. Industry: Biotech Link: www.zacks.com/commentary/2187656/5-biotech-stocks-likely-to-thrive-as-industry-prospects-look-bright It has been a choppy ride for the biotech industry in 2023…

Continue Reading Zacks Industry Outlook Highlights Gilead Sciences, CRISPR Therapeutics, ACADIA Pharmaceuticals, Dynavax and Ligand Pharmaceuticals

Functional filter for whole-genome sequencing data identifies HHT and stress-associated non-coding SMAD4 polyadenylation site variants >5 kb from coding DNA

Summary Despite whole-genome sequencing (WGS), many cases of single-gene disorders remain unsolved, impeding diagnosis and preventative care for people whose disease-causing variants escape detection. Since early WGS data analytic steps prioritize protein-coding sequences, to simultaneously prioritize variants in non-coding regions rich in transcribed and critical regulatory sequences, we developed GROFFFY,…

Continue Reading Functional filter for whole-genome sequencing data identifies HHT and stress-associated non-coding SMAD4 polyadenylation site variants >5 kb from coding DNA

Megakaryocytes possess a STING pathway that is transferred to platelets to potentiate activation

Introduction Host defence against infection relies on two important systems: the immune and the coagulation systems. Platelets are anucleate cells produced by megakaryocytes and are responsible for blood clotting and haemostasis (Lefrancais et al, 2017). They are also very abundant and play unexpected roles in immune responses (Maouia et al,…

Continue Reading Megakaryocytes possess a STING pathway that is transferred to platelets to potentiate activation

Sequencing 101: Tandem repeats – PacBio

In the field of genetics, the concept of tandem repeats has been both scientifically fascinating, experimentally challenging, and motivating for technology development. As DNA sequencing technologies and analysis tools have evolved, scientists are now able to reveal the secrets hidden within these repetitive sequences, shedding light on their significance in…

Continue Reading Sequencing 101: Tandem repeats – PacBio

Definition, Uses, Benefits, Costs, Process

Epigenetic testing offers insights that go beyond our DNA sequence. This emerging field examines how our behaviors and environment can impact the way our genes work. Understanding these modifications provides a powerful tool for health management.  As we explore the definition, uses, benefits, costs, and process of epigenetic testing, we…

Continue Reading Definition, Uses, Benefits, Costs, Process

Advancing personalized medicine in brain cancer: exploring the role of mRNA vaccines | Journal of Translational Medicine

Personalized medicine aims to revolutionize healthcare by providing tailored treatments based on an individual’s unique characteristics. Genetic information of the host and target plays a crucial role in determining disease susceptibility and treatment response [1, 2]. By utilizing genomic analysis, biomarker identification, risk assessment, tailored treatment strategies, and continuous monitoring,…

Continue Reading Advancing personalized medicine in brain cancer: exploring the role of mRNA vaccines | Journal of Translational Medicine

Advances in CHO Cell Line Development for Biotherapeutics

A diverse array of biological medicines – including therapeutic proteins, hormones, monoclonal antibodies, cytokines, enzymes and vaccines – are now used to prevent and treat a wide range of illnesses. While some of these biotherapeutics were originally obtained from natural origins, such as donated blood, many are now synthesized using…

Continue Reading Advances in CHO Cell Line Development for Biotherapeutics

Transgenerational epigenetic effects imposed by neonicotinoid thiacloprid exposure

This study is aimed at revealing the transgenerational effects of thia. We chose the developmental window from embryonic days 6.5 to E15.5 because of its importance in germ cell program establishment. The mice breeding was described in the Materials and Methods section “Mouse treatment and dissection.” The design of the…

Continue Reading Transgenerational epigenetic effects imposed by neonicotinoid thiacloprid exposure

CRISPR-broad: combined design of multi-targeting gRNAs and broad, multiplex target finding

CRISPR-broad framework We developed a procedural pipeline for detecting gRNAs and implemented this in Python as a standalone application (Fig. 1a). For speeding up gRNA selection, we employed multithreading and used big data Python module Pandas. This allowed splitting millions of short sequences for mapping and processing large numbers of uncompressed…

Continue Reading CRISPR-broad: combined design of multi-targeting gRNAs and broad, multiplex target finding

H2O.ai Sets the Stage for Advanced LLM Demonstrations at Its Inaugural Event, GenAI World

MOUNTAIN VIEW, Calif., Nov. 8, 2023 — H2O.ai, an open source leader in Generative AI and machine learning, is responding to the overwhelming community and customer interest in bringing H2O World back to the Bay Area. This year’s gathering is the first in a series of GenAI World events that…

Continue Reading H2O.ai Sets the Stage for Advanced LLM Demonstrations at Its Inaugural Event, GenAI World

