Tag: Cutadapt

ChaoXianSen/TrimGalore – Giters

Trim Galore is a wrapper around Cutadapt and FastQC to consistently apply adapter and quality trimming to FastQ files, with extra functionality for RRBS data. Installation Trim Galore is a a Perl wrapper around two tools: Cutadapt and FastQC. To use, ensure that these two pieces of software are available…

Continue Reading ChaoXianSen/TrimGalore – Giters

Valine tRNA levels and availability regulate complex I assembly in leukaemia

1. Rapino, F. et al. Codon-specific translation reprogramming promotes resistance to targeted therapy. Nature 558, 605–609 (2018). CAS  PubMed  Google Scholar  2. Goodarzi, H. et al. Modulated expression of specific tRNAs drives gene expression and cancer progression. Cell 165, 1416–1427 (2016). CAS  PubMed  PubMed Central  Google Scholar  3. Wolfe, A….

Continue Reading Valine tRNA levels and availability regulate complex I assembly in leukaemia

Zooplankton diversity monitoring strategy for the urban coastal region using metabarcoding analysis

1. Eyun, S. Phylogenomic analysis of Copepoda (Arthropoda, Crustacea) reveals unexpected similarities with earlier proposed morphological phylogenies. BMC Evol. Biol. 17, 23 (2017). PubMed  PubMed Central  Google Scholar  2. Eyun, S. et al. Evolutionary history of chemosensory-related gene families across the Arthropoda. Mol. Biol. Evol. 34, 1838–1862 (2017). CAS  PubMed …

Continue Reading Zooplankton diversity monitoring strategy for the urban coastal region using metabarcoding analysis

cutadapt / trim-paired / option “front” and “adapter” – User Support

Hello, I have sequences in paired end that have both primers in R1 and R2 files.For exemple, a sequence in the forward ( R1 ) file :In bold the 2 primers : GTACACACCGCCCGTCGCTCCTACCGATACCGGGTGATCCGGTGAACCTTTTGGACCGTTTTTCGGAAAAATAAGTAAACCATATCACCTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGACCAAGTCTCTGCTACCGTACGTCTTCTTAATCTCGTATGCCGTCTTCTGCTTGAAAATTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG A sequence In the reverse ( R2 ) file: TGATCCTTCTGCAGGTTCACCTACGGAAACCTTGTTACGACTTCTCCTTCCTCTAGGTGATATGGTTTACTTATTTTTCCGAAAAACGGTCCAAAAGGTTCACCGGATCACCCGGTATCGGTAGGAGCGACGGGCGGTGTGTACTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAACGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG I wish to remove the primers to…

Continue Reading cutadapt / trim-paired / option “front” and “adapter” – User Support

Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Continue Reading Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

How to remove Illumina TruSeq Index adapters reverse (R2 reads )

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Continue Reading How to remove Illumina TruSeq Index adapters reverse (R2 reads )

FASTQC not showing adapters—cutadapt sanity check—

Hello a newbie here, I am reanalyzing an article (GSE83931) for training purpose. I have two concerns/question. 1- I performed FASTQC on the sequences followed by multiqc. When I look at the reports individually it doesn’t show any adapter sequence. (please see pic1). (Authors reported the they used Trimmomatic to…

Continue Reading FASTQC not showing adapters—cutadapt sanity check—

An epigenetic basis of inbreeding depression in maize

INTRODUCTION Charles R. Darwin documented inbreeding depression as growth disadvantages from self-fertilization compared to outcrossing in many plants (1). Prevailing hypotheses suggest that inbreeding depression results from the exposure of deleterious recessive alleles and/or loss of overdominant alleles due to increased homozygosity (2, 3) or reduced recombination frequency in some…

Continue Reading An epigenetic basis of inbreeding depression in maize

Analysis of shRNA/CRISPR screens in 2021

I’ve used Mageck for CRISPR screens and it works great. A few things: It, by default, doesn’t allow mismatches between read and library but still I’ve always had good (>= ~80%) mapping rates; I’ve had better mapping results with paired-end reads (because if one read fails to align because of…

Continue Reading Analysis of shRNA/CRISPR screens in 2021

Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Continue Reading Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

Why does Cutadapt output much larger files than I am inputting?

Why does Cutadapt output much larger files than I am inputting? 0 I am using usegalaxy.org to work with paired end RNAseq data. I am using Cutadapt to trim adapter sequences, and the Cutadapt output files are larger than the files I am inputting. Example, my first sample SRR6467550, the…

Continue Reading Why does Cutadapt output much larger files than I am inputting?

how to demultiplex paired end reads when R1 and R2 are identified by two different substrings?

I am struggling with finding a solution to a problem which seems easy but it’s not. I found many many questions that seems to be related (and I believe they are) but they are confusing and you never know which one fits your case. So there we go. I’ll try…

Continue Reading how to demultiplex paired end reads when R1 and R2 are identified by two different substrings?