Tag: Cutadapt

Simulated global warming affects endophytic bacterial and fungal communities of Antarctic pearlwort leaves and some bacterial isolates support plant growth at low temperatures

Sample collection Colobanthus quitensis samples were collected at King George Island near the Henryk Arctowski Polish Antarctic Station, Maritime Antarctica (62°14’ S, 58°48’ W) during the summer season (February 2018). Samples were collected inside the Antarctic Specially Protected Area (ASPA) 128 using permits provided by The Chilean Antarctic Institute (INACH)…

Continue Reading Simulated global warming affects endophytic bacterial and fungal communities of Antarctic pearlwort leaves and some bacterial isolates support plant growth at low temperatures

Orient nanopore reads without trimming the adapters using cutadapt and pychopper

Orient nanopore reads without trimming the adapters using cutadapt and pychopper 0 Hello, I want to orient demultiplexed reads based on 3′ adapter without trimming the adapter (keep entire read). I would like to get any suggestions on this. I have looked in to pychoppper and primer-chop tools. As I…

Continue Reading Orient nanopore reads without trimming the adapters using cutadapt and pychopper

Impact of host age on viral and bacterial communities in a waterbird population

Woolhouse MEJ, Gowtage-Sequeria S. Host range and emerging and reemerging pathogens. Emerg Infect Dis. 2005;11:1842–7. Article  PubMed  PubMed Central  Google Scholar  Allen T, Murray KA, Zambrana-Torrelio C, Morse SS, Rondinini C, Di Marco M, et al. Global hotspots and correlates of emerging zoonotic diseases. Nat Commun. 2017;8:1–10. Article  CAS  Google…

Continue Reading Impact of host age on viral and bacterial communities in a waterbird population

Identification of unique DNA methylation sites in Kabuki syndrome using whole genome bisulfite sequencing and targeted hybridization capture followed by enzymatic methylation sequencing

Niikawa N, Matsuura N, Fukushima Y, Ohsawa T, Kajii T. Kabuki make-up syndrome: a syndrome of mentalretardation, unusual facies, large and protruding ears, and postnatal growth deficiency. J Pediatrics. 1981;99:565–9. CAS  Article  Google Scholar  Kuroki Y, Suzuki Y, Chyo H, Hata A, Matsui I. A new malformation syndrome of long…

Continue Reading Identification of unique DNA methylation sites in Kabuki syndrome using whole genome bisulfite sequencing and targeted hybridization capture followed by enzymatic methylation sequencing

Page Not Found – QIIME 2 Forum

Sign Up Log In Log In Popular installing qiime2 with conda – executing transaction timeoutUser Support Cannot run DADA2 in the tutorialsTechnical Support meta analysis and weird looking emperor plot of beta-analysisUser Support QIIME 2 2022.8 is now available!Announcements Qiime Plugin error from fragment-insertionTechnical Support [RESOLVED] Notice to Multi-User System…

Continue Reading Page Not Found – QIIME 2 Forum

Evolution of stickleback spines through independent cis-regulatory changes at HOXDB

Darwin, C. On the Origin of Species by Means of Natural Selection (John Murray, 1859). Owen, R. On the Archetype and Homologies of the Vertebrate Skeleton (Richard and John E. Taylor, 1848). Stern, D. L. & Orgogozo, V. Is genetic evolution predictable? Science 323, 746–751 (2009). CAS  PubMed  PubMed Central …

Continue Reading Evolution of stickleback spines through independent cis-regulatory changes at HOXDB

BBmap bbduk.sh for filtering reads

I’m looking to filter reads that contain a stretch of A’s, I found these posts looking for polyA tails, meaning this should work all the same (Identify RNA-seq reads containing polyA sequence, Identifying RNA-seq reads containing polyA stretch). However, I cannot get it to work. Given just these two reads,…

Continue Reading BBmap bbduk.sh for filtering reads

Patrick Murphy Bulk RNA-Seq – HackMD

Patrick Murphy Bulk RNA-Seq – HackMD        owned this note   Published Linked with GitHub — title: ‘Patrick Murphy Bulk RNA-Seq’ disqus: hackmd — Patrick Murphy bulk RNA-Seq Analysis === ## Table of Contents [TOC] ## 1. Introduction This is a bulk RNA-Seq project, which includes human data….