Zebrafish danRer11 chr6:43,426,661-43,433,266 UCSC Genome Browser v456

     DANIO-CODE Track Hub 3P-seq trackshidedensesquishpackfull CAGE-seq trackshidedensesquishpackfull ChIP-seq trackshidedensesquishpackfull RNA-seq trackshidedensefull Cell Typeshidedensesquishpackfull Consensus promotershidedensesquishpackfull Conservation and CRISPR targetshideshow COPEs and pooled DOPEshideshow Enhancer validationhideshow HiC trackshidedensefull Stages_Typeshidedensesquishpackfull    Mapping and Sequencing Base Positionhidedensefull Assemblyhidedensesquishpackfull Gaphidedensesquishpackfull GC Percenthidedensefull GRC Incidenthidedensesquishpackfull INSDChidedensesquishpackfull RefSeq Acchidedensesquishpackfull Restr Enzymeshidedensesquishpackfull Short Matchhidedensesquishpackfull   …

Continue Reading Zebrafish danRer11 chr6:43,426,661-43,433,266 UCSC Genome Browser v456

Integrative transcriptome- and DNA methylation analysis of brain tissue from the temporal pole in suicide decedents and their controls

World Health Organization. Facts sheet: suicide. www.who.int/news-room/fact-sheets/detail/suicide. National Institute of Mental Health. Suicide. www.nimh.nih.gov/health/statistics/suicide. Nock MK, Hwang I, Sampson N, Kessler RC, Angermeyer M, Beautrais A, et al. Cross-national analysis of the associations among mental disorders and suicidal behavior: findings from the WHO world mental health surveys. PLoS Med. 2009;6:e1000123….

Continue Reading Integrative transcriptome- and DNA methylation analysis of brain tissue from the temporal pole in suicide decedents and their controls

IJMS | Free Full-Text | CRISPR/Cas9 Landscape: Current State and Future Perspectives

1. Introduction Genome editing has taken a leading position among genome modification technologies in a short time and is now widely used in gene therapy. To date, there are three main systems for genome editing: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas nucleases. Genome editing has…

Continue Reading IJMS | Free Full-Text | CRISPR/Cas9 Landscape: Current State and Future Perspectives

Insights gained from single-cell analysis of chimeric antigen receptor T-cell immunotherapy in cancer | Military Medical Research

Zhu J, Ke Y, Liu Q, Yang J, Liu F, Xu R, et al. Engineered Lactococcus lactis secreting Flt3L and OX40 ligand for in situ vaccination-based cancer immunotherapy. Nat Commun. 2022;13(1):7466. Article  CAS  PubMed  PubMed Central  Google Scholar  Evans ER, Bugga P, Asthana V, Drezek R. Metallic nanoparticles for cancer…

Continue Reading Insights gained from single-cell analysis of chimeric antigen receptor T-cell immunotherapy in cancer | Military Medical Research

The association between neighborhood deprivation, DNA methylation, and gene expression in breast tissue for Black and White women with breast cancer

In a recent study published in JAMA Network Open, researchers investigated the association between neighborhood deprivation and alterations in deoxyribonucleic acid (DNA) methylation and gene expression in breast cancer tissues of Black and White women. Study: Neighborhood Deprivation and DNA Methylation and Expression of Cancer Genes in Breast Tumors. Image…

Continue Reading The association between neighborhood deprivation, DNA methylation, and gene expression in breast tissue for Black and White women with breast cancer

H2O.ai Kicks Off Inaugural Open Source GenAI World Event in San Francisco with the Winning Kaggle LLM Team and SF’s Largest Gathering of AI Grandmasters

#GenerativeAI–H2O.ai, the open source leader in Generative AI and machine learning, is responding to the overwhelming community and customer interest in bringing H2O World back to the Bay Area. This … SF’s largest gathering of Kaggle Grandmasters brings in 1000+ GenAI users to the biggest GenAI open source event Speakers…

Continue Reading H2O.ai Kicks Off Inaugural Open Source GenAI World Event in San Francisco with the Winning Kaggle LLM Team and SF’s Largest Gathering of AI Grandmasters

An FcRn-targeted mucosal vaccine against SARS-CoV-2 infection and transmission

Mice and Golden Syrian hamsters All research experiments in this study comply with all relevant ethical regulations. The Institutional Animal Care and Use Committee approved the animal protocol at the University of Maryland (#R-APR-20-18 and #R-MAR-21-19). The animals were acclimatized at the animal facility for 4–6 days before initiating experiments….

