Tag: Cutadapt

Strains and growth conditions All strains and plasmids used in this work are described in Supplementary Table 1. The clinical isolates were obtained from the Cystic Fibrosis Foundation Isolate Core at Seattle Children’s Hospital and were originally isolated from two different cystic fibrosis patients. Distribution of these isolates is covered by…

Dargie, G. C. et al. Age, extent and carbon storage of the central Congo Basin peatland complex. Nature 542, 86–90 (2017). Article  ADS  CAS  PubMed  Google Scholar  Page, S. E., Rieley, J. O. & Banks, C. J. Global and regional importance of the tropical peatland carbon pool. Global Change Biology…

Study sites Soils were collected from two different sites (ARDEC: Colorado State University’s Agricultural Research, Development and Education Center in Fort Collins, CO; and CPCRC: USDA Columbia Plateau Conservation Research Center in Pendleton, OR). At each site, four replicate plots of no-till corn (ARDEC) or no-till annual wheat (CPCRC) were…

acCRISPR framework acCRISPR performs essential gene identification by calculating two scores for each sgRNA, namely the cutting score (CS) and the fitness score (FS). CS and FS are the log2-fold change of sgRNA abundance in the appropriate treatment sample with respect to that in the corresponding control sample (see Supplementary…

Tool:ChatGPT optimized for bioinformatics questions 1 Hey everyone! I launched a new chatbot today that is bioinformatics focused! It’s trained on bioinformatics content and should help debug / ideate much faster for you than vanilla ChatGPT. Check it out here: ai.tinybio.cloud/chat Thanks! gpt • 165 views • link updated 1…

Correct way to remove Nextera adapters from ITS sequences 0 Hi everyone, I think this question has been coming up a few times but it didn’t help me solve my issue. I have FastQ files from ITS amplicon based metagenomic sequencing (ITS1/2) (300 bp) and FastQC tells me that they…

Introduction The definition of an individual organism, traditionally defined by the invariable presence of a physiological unit and genetic homogeneity, is challenged by situations such as intraorganismal genetic heterogeneity (IGH), which refers to the presence of more than one genotype in a single organism (Schweinsberg et al., 2015). Cells within a…

Upgrade In Progress:  EvE Premium is unavailable during the upgrade process. The new, upgraded version is scheduled for release in May 2023. Create Your Own Bioinformatics Pipeline: Powerful and Easy-to-use. Design your own ultra-fast, cloud-based pipeline in seconds. Use defaults or define specific parameters. It’s your choice! Preprocessing ✯ Alignment & Mapping…

Carlson, J. L., Erickson, J. M., Lloyd, B. B. & Slavin, J. L. Health effects and sources of prebiotic dietary fiber. Curr. Dev. Nutr. 2, nzy005 (2018). Article  PubMed  PubMed Central  Google Scholar  Deehan, E. C. et al. Precision microbiome modulation with discrete dietary fiber structures directs short-chain fatty acid…

Introduction Sarcoidosis is a multisystem inflammatory disease of unknown aetiology that is characterised by non-caseating epithelioid granulomatous lesions (aggregates of lymphocytes, macrophages, epithelioid cells, and giant cells).1 Typical clinical features include bilateral hilar lymph node lesions, pulmonary infiltration, and eye and skin lesions. Some patients may also have neurological and…

Hunt, T. et al. A comprehensive phylogeny of beetles reveals the evolutionary origins of a superradiation. Science 318, 1913–1916 (2007). Article  ADS  CAS  PubMed  Google Scholar  Crowson, R. A. The phylogeny of coleoptera. Annu. Rev. Entomol. 5, 111–134 (1960). Article  Google Scholar  Darwin, C. The Descent of Man, and Selection…

Participants This is an observational case–control study, carried out in adult patients who attended the Endocrinology and Nutrition Service of the Central University Hospital of Asturias, between June 2019 and December 2021. Written informed consent was obtained from all participants and the study was conducted in accordance with the principles…