Continue Reading Patrick Murphy Bulk RNA-Seq – HackMD

ViReMa not working after adapter trimming

ViReMa not working after adapter trimming 0 Hi, I have a viral RNA-seq dataset that I am trying to run through ViReMa to look for deletion junctions. When I input my fastq files directly into ViReMa without trimming adapters first, my results look about how I would expect (multiple junctions…

Continue Reading ViReMa not working after adapter trimming

can i skip cutadapt?? – User Support

recently i receive rowdata from NGS center..and i start analysis using QIIME2 i want ‘cutadapt’, so i ask primer sequence to NGS center..but center reply to me “it is secret” if it is neccessery, i request to NGS center…. thank u for reading Hi @svbreqwaiu01, You do not need to…

Continue Reading can i skip cutadapt?? – User Support

Trimming adaptors and primers for RNAseq reads

Trimming adaptors and primers for RNAseq reads 2 Hi all, I have RNA sequencing (sequenced on NextSeq 2000) reads that I know I need to cut the adaptor sequences off of and was planning to use cutadapt to do so. I have identified the adaptor sequence in my reads, but…

Continue Reading Trimming adaptors and primers for RNAseq reads

A genome-scale screen for synthetic drivers of T cell proliferation

Abramson, J. S. et al. Transcend NHL 001: immunotherapy with the CD19-directed CAR T-cell product JCAR017 results in high complete response rates in relapsed or refractory B-cell non-Hodgkin lymphoma. Blood 128, 4192–4192 (2016). Google Scholar  Shifrut, E. et al. Genome-wide CRISPR screens in primary human T cells reveal key regulators…

Continue Reading A genome-scale screen for synthetic drivers of T cell proliferation

cutadapt installation location? | Code Info Park

cutadapt installation location The documentation on the installation of cutadapt is just a bit misleading, as far as I’m concerned. Cutadapt was just installed as a Python package. The cutadapt executable is probably in /Users/yc/Library/Python/2.7/bin. If that folder is already in your PATH you can just type cutadapt to run…

Continue Reading cutadapt installation location? | Code Info Park

Index of /ubuntu/pool/universe/q/q2-cutadapt/

../ q2-cutadapt_2020.11.1-1.debian.tar.xz 08-Dec-2020 23:18 5540 q2-cutadapt_2020.11.1-1.dsc 08-Dec-2020 23:18 2203 q2-cutadapt_2020.11.1-1_amd64.deb 08-Dec-2020 23:34 2M q2-cutadapt_2020.11.1.orig.tar.gz 08-Dec-2020 23:18 7M q2-cutadapt_2021.8.0-1.debian.tar.xz 18-Oct-2021 21:15 5708 q2-cutadapt_2021.8.0-1.dsc 18-Oct-2021 21:15 2190 q2-cutadapt_2021.8.0-1_amd64.deb 19-Oct-2021 15:52 2M q2-cutadapt_2021.8.0.orig.tar.gz 18-Oct-2021 21:15 7M Read more here: Source link

Continue Reading Index of /ubuntu/pool/universe/q/q2-cutadapt/

Cell Strain-Derived Induced Pluripotent Stem Cells as an Isogenic Approach To Investigate Age-Related Host Response to Flaviviral Infection

INTRODUCTION Dengue is the most common mosquito-borne viral disease globally (1). This acute disease, which can be life-threatening, is caused by four different dengue viruses (DENVs) (DENV-1, DENV-2, DENV-3, and DENV-4). An estimated 390 million people are infected with these DENVs annually (2), and populations throughout the tropics face frequent…

Continue Reading Cell Strain-Derived Induced Pluripotent Stem Cells as an Isogenic Approach To Investigate Age-Related Host Response to Flaviviral Infection

Vertical stratification of the air microbiome in the lower troposphere

Significance Large-scale meteorological and biological data demonstrate the vertical stratification of airborne biomass. The previously described diel cycle of airborne microorganisms is shown to disappear at height. Atmospheric turbulence and stratification are shown to be defining factors for the scale and boundaries, dynamics, and natural variability of airborne biomass, resulting…

Continue Reading Vertical stratification of the air microbiome in the lower troposphere

Profiling and functional characterization of maternal mRNA translation during mouse maternal-to-zygotic transition

INTRODUCTION Mammalian life starts with the fusion of two terminally differentiated gametes, sperm and oocyte, resulting in a totipotent zygote. After going through preimplantation development, the zygote reaches blastocyst before implantation. The two most important events taking place during preimplantation development are zygotic genome activation (ZGA) and the first cell…

Continue Reading Profiling and functional characterization of maternal mRNA translation during mouse maternal-to-zygotic transition

ChaoXianSen/TrimGalore – Giters

Trim Galore is a wrapper around Cutadapt and