Continue Reading An FcRn-targeted mucosal vaccine against SARS-CoV-2 infection and transmission

DNA hypomethylation characterizes genes encoding tissue-dominant functional proteins in liver and skeletal muscle

Overview of this study In this study, we measured the DNA methylome from mouse liver and skeletal muscle, integrated the data with the transcriptome and proteome of these mouse tissues22,23, and examined how tissue-dominant protein and gene expression were associated with DNA hypomethylation (Fig. 1). In this study, we measured DNA…

Continue Reading DNA hypomethylation characterizes genes encoding tissue-dominant functional proteins in liver and skeletal muscle

Q3 2023 Grid Dynamics Holdings Inc Earnings Call

Participants Anil Kumar Doradla; CFO & Secretary; Grid Dynamics Holdings, Inc. Leonard Livschitz; CEO & Director; Grid Dynamics Holdings, Inc. Bryan C. Bergin; MD of TMT – Services, HCM & Automation Software and Analyst; Cowen Inc. Joshua Michael Siegler; Research Analyst; Cantor Fitzgerald & Co., Research Division Maggie Nolan Mayank…

Continue Reading Q3 2023 Grid Dynamics Holdings Inc Earnings Call

Characterization of H3K9me3 and DNA methylation co-marked CpG-rich regions during mouse development | BMC Genomics

CHMs are stable during mouse development To explore the co-localization between H3K9me3 and DNA methylation, we collected public H3K9me3 chromatin immunoprecipitation sequencing (ChIP-seq) and whole-genome bisulfite sequencing (WGBS) data during mouse pre-implantation embryogenesis [11], PGC development [12], spermatogenesis [13, 14], retina development [15], heart and liver development after gastrulation [16,17,18]…

Continue Reading Characterization of H3K9me3 and DNA methylation co-marked CpG-rich regions during mouse development | BMC Genomics

how to merge multiple files based on column header

how to merge multiple files based on column header 3 Hi, I would like to merge three files based on column header Sample_ID and file should only have those samples that are common in all these three file. Could you please help with this. in.sites <- read.table(“CpG.csv”, header=T, sep=”,”, as.is=T,…

Continue Reading how to merge multiple files based on column header

Illumina EPIC v2 IlmnIDs and probe names

Illumina EPIC v2 IlmnIDs and probe names 0 I am working with illumina EPIC beadchip v1 and v2 data. I see that the v2 data comes with another IlmnID than the v1 data, and includes the cg name e.g. cg and a number, however in v2 it also has an…

Continue Reading Illumina EPIC v2 IlmnIDs and probe names

When Glia Meet Induced Pluripotent Stem Cells (iPSCs)

Abstract The importance of glial cells, mainly astrocytes, oligodendrocytes, and microglia, in the central nervous system (CNS) has been increasingly appreciated. Recent advances have demonstrated the diversity of glial cells and their contribution to human CNS development, normal CNS functions, and disease progression. The uniqueness of human glial cells is…

Continue Reading When Glia Meet Induced Pluripotent Stem Cells (iPSCs)

Novel Rett syndrome variant shines light on n

Rett syndrome is a rare devastating neurological disorder that primarily affects young girls and manifests as an impaired ability to walk and talk, along with characteristic ‘hand-wringing’ movements, seizures, and cognitive disability. This incurable condition results from mutations in the methyl-CpG binding protein 2 (MECP2) gene that impairs the role…

Continue Reading Novel Rett syndrome variant shines light on n

epialleleR: an R/Bioconductor package for sensitive allele-specific methylation analysis in NGS data | GigaScience

Abstract Low-level mosaic epimutations within the BRCA1 gene promoter occur in 5–8% of healthy individuals and are associated with a significantly elevated risk of breast and ovarian cancer. Similar events may also affect other tumor suppressor genes, potentially being a significant contributor to cancer burden. While this opens a new…

Continue Reading epialleleR: an R/Bioconductor package for sensitive allele-specific methylation analysis in NGS data | GigaScience

Data Science Hiring Process at Happiest Minds

Founded in 2011 by Ashok Soota, a serial entrepreneur and Indian IT veteran, Happiest Minds boasts a robust data science team comprising over 300 members, including data engineers, intelligence specialists, and data science experts. Based in the Silicon Valley of India, Bangalore, and extending its reach across the global landscape,…

Continue Reading Data Science Hiring Process at Happiest Minds

R packages for DNA methylation as mediator analysis

R packages for DNA methylation as mediator analysis 0 Hi, I do have diabetes and no diabetes disease phenotypes, and also arsenic exposure and DNA methylation data (epic array). Could you please suggest best way to find CpG sites associated with arsenic exposure and diabetes. We know that toxic element…

Continue Reading R packages for DNA methylation as mediator analysis

T cell receptor therapeutics: immunological targeting of the intracellular cancer proteome

Hedrick, S. M., Cohen, D. I., Nielsen, E. A. & Davis, M. M. Isolation of cDNA clones encoding T cell-specific membrane-associated proteins. Nature 308, 149–153 (1984). Article  CAS  PubMed  Google Scholar  Yanagi, Y. et al. A human T cell-specific cDNA clone encodes a protein having extensive homology to immunoglobulin chains….