Error while running Megahit 0 Hi, Myself Abhirami, Currently pursuing Ph.D., for a paper publication currently I’m working on mitogenomic sequences. So as the initial steps, I proceed successfully with fastp (Quality checking), cutadapt, bwa mem (to remove host genome). But, while running megahit, I reached up with many difficulties…

Below is my command.qiime cutadapt demux-paired –i-seqs asap2_out/imported/fqMuBiPe-1.qza –m-forward-barcodes-file input//fqMuBiPe-1/metadata.tsv –m-forward-barcodes-column barcode-sequence –o-per-sample-sequences asap2_out/demultiplexed/fqMuBiPe-1-demux.qza –o-untrimmed-sequences asap2_out/demultiplexed/fqMuBiPe-1-untrimmed.qza The output has many partial reads because there were reads (e.g. reverse complementary, or contaminants) with no barcode at the beginning, but with a fake barcode (randomly matched) in the middle, and qiime mistook…

Cutadapt error: too many parameters. 0 Hi biostars community! I am having issues to loop cutadapt over gunzipped samples. This is the script I am using: #!/bin/bash #SBATCH –account GRINFISH #SBATCH -c 8 #SBATCH –mem 96g #SBATCH –output logfile.out #SBATCH –error logfile.err # This script performs trimming for PE sequences…

Hi, I followed the dada2 tutorial on 16S and ITS amplicon metagenomic data from soil samples. However, when trying to assign a taxonomic rank to my ASV table using DECIPHER, I only get “NAs”. When using the dada2 native’s Bayesian method, I get “NA” or “Mitochondria” (family). For my 16S…

Klepeis, N. E. et al. The National Human Activity Pattern Survey (NHAPS): A resource for assessing exposure to environmental pollutants. J. Expo. Anal. Environ. Epidemiol. 11, 231–252 (2001). CAS  PubMed  Google Scholar  Richardson, A. et al. Office design and health: A systematic review. N. Z. Med. J. 130, 39–49 (2017)….

Hello all, I’m looking for guidance on how to write a non-interactive job script for qiime2. The HPC I have access to uses LSF and docker images, which are both new to me. So far, I have been creating an interactive shell to use qiime2 (I created a .sh file…

Anderson MJ (2001) A new method for non‐parametric multivariate analysis of variance. Austral Ecol 26(1):32–46 Google Scholar  Anderson MJ (2004) PERMDISP: a FORTRAN computer program for permutational analysis of multivariate dispersions (for any two-factor ANOVA design) using permutation tests. Department of Statistics, University of Auckland, New Zealand, 24. Aykanat T,…

Tried to create an environment using Conda and was not able to do so. Have copy pasted the message below. Would be grateful to know what the issue is and how to resolve the issue. (base) C:\Users\Mathangi Janakiraman>wget data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.yml–2023-05-11 12:54:47– data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.ymlResolving data.qiime2.org (data.qiime2.org)… 54.200.1.12Connecting to data.qiime2.org (data.qiime2.org)|54.200.1.12|:443… connected.ERROR: cannot verify…

Phylogenetic tree construction Tree diagram showing relationships between CDK proteins was constructed from a multi-sequence alignment (MSA) using Geneious95. The “Geneious Aligner”, was used to generate the MSA, and the neighbor joining method was used to construct the tree. All default parameters were used except where otherwise indicated. Combinatorial CRISPR…

GC content of WES cohort 0 Hello, I know a lot of questions have been asked before about GC content, but I just wanted to see if anyone had experience with WES GC content. I have 134 WES (not all the same exome panel or from the same sequencing company)….

My concern here is the possibility of existing adapter dimers, where the 3′-adapter sequence is expected to be located at the 5′-end. If I use the “-b” command, for these adapter dimers, for what i understood, the cutadapt will consider these sequences as 5’adapters instead of 3′-adapters and, thus, will…

Plasmid design The information on each plasmid for combinatorial libraries is indicated in Supplementary Table S1. Plasmids used in this study to generate combinatorial libraries for SpCas9, enAsCas12a, CHyMErA, enAsCas12a (dual-gRNA), CHyMErA.v2, multiSPAS were deposited to Addgene (IDs: 189632, 189633, 189634, 189635, 189636, 189637, respectively). 3Cs oligonucleotide design The protocol…

Enter a project name for your analyze runner. This name will help you identify insert final in case yours do manifold runs in a brawl. Provision of an email site exists optional, but desires rented you safely close the browser during the analysis and receive a notification following verwirklichung. Upload…

High number of duplicates and low percentage properly paired 0 I have some paired end sequencing data that I have trimmed using cutadapt. It was sequenced on an illumina novaseq 6000 and is low coverage RADseq data (2-3x). My cutadapt script used forward and reverse adapters from illumina : cutadapt…

Abbott R, Albach D, Ansell S, Arntzen JW, Baird SJE, Bierne N, Zinner D (2013) Hybridization and speciation. J Evolut Biol 26:229–246. doi.org/10.1111/j.1420-9101.2012.02599.x Article  CAS  Google Scholar  Arntzen JW (2019) An amphibian species pushed out of Britain by a moving hybrid zone. Mol Ecol 28:5145–5154 Article  PubMed  PubMed Central  Google…

Barcoding and demultiplexing in high-throughput sequencing experiments Barcoding, or indexing, is a widely used strategy in high-throughput sequencing experiments. This method enables the multiplexing of numerous samples in a single sequencing run by adding a unique DNA sequence to each sample before sequencing. During sequencing, the barcodes are read along…

Hello, New user here, still trying to set up a workflow that works… I got as far as assigning Taxonomy using a pre-trained database (silva138_AB_V4_classifier.qza).However, there are still some unassigned sequences left. When I want to make a barplot, I get an error because some ‘ Feature IDs found in…

Tool Tool Name Description Removes adapter sequences and trims low quality bases from the 3′ end of reads. Overlapping paired-ended reads can be merged into consensus sequences and adapter sequence can be found for paired-ended data if not known. Automatic Filtering, Trimming, Error Removing and Quality Control for fastq data….

Back to Bioinformatics Main Menu Evaluation FastQC GCATemplates available: grace terra module spider FastQC After running FastQC via the command line, you can ssh to an HPRC cluster enabling X11 forwarding by using the -X option and view the images using the eog tool. From your desktop: ssh -X username@grace.hprc.tamu.edu From your FastQC working…

Ethics statement All animal experimentation was conducted according to the National Institutes of Health guidelines for the housing and care of laboratory animals. All experiments were performed in accordance with institutional regulations after review and approval by the Animal Studies Committee at Washington University School of Medicine in St Louis,…

Precht, W. F., Gintert, B. E., Robbart, M. L., Fura, R. & van Woesik, R. Unprecedented disease-related coral mortality in Southeastern Florida. Sci. Rep. 6, 31374 (2016). Article  CAS  PubMed  PubMed Central  Google Scholar  Knowlton, N. et al. Rebuilding coral reefs: a decadal grand challenge. 1–55 doi.org/10.53642/NRKY9386 (2021). Walton, C….

Schmitz, J. F. & Bornberg-Bauer, E. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA. F1000Research 6, 57 (2017). Article  PubMed  PubMed Central  Google Scholar  Vakirlis, N. et al. De novo emergence of adaptive membrane proteins from thymine-rich genomic sequences. Nat. Commun. 11,…

Wei_Zhang (Wei Zhang) April 5, 2023, 4:22pm 1 Hello everyone, I apply qiime2 to my 16S rRNA sequencing data, which is an amplification of the V4 region with a primer pair of “GTGCCAGCMGCCGCGGTAA” and “GGACTACHVGGGTWTCTAAT”. Whereas I use the cutadapt plugin to remove the primer with different commands below, some…