Continue Reading T cell receptor therapeutics: immunological targeting of the intracellular cancer proteome

TET2 modulates spatial relocalization of heterochromatin in aged hematopoietic stem and progenitor cells

Animal models Animal studies were approved by the Institutional Animal Care Use Committee of the Institute of Biosciences and Technology, Texas A&M University (AUP 2020-0195). Most mouse strains bear a C57BL/6 genetic background unless otherwise noted. All the animals were housed in a certified animal facility with a standard dark/light…

Continue Reading TET2 modulates spatial relocalization of heterochromatin in aged hematopoietic stem and progenitor cells

Mouse mm10 chr4:22,481,383-22,489,763 UCSC Genome Browser v455

     Custom Tracks Adiposehidedensesquishpackfull Cerebellumhidedensesquishpackfull Cortexhidedensesquishpackfull Liverhidedensesquishpackfull Lunghidedensesquishpackfull Sintesthidedensesquishpackfull Spleenhidedensesquishpackfull    mouse_7_core ATAC Adipose Rep1hidedensefull ATAC Adipose Rep2hidedensefull ATAC Cerebellum Rep1hidedensefull ATAC Cerebellum Rep2hidedensefull ATAC Colon Rep1hidedensefull ATAC Colon Rep2hidedensefull ATAC Cortex Rep1hidedensefull ATAC Cortex Rep2hidedensefull ATAC Heart Rep1hidedensefull ATAC Heart Rep2hidedensefull ATAC Liver Rep1hidedensefull ATAC Liver Rep2hidedensefull ATAC…

Continue Reading Mouse mm10 chr4:22,481,383-22,489,763 UCSC Genome Browser v455

NGS Training | Top NGS Courses | Online Training | RNASeq | Genome Variant Detection

        NGS Training Next Generation Sequencing (NGS), a recently evolved technology, have served a lot in the research and development sector of our society. NGS methods are highly parallelized enabling to sequence thousands to millions of molecules simultaneously. This technology results into huge amount of data, which…

Continue Reading NGS Training | Top NGS Courses | Online Training | RNASeq | Genome Variant Detection

Genome-wide epigenetic dynamics during postnatal skeletal muscle growth in Hu sheep

Global changes of the transcriptome during postnatal muscle growth The number of myofibers is thought to remain fixed following birth, muscle fiber hypertrophy growth is the primaryway of muscle growth. The average CSA is generally used to measure the hypertrophy of skeletal muscle fibers. To systematically identify the growth of postnatal…

Continue Reading Genome-wide epigenetic dynamics during postnatal skeletal muscle growth in Hu sheep

Comparison of methylation estimates obtained via MinION nanopore sequencing and sanger bisulfite sequencing in the TRPA1 promoter region | BMC Medical Genomics

Repeated measurements in one DNA sample revealed congruent results for methylation calling between the methods Sanger bisulfite and nanopore sequencing Mean methylation rates and the methylation rates of individual replicates were congruent between bisulfite and nanopore sequencing (Fig. 1), although the number of calls per site varied in nanopore sequencing. The…

Continue Reading Comparison of methylation estimates obtained via MinION nanopore sequencing and sanger bisulfite sequencing in the TRPA1 promoter region | BMC Medical Genomics

The impact of DNA methylation of different regions?

The impact of DNA methylation of different regions? 0 Hello, community, When I perform DNA methylation data processing and analysis (WGBS), I follow the current consensus and compare the methylation levels of the gene promoter region (2kbp), and thus speculate on the expression regulation of the gene. However, my supervisor…

Continue Reading The impact of DNA methylation of different regions?

Whole genome methylation sequencing in blood identifies extensive differential DNA methylation in late-onset dementia due to Alzheimer’s disease

Introduction: DNA microarray-based studies report differentially methylated positions (DMPs) in blood between late-onset dementia due to Alzheimer’s disease (AD) and cognitively unimpaired individuals, but interrogate < 4% of the genome. Methods: We used whole genome methylation sequencing (WGMS) to quantify DNA methylation levels at 25,409,826 CpG loci in 281 blood…

Continue Reading Whole genome methylation sequencing in blood identifies extensive differential DNA methylation in late-onset dementia due to Alzheimer’s disease

Cell-Free Liquid Biopsy Test for Ovarian Cancer Proves 91% Accurate

ovarian cancer | Image credit: Crystal light – stock.adobe.com A recent analysis investigating the use of an experimental cell-free DNA (cfDNA) liquid biopsy found that the test was 91% accurate at identifying early-stage epithelial ovarian cancer (EOC), a higher rate than that of other tests currently available. The study, published…

Continue Reading Cell-Free Liquid Biopsy Test for Ovarian Cancer Proves 91% Accurate

Cell-Free DNA Methylation Liquid Biopsy Discriminates Ovarian Cancer – Consumer Health News

THURSDAY, Oct. 19, 2023 (HealthDay News) — A classifier based on cell-free DNA (cfDNA) methylation liquid biopsy can discriminate high-grade serous ovarian carcinoma (HGSOC) from benign masses, according to a study published online Oct. 9 in Clinical Cancer Research. David N. Buckley, from the University of Southern California in Los…

Continue Reading Cell-Free DNA Methylation Liquid Biopsy Discriminates Ovarian Cancer – Consumer Health News

Cell-Free DNA Methylation Liquid Biopsy Discriminates Ovarian Cancer | Health

THURSDAY, Oct. 19, 2023 (HealthDay News) — A classifier based on cell-free DNA (cfDNA) methylation liquid biopsy can discriminate high-grade serous ovarian carcinoma (HGSOC) from benign masses, according to a study published online Oct. 9 in Clinical Cancer Research. David N. Buckley, from the University of Southern California in Los…

Continue Reading Cell-Free DNA Methylation Liquid Biopsy Discriminates Ovarian Cancer | Health

how to get genomic locations of Sequence patterns in R

Hi, my current implementation returns the indexes of input genomic range where “CG” are found but i want to get the genomic location matching the pattern. pls see code and example data. thank you in advance for your help getMotif_sites <- function(ref_genome=NULL, grList=NULL, context=”CG”){ library(Biostrings) # Load ref genome of…

Continue Reading how to get genomic locations of Sequence patterns in R

Comparing feature selection and machine learning approaches for predicting CYP2D6 methylation from genetic variation

1National University of Singapore, Singapore 2Singapore Institute for Clinical Sciences (A*STAR), Singapore 3KK Women’s and Children’s Hospital, Singapore 4Duke-NUS Medical School, Singapore 5National University Hospital, Singapore 6Yale-NUS College, Singapore 7National Healthcare Group, Singapore 8Institute…

Continue Reading Comparing feature selection and machine learning approaches for predicting CYP2D6 methylation from genetic variation

R encountered fatal error when using processBismarkAln in methylKit

R encountered fatal error when using processBismarkAln in methylKit 2 Hi I am attempting to use methylkit to analyse my RRBS data but cannot seem to be able to import my files. I have .bam files generated from bismark. I read I can use function processBismarkAln to read these kind…

Continue Reading R encountered fatal error when using processBismarkAln in methylKit

Interpreting the CpG pearson correlation plot

Interpreting the CpG pearson correlation plot 0 I have performed DMR analysis using Methylkit and have generated the correlation plot but i am not able to interpret it completely. Apart from the correlation % what do the bar plots, color and x and y axis signify? Differential-methylation • 33 views…

Continue Reading Interpreting the CpG pearson correlation plot

Computational Tools – PacBio

Paraphase Paraphase is a computational tool for variant calling in homologous genes, for either WGS or targeted sequencing. Paraphase was introduced for gene profiling of spinal muscular atrophy (SMA), for which it successfully identified full-length SMN1 and SMN2 haplotypes. This tool is also accessible through our partner platform DNAnexus. This…

Continue Reading Computational Tools – PacBio

Ultra-fast deep-learned CNS tumour classification during surgery

Data simulation Short nanopore sequencing runs yield sparse and random coverage of the genome. To enable model training, we generate simulated sparse nanopore runs based on microarray data. To this end, N simulated reads are randomly sampled from the read length distribution (D) and assigned a start mapping position in…

Continue Reading Ultra-fast deep-learned CNS tumour classification during surgery

“Argonaute 4 promotes genomic methylation” by Kanwalat Chalertpet

Other Title (Parallel Title in Other Language of ETD) โปรตีนอะโกรนอท 4 กระตุ้นการเกิดเมทิลเลชั่นของจีโนม First Advisor Apiwat Mutirangura Faculty/College Graduate School (บัณฑิตวิทยาลัย) Degree Name Doctor of Philosophy Degree Level Doctoral Degree Degree Discipline Biomedical Sciences DOI 10.58837/CHULA.THE.2019.29 Abstract RNA-directed DNA methylation (RdDM) is the major small RNA-mediated epigenetic pathway in plants. Similar…

Continue Reading “Argonaute 4 promotes genomic methylation” by Kanwalat Chalertpet

Diagnosing and monitoring pancreatic cancer through cell-free DNA methylation: progress and prospects | Biomarker Research

The exploration of methylated biomarkers in plasma for pancreatic cancer is still in its early stages, and the number of studies conducted to date for this purpose is limited. Analysis of cfDNA methylation patterns in pancreatic cancer has been approached both at the whole genome level and by identifying and…

Continue Reading Diagnosing and monitoring pancreatic cancer through cell-free DNA methylation: progress and prospects | Biomarker Research

Study helps explain how the brain adapts during a critical period of adulthood

Oct 5 2023 Developing brains become shaped by the sights, sounds, and experiences of early life. The brain’s circuits grow more stable as we age. However, some experiences later in life open up opportunities for these circuits to be rapidly rewired. New research from Cold Spring Harbor Laboratory Associate Professor…

Continue Reading Study helps explain how the brain adapts during a critical period of adulthood

Gene Set – PPP6C

Symbol Name ACTR3 ARP3 actin-related protein 3 homolog (yeast) ADAR adenosine deaminase, RNA-specific ADNP activity-dependent neuroprotector homeobox ANAPC13 anaphase promoting complex subunit 13 ARF6 ADP-ribosylation factor 6 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ATP5J2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 ATP5L ATP…

Continue Reading Gene Set – PPP6C

Integrative single-nucleus multi-omics analysis prioritizes candidate cis and trans regulatory networks and their target genes in Alzheimer’s disease brains | Cell & Bioscience

Lo MT, Kauppi K, Fan CC, Sanyal N, Reas ET, Sundar VS, Lee WC, Desikan RS, McEvoy LK, Chen CH, Alzheimer’s Disease Genetics, C. Identification of genetic heterogeneity of Alzheimer’s disease across age. Neurobiol Aging. 2019;84(243):e241-243. doi.org/10.1016/j.neurobiolaging.2019.02.022. Article  Google Scholar  Nacmias B, Bagnoli S, Piaceri I, Sorbi S. Genetic heterogeneity…

Continue Reading Integrative single-nucleus multi-omics analysis prioritizes candidate cis and trans regulatory networks and their target genes in Alzheimer’s disease brains | Cell & Bioscience

DMRcate design

Hi all, I am trying to use DMRcate first time for epic array data. I have done the limma association analysis using below model design but not sure how to design model metrix for DMRcate for same type of BMI and CpG sites association analysis; Could you help me if…

Continue Reading DMRcate design

Mitochondrial DNA damage triggers spread of Parkinson’s disease-like pathology

Lack of IFNβ/IFNAR signaling causes mtDNA oxidization and mutation in a hotspot in complex I respiratory chain subunits mimicking PD brain pathology We analyzed transcriptomic datasets from sPD patients [28] to identify molecular pathways related to the disease pathology. Dysregulated oxidative phosphorylation (OXPHOS) emerged as the top-ranked pathway in sPDD, patients with…

Continue Reading Mitochondrial DNA damage triggers spread of Parkinson’s disease-like pathology

Nobel Prize for mRNA Vaccines

Katalin Karikó, a biochemist at BioNTech, Szeged University, and the University of Pennsylvania (UPenn), and Drew Weissman, an immunologist at UPenn, won this year’s Nobel Prize in Physiology or Medicine “for their discoveries concerning nucleoside base modifications that enabled the development of effective mRNA vaccines against COVID-19,” the Nobel Assembly…

Continue Reading Nobel Prize for mRNA Vaccines

Epstein-Barr virus infection: the micro and macro worlds | Virology Journal

Epstein MA, Achong BG, Barr YM. VIRUS PARTICLES IN CULTURED LYMPHOBLASTS FROM BURKITT’S LYMPHOMA. Lancet. 1964;1(7335):702–3. Article  CAS  PubMed  Google Scholar  Cohen JI, Jaffe ES, Dale JK, Pittaluga S, Heslop HE, Rooney CM, et al. Characterization and treatment of chronic active Epstein-Barr virus disease: a 28-year experience in the United…

Continue Reading Epstein-Barr virus infection: the micro and macro worlds | Virology Journal

age-related methylation changes across the whole genome

Aging is a biological process that is characterized by a gradual decline in the function of organs leading to increased vulnerability to several diseases. We can see and feel it happening, but the process also happens on a molecular level – research has highlighted epigenetic modifications such as DNA methylation,…

Continue Reading age-related methylation changes across the whole genome

Cost-effective DNA methylation profiling by FML-seq

The FML-seq method The protocol for FML-seq comprises only three steps (Fig 1A). First, genomic DNA (gDNA) is digested by a methylation-dependent restriction endonuclease that cuts at a certain distance from the 5-methylcytosine or 5-hydroxymethylcytosine in its motif and leaves a short overhang (10). Second, a master mix is added…

Continue Reading Cost-effective DNA methylation profiling by FML-seq

The blackcap (Sylvia atricapilla) genome reveals a recent accumulation of LTR retrotransposons

The genome assembly was performed with the pipeline v1.5 of the Vertebrate Genomes Project (VGP) and can be found under NCBI BioProject PRJNA558064, accession number GCA_009819655.1, for further details on the sample collection and assembly see Ishigohoka et al.9. In brief, a female blackcap from mainland Spain was caught to…

Continue Reading The blackcap (Sylvia atricapilla) genome reveals a recent accumulation of LTR retrotransposons

Molecular classification of hormone receptor-positive HER2-negative breast cancer

Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 70, 7–30 (2020). Article  PubMed  Google Scholar  Huppert, L. A., Gumusay, O., Idossa, D. & Rugo, H. S. Systemic therapy for hormone receptor-positive/human epidermal growth factor receptor 2-negative early stage and metastatic breast cancer….

Continue Reading Molecular classification of hormone receptor-positive HER2-negative breast cancer

Into the Multi-ome: Four high-quality ‘omes from a single Revio SMRT Cell run

 As Marvel superheroes traverse the multiverse to save the day, genomics researchers are our superheroes as they navigate the daunting multiverse that is biology. The complex and dynamic interactions between the genome sequence, its epigenetic regulation, and their combined effects on transcript expression and splicing are fundamental to our understanding…

Continue Reading Into the Multi-ome: Four high-quality ‘omes from a single Revio SMRT Cell run

Comparing multiple columns from two files using AWK

Dear all, I need your help to solve the following problem. I have the following two files (indicated as A and B): FILE A: head 129N.final-test_taxid-120686.txt A00270:507:H3KTJDSX5:4:1105:31747:1736 1187 chr1 205559197 60 144M6S = 205559203 152 GAGCATTTAGGCAAGAGAAAGGAACAAAGGGTATCCAAATTGAAAAACAGGAGTCAAATTGTCCCTTTGCAGACAACAGGATTTTACATATAGAAAAATCTAAAAGATCACACACACACACACACACACACACACACACACACACACAAA FFFFFFFFFFFFFFF:FFFFFFFFFFF:FF:FFFF,FFFFF:FFFF:F:FFFFFF:F:FFFFFF:FFFFFF:FF,FFFFFFFFFFFFFFFFFFFFFF::,FFFF::,FFF,F:FFFFFFFFFFFFFFFF,FFFFFFFFFF:,F,FF,FF: NM:i:0 AS:i:288 nn:i:0 tp:A:P cm:i:18 s1:i:120 s2:i:0 de:f:0 rl:i:86 MQ:i:50 MC:Z:102M4I44M ms:i:4398 A00270:507:H3KTJDSX5:4:1105:31747:1736…

Continue Reading Comparing multiple columns from two files using AWK

How-to: Profile the epigenome

The epigenome regulates the expression of genes without altering their underlying DNA sequence. Comprising a dynamic landscape of chemical modifications and structural changes to DNA and its associated histone proteins, the epigenome wields profound influence over cellular identity and function. Epigenetic mechanisms, such as DNA methylation and histone modifications, form…

Continue Reading How-to: Profile the epigenome

Recent animal study finds that perinatal SAMe supplementation may reduce risk of developing Alzheimer’s Disease

Gnosis by Lesaffre has announced the results of a study that investigates the potential of S-adenosylmethionine (SAMe) to repress the expression of genes associated with the development of Alzheimer’s disease. Because previous studies have indicated that epigenetic signatures that can lead to diseased aging can be acquired at early life…

Continue Reading Recent animal study finds that perinatal SAMe supplementation may reduce risk of developing Alzheimer’s Disease

Systemic epigenome-wide association study of elk treponeme-associated hoof disease

Study samples were obtained from Rocky Mountain elk collected in Washington, Idaho, and South Dakota and from Roosevelt elk from Washington, Oregon, and California. Only cases with required metadata (location of collection and sex) and confirmed diagnosis of TAHD present or not detected were included in the analysis. Treponeme-associated hoof…

Continue Reading Systemic epigenome-wide association study of elk treponeme-associated hoof disease

New Cell & Gene Therapy Solutions From Form Bio Analyze Billions of Potential Construct Candidates, Reducing Time-to-Clinic

Powerful New Solutions Help Therapeutic Developers Reduce Time-to-Clinic While Increasing Yield and Safety DALLAS, September 14, 2023 (Newswire.com) – Form Bio, the provider of advanced computational life sciences technology, announced today capabilities for cell and gene therapy companies to rapidly model billions of potential construct candidates. With great progress to…

Continue Reading New Cell & Gene Therapy Solutions From Form Bio Analyze Billions of Potential Construct Candidates, Reducing Time-to-Clinic

The genomic footprint of whaling and isolation in fin whale populations

Samples and sequencing Tissue samples from 50 fin whales (Balaenoptera physalus) were collected using a standard protocol to obtain skin biopsies from free-ranging cetacean species, which use a small stainless-steel biopsy dart deployed from a crossbow or rifle73,74. These samples were collected throughout the Eastern North Pacific (ENP; N = 30, represented…

Continue Reading The genomic footprint of whaling and isolation in fin whale populations

BiocMAP: a Bioconductor-friendly, GPU-accelerated pipeline for bisulfite-sequencing data | BMC Bioinformatics

Overview In the first alignment module, FASTQ files are checked with FastQC 0.11.8 [15], and by default samples that fail the “Adapter Content” metric are trimmed using Trim Galore! 0.6.6 [16] (see Methods: Configuration for alternative trimming options). The resulting FASTQ files are aligned to a reference genome using the…

Continue Reading BiocMAP: a Bioconductor-friendly, GPU-accelerated pipeline for bisulfite-sequencing data | BMC Bioinformatics

Are Your Formulations Affecting DNA Methylation?

There is growing evidence that dynamic DNA methylation occurs throughout an individual’s lifetime and is correlated with age and age-related health outcomes. Skin aging is often marked by the establishment of global hypomethylation and regions of CpG island hypermethylation that affect the expression of genes such as collagen, elastin and…

Continue Reading Are Your Formulations Affecting DNA Methylation?

Calcium electroporation of esophageal cancer induces gene expression changes: a sub-study of a phase I clinical trial

Ágoston D, Baltás E, Ócsai H, Rátka S, Lázár PG, Korom I et al (2020) Evaluation of calcium electroporation for the treatment of cutaneous metastases: a double blinded randomised controlled phase II trial. Cancers. doi.org/10.3390/cancers12010179 Article  PubMed  PubMed Central  Google Scholar  Alrumaihi F (2022) The multi-functional roles of CCR7 in…

Continue Reading Calcium electroporation of esophageal cancer induces gene expression changes: a sub-study of a phase I clinical trial

Genome-wide DNA methylation patterns in bumble bee (Bombus vosnesenskii) populations from spatial-environmental range extremes

Orr, H. A. The genetic theory of adaptation: A brief history. Nat. Rev. Genet. 6, 119–127 (2005). Article  CAS  PubMed  Google Scholar  Dillon, M. E. & Lozier, J. D. Adaptation to the abiotic environment in insects: the influence of variability on ecophysiology and evolutionary genomics. Curr. Opin. Insect Sci. 36,…

Continue Reading Genome-wide DNA methylation patterns in bumble bee (Bombus vosnesenskii) populations from spatial-environmental range extremes

Promising new cervical cancer test fills in the gap missed by Pap tests

In a recent study published in the Journal of the National Cancer Institute, researchers assessed a novel human papillomavirus (HPV) and host deoxyribonucleic acid (DNA) methylation score for adenocarcinoma in-situ (AIS) and cervical adenocarcinoma (ADC) screening. Study: A novel human papillomavirus and host DNA methylation score and detection of cervical…

Continue Reading Promising new cervical cancer test fills in the gap missed by Pap tests

Tips and best practices for DNA methylation studies

This article features interviews with leading experts who discuss the impact of DNA methylation in biological processes involved in development and aging and disease states like cancer and neurological disorders. Expert panel: Per Hoffman (Life & Brain Genomics; Germany) Robert Hillary (University of Edinburgh; UK) Jörg Tost (Centre National de…

Continue Reading Tips and best practices for DNA methylation studies

Liquid Biopsy Might Be Useful in the Detection of Colorectal, Lung Cancer

Methylation-sensitive restriction enzyme digestion followed by sequencing (MRE-Seq) was found to be an advantageous method for identifying global hypomethylation patterns in liquid biopsy samples and precisely diagnosing colorectal and lung cancers, as well as determining the cancer signal origin (CSO) of the cancer using deep neural network (DNN) analysis, according…

Continue Reading Liquid Biopsy Might Be Useful in the Detection of Colorectal, Lung Cancer