Small RNAs are important functional molecules in organisms, which have three main categories: microRNA (miRNA), small interfering RNA (siRNA), and piwi-interacting RNA (piRNA). They are less than 200 nt in length and are often not translated into proteins. Small RNA generally accomplishes RNA interference (RNAi) by forming the core of…

MultiQC output: opposing output 1 Hi, I’m working with RAD genomic data (produced through genotype-by-sequencing). Two panels in my MultiQC document seem to contradict one another, the “Trimmed Sequence Lengths (3′)” and the “Sequence Length Distribution” panels. I expect a lot of duplication because of the GBS protocol. In the…

First (and last?) time running qiime. All I am trying to do at the moment is demultiplex. Qiime cutadapt is unable parse my metadata file no matter what I do to it. I’ve spent hours trying to fix this ridiculous bug. It seems most likely that the cutadapt plugin isn’t…

how to know what adapter sequences to trim for RNA-seq? 0 Hello, I’m very new to RNA-seq analysis and am currently stuck on the trimming step. The libraries I am trying to analyze were built using the NEXTFLEX Rapid Directional RNA-seq kit with their Unique Dual Index Barcodes (perkinelmer-appliedgenomics.com/wp-content/uploads/2022/02/NOVA-51292X-NEXTFLEX-RNA-Seq-2-0-UDI-Barcodes-V22-02-new.pdf). They…

Is it ok to trim assembled paired-end fastq files with cutadapt 3.4 ? 0 Hi, I don’t know much about bioinformatics and R language, I just know how to use some bioinformatic tools in a simple way. That´s why I prefer to follow simple tools to analyze my Illumina seqs…

Name Last modified Size Description Parent Directory   –   CH01-06.trimmed.R1.f..> 2023-02-07 11:02 1.0G   CH01-06.trimmed.R2.f..> 2023-02-07 11:02 1.0G   CH01-14.trimmed.R1.f..> 2023-02-07 11:06 2.2G   CH01-14.trimmed.R2.f..> 2023-02-07 11:06 2.2G   CH01-22.trimmed.R1.f..> 2023-02-07 11:08 1.4G   CH01-22.trimmed.R2.f..> 2023-02-07 11:08 1.4G   CH01-38.trimmed.R1.f..> 2023-02-07 11:12 1.9G   CH01-38.trimmed.R2.f..> 2023-02-07 11:12 1.9G  …

Animals All the procedures and protocols were approved by the Institutional Animal Care and Use Committee of the National Institute for Basic Biology (15A005, 14A003, 13A023, 12A020, 11A028) and Kyushu University (A21-043-0, A19-137-0, A19-137-1, A19-137-2, A29-088-0, A29-088-1, A29-088-2). Japanese medaka (Oryzias latipes) were bred and maintained under artificial reproductive conditions…

Grabowski P, Zaug A, Cech T. The intervening sequence of the ribosomal RNA precursor is converted to a circular RNA in isolated nuclei of Tetrahymena. Cell. 1981;23(2):467–76. Article  CAS  PubMed  Google Scholar  Ye C, Chen L, Liu C, Zhu Q, Fan L. Widespread noncoding circular RNAs in plants. New Phytol….

Zoey_Hall (Zoey Hall) March 10, 2023, 7:37pm 1 Hi Qiime team, I am an undergrad working on a comparative microbiome research project with @Sam_Degregori. I am importing casava 1.8 paired-end files formatted as so: SRR14041259_16SS_sequencing_of_carnivore_and_herbivore_mammals_1.fastq.gzSRR14041259_16SS_sequencing_of_carnivore_and_herbivore_mammals_2.fastq.gz However, I keep getting this error. qiime tools import \ –type ‘SampleData[PairedEndSequencesWithQuality]’ –input-path zoelzer –input-format…

Inagaki, F., Takai, K., Kobayashi, H., Nealson, K. H. & Horikoshi, K. Sulfurimonas autotrophica gen. nov., sp. nov., a novel sulfur-oxidizing e-proteobacterium isolated from hydrothermal sediments in the Mid-Okinawa Trough. Int. J. Syst. Evol. Microbiol. 53, 1801–1805 (2003). Article  CAS  PubMed  Google Scholar  Timmer-Ten Hoor, A. A new type of…

Mice Mice were of mixed genetic background C57BL/6 and 129/SvJ. Mice were bred and maintained under specific-pathogen-free conditions at the Breeding Unit (BRU) at the CRUK Cambridge Institute. Fh1fl/fl (ref. 4) and R26-Cre-ERT2 (ref. 5) mice were gifts from E. Gottlieb and D. Winton, respectively. Experimental mice were homozygous for…

Next-generation sequencing (NGS), which makes millions to billions of sequence reads at a fast rate, has greatly sped up genomics research. At the moment, Illumina, Ion Torrent/Life Technologies, 454/Roche, Pacific Bioscience, Nanopore, and GenapSys are all NGS platforms that can be used. They can produce reads of 100–10,000 bp in…

Cutadapt using nano command 1 Dear all, I am new to the world of bioinformatics and I am trying to use the cutadapt to a series of files I have. The post doc in my lab. suggested I use “nano command” but it’s not working out for me. every time…

cutadapt error problem 2 Hi, I am trying to use cutadapt installed from conda. I am running this command : cutadapt -a cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/unzipped/barcodes.fasta -o cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/output.fastq input cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/unzipped/Pool1_S1_L001_R1_001.fastq and it complains cutadapt: error: Too many parameters. Can someone kindly tell me what am I doing wrong here. regards….

Cell lines Immortalised HA1E (hTERT and SV40ER) and tumourigenic HA1ER cells (hTERT, SV40ER and HRAS-G12V) from stepwise tumourigenesis models generated from normal human embryonic kidney cells were obtained from Dr. Hahn (Broad Institute of MIT and Harvard, Cambridge, USA). Cells were cultured in DMEM (1 g/L glucose) (Gibco, cat. #10567014) supplemented…

Willing, B. P. et al. A pyrosequencing study in twins shows that gastrointestinal microbial profiles vary with inflammatory bowel disease phenotypes. Gastroenterology 139, 1844–1854 (2010). Article  PubMed  Google Scholar  Morgan, X. C. et al. Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment. Genome Biol. 13, R79 (2012)….

Fuhrman, J. A. Microbial community structure and its functional implications. Nature 459, 193–199 (2009). Article  CAS  PubMed  Google Scholar  Graham, E. B. et al. Microbes as engines of ecosystem function: when does community structure enhance predictions of ecosystem processes? Front. Microbiol. 7, 214 (2016). Article  PubMed  PubMed Central  Google Scholar …

Sequencing read QC using Galaxy Lead trainer: Tom Harrop (Melbourne Bioinformatics, The University of Melbourne) Workshop Description: This beginners tutorial will teach you how to use the Galaxy’s interface to perform quality control of raw long and short read sequencing data. The material covered in this workshop is freely available…

Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med. 1995;332:1186–91. Article  CAS  PubMed  Google Scholar  Nador RG, Cesarman E, Chadburn A, Dawson DB, Ansari MQ, Sald J, et al. Primary effusion lymphoma: a distinct clinicopathologic entity…

Croft, M. T., Lawrence, A. D., Raux-Deery, E., Warren, M. J. & Smith, A. G. Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature doi.org/10.1038/nature04056 (2005). Article  PubMed  Google Scholar  Kazamia, E. et al. Mutualistic interactions between vitamin B12-dependent algae and heterotrophic bacteria exhibit regulation. Environ. Microbiol. doi.org/10.1111/j.1462-2920.2012.02733.x…

Hello, I am trying to learn DNA sequencing analysis by using GIAB datasets [Link to Chinese trio – HG005_NA24631_son/], the readme file they had provided does not provide the adapter sequences used. I tried to use bbmerge.sh like in this biostars post ; bbmerge.sh in1=r1.fq in2=r2.fq outa=adapters.fa and it identified…

Creating reference genome that includes HIV genome 1 Hi all, In this paper (www.ncbi.nlm.nih.gov/pmc/articles/PMC9831945/) the authors use a reference genome that includes the HIV genome. Seen in this sentence of the paper: “Adapters and low-quality bases were trimmed using Cutadapt v1.18 software 11 before alignment with the human reference genome(hg38andHIV-1:…

Hall, B. K. & Wake, M. H. in The Origin and Evolution of Larval Forms (eds Hall, B. K. & Wake, M. H.) 1–19 (Academic Press, 1999). Nielsen, C. Animal phylogeny in the light of the trochaea theory. Biol. J. Linn. Soc. 25, 243–299 (2008). Article  Google Scholar  Garstang, W….

RNA-seq library size – significant sample discrepency 2 Hello, I’ve been given some data to perform differential expression on, and it the process of QCing the resultant count data, I’m seeing that the library sizes have pretty big discrepancies between the 2 samples shown below. I know a good run…

Only very recently (~2 weeks ago), cutadapt installed via conda has the following error: This is cutadapt 3.2 with Python 3.8.6 Command line parameters: -j 4 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC in2438_3_CKDL210000739-2a-AK5142-AK6697_HVHF2DSXY_L2_1.fq.gz Processing reads on 4 cores in single-end mode … [———>8 ] 00:00:26 5,536,084 reads @…

Boore, J. L. Animal mitochondrial genomes. Nucleic Acids Res. 27, 1767–1780 (1999). Article  CAS  Google Scholar  Calvo, S. E., Clauser, K. R. & Mootha, V. K. MitoCarta2. 0: an updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res. 44, D1251–D1257 (2016). Article  CAS  Google Scholar  Andrews, R. M. et al….

Eisenstein, M. Big data: the power of petabytes. Nature 527, S2–S4 (2015). Article  CAS  Google Scholar  Trewavas, A. A brief history of systems biology: ‘Every object that biology studies is a system of systems’. Francois Jacob (1974). Plant Cell 18, 2420–2430 (2006). Article  CAS  Google Scholar  Dixon, S. J., Costanzo,…

Sample collection Colobanthus quitensis samples were collected at King George Island near the Henryk Arctowski Polish Antarctic Station, Maritime Antarctica (62°14’ S, 58°48’ W) during the summer season (February 2018). Samples were collected inside the Antarctic Specially Protected Area (ASPA) 128 using permits provided by The Chilean Antarctic Institute (INACH)…

Orient nanopore reads without trimming the adapters using cutadapt and pychopper 0 Hello, I want to orient demultiplexed reads based on 3′ adapter without trimming the adapter (keep entire read). I would like to get any suggestions on this. I have looked in to pychoppper and primer-chop tools. As I…

Woolhouse MEJ, Gowtage-Sequeria S. Host range and emerging and reemerging pathogens. Emerg Infect Dis. 2005;11:1842–7. Article  PubMed  PubMed Central  Google Scholar  Allen T, Murray KA, Zambrana-Torrelio C, Morse SS, Rondinini C, Di Marco M, et al. Global hotspots and correlates of emerging zoonotic diseases. Nat Commun. 2017;8:1–10. Article  CAS  Google…

Niikawa N, Matsuura N, Fukushima Y, Ohsawa T, Kajii T. Kabuki make-up syndrome: a syndrome of mentalretardation, unusual facies, large and protruding ears, and postnatal growth deficiency. J Pediatrics. 1981;99:565–9. CAS  Article  Google Scholar  Kuroki Y, Suzuki Y, Chyo H, Hata A, Matsui I. A new malformation syndrome of long…

Sign Up Log In Log In Popular installing qiime2 with conda – executing transaction timeoutUser Support Cannot run DADA2 in the tutorialsTechnical Support meta analysis and weird looking emperor plot of beta-analysisUser Support QIIME 2 2022.8 is now available!Announcements Qiime Plugin error from fragment-insertionTechnical Support [RESOLVED] Notice to Multi-User System…

Darwin, C. On the Origin of Species by Means of Natural Selection (John Murray, 1859). Owen, R. On the Archetype and Homologies of the Vertebrate Skeleton (Richard and John E. Taylor, 1848). Stern, D. L. & Orgogozo, V. Is genetic evolution predictable? Science 323, 746–751 (2009). CAS  PubMed  PubMed Central …

I’m looking to filter reads that contain a stretch of A’s, I found these posts looking for polyA tails, meaning this should work all the same (Identify RNA-seq reads containing polyA sequence, Identifying RNA-seq reads containing polyA stretch). However, I cannot get it to work. Given just these two reads,…

Patrick Murphy Bulk RNA-Seq – HackMD        owned this note   Published Linked with GitHub — title: ‘Patrick Murphy Bulk RNA-Seq’ disqus: hackmd — Patrick Murphy bulk RNA-Seq Analysis === ## Table of Contents [TOC] ## 1. Introduction This is a bulk RNA-Seq project, which includes human data….

ViReMa not working after adapter trimming 0 Hi, I have a viral RNA-seq dataset that I am trying to run through ViReMa to look for deletion junctions. When I input my fastq files directly into ViReMa without trimming adapters first, my results look about how I would expect (multiple junctions…

recently i receive rowdata from NGS center..and i start analysis using QIIME2 i want ‘cutadapt’, so i ask primer sequence to NGS center..but center reply to me “it is secret” if it is neccessery, i request to NGS center…. thank u for reading Hi @svbreqwaiu01, You do not need to…

Trimming adaptors and primers for RNAseq reads 2 Hi all, I have RNA sequencing (sequenced on NextSeq 2000) reads that I know I need to cut the adaptor sequences off of and was planning to use cutadapt to do so. I have identified the adaptor sequence in my reads, but…

Abramson, J. S. et al. Transcend NHL 001: immunotherapy with the CD19-directed CAR T-cell product JCAR017 results in high complete response rates in relapsed or refractory B-cell non-Hodgkin lymphoma. Blood 128, 4192–4192 (2016). Google Scholar  Shifrut, E. et al. Genome-wide CRISPR screens in primary human T cells reveal key regulators…

cutadapt installation location The documentation on the installation of cutadapt is just a bit misleading, as far as I’m concerned. Cutadapt was just installed as a Python package. The cutadapt executable is probably in /Users/yc/Library/Python/2.7/bin. If that folder is already in your PATH you can just type cutadapt to run…

../ q2-cutadapt_2020.11.1-1.debian.tar.xz 08-Dec-2020 23:18 5540 q2-cutadapt_2020.11.1-1.dsc 08-Dec-2020 23:18 2203 q2-cutadapt_2020.11.1-1_amd64.deb 08-Dec-2020 23:34 2M q2-cutadapt_2020.11.1.orig.tar.gz 08-Dec-2020 23:18 7M q2-cutadapt_2021.8.0-1.debian.tar.xz 18-Oct-2021 21:15 5708 q2-cutadapt_2021.8.0-1.dsc 18-Oct-2021 21:15 2190 q2-cutadapt_2021.8.0-1_amd64.deb 19-Oct-2021 15:52 2M q2-cutadapt_2021.8.0.orig.tar.gz 18-Oct-2021 21:15 7M Read more here: Source link

INTRODUCTION Dengue is the most common mosquito-borne viral disease globally (1). This acute disease, which can be life-threatening, is caused by four different dengue viruses (DENVs) (DENV-1, DENV-2, DENV-3, and DENV-4). An estimated 390 million people are infected with these DENVs annually (2), and populations throughout the tropics face frequent…

Significance Large-scale meteorological and biological data demonstrate the vertical stratification of airborne biomass. The previously described diel cycle of airborne microorganisms is shown to disappear at height. Atmospheric turbulence and stratification are shown to be defining factors for the scale and boundaries, dynamics, and natural variability of airborne biomass, resulting…

INTRODUCTION Mammalian life starts with the fusion of two terminally differentiated gametes, sperm and oocyte, resulting in a totipotent zygote. After going through preimplantation development, the zygote reaches blastocyst before implantation. The two most important events taking place during preimplantation development are zygotic genome activation (ZGA) and the first cell…

Trim Galore is a wrapper around Cutadapt and FastQC to consistently apply adapter and quality trimming to FastQ files, with extra functionality for RRBS data. Installation Trim Galore is a a Perl wrapper around two tools: Cutadapt and FastQC. To use, ensure that these two pieces of software are available…

1. Rapino, F. et al. Codon-specific translation reprogramming promotes resistance to targeted therapy. Nature 558, 605–609 (2018). CAS  PubMed  Google Scholar  2. Goodarzi, H. et al. Modulated expression of specific tRNAs drives gene expression and cancer progression. Cell 165, 1416–1427 (2016). CAS  PubMed  PubMed Central  Google Scholar  3. Wolfe, A….

1. Eyun, S. Phylogenomic analysis of Copepoda (Arthropoda, Crustacea) reveals unexpected similarities with earlier proposed morphological phylogenies. BMC Evol. Biol. 17, 23 (2017). PubMed  PubMed Central  Google Scholar  2. Eyun, S. et al. Evolutionary history of chemosensory-related gene families across the Arthropoda. Mol. Biol. Evol. 34, 1838–1862 (2017). CAS  PubMed …

Hello, I have sequences in paired end that have both primers in R1 and R2 files.For exemple, a sequence in the forward ( R1 ) file :In bold the 2 primers : GTACACACCGCCCGTCGCTCCTACCGATACCGGGTGATCCGGTGAACCTTTTGGACCGTTTTTCGGAAAAATAAGTAAACCATATCACCTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGACCAAGTCTCTGCTACCGTACGTCTTCTTAATCTCGTATGCCGTCTTCTGCTTGAAAATTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG A sequence In the reverse ( R2 ) file: TGATCCTTCTGCAGGTTCACCTACGGAAACCTTGTTACGACTTCTCCTTCCTCTAGGTGATATGGTTTACTTATTTTTCCGAAAAACGGTCCAAAAGGTTCACCGGATCACCCGGTATCGGTAGGAGCGACGGGCGGTGTGTACTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAACGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG I wish to remove the primers to…

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Hello a newbie here, I am reanalyzing an article (GSE83931) for training purpose. I have two concerns/question. 1- I performed FASTQC on the sequences followed by multiqc. When I look at the reports individually it doesn’t show any adapter sequence. (please see pic1). (Authors reported the they used Trimmomatic to…

INTRODUCTION Charles R. Darwin documented inbreeding depression as growth disadvantages from self-fertilization compared to outcrossing in many plants (1). Prevailing hypotheses suggest that inbreeding depression results from the exposure of deleterious recessive alleles and/or loss of overdominant alleles due to increased homozygosity (2, 3) or reduced recombination frequency in some…

I’ve used Mageck for CRISPR screens and it works great. A few things: It, by default, doesn’t allow mismatches between read and library but still I’ve always had good (>= ~80%) mapping rates; I’ve had better mapping results with paired-end reads (because if one read fails to align because of…

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Why does Cutadapt output much larger files than I am inputting? 0 I am using usegalaxy.org to work with paired end RNAseq data. I am using Cutadapt to trim adapter sequences, and the Cutadapt output files are larger than the files I am inputting. Example, my first sample SRR6467550, the…

I am struggling with finding a solution to a problem which seems easy but it’s not. I found many many questions that seems to be related (and I believe they are) but they are confusing and you never know which one fits your case. So there we go. I’ll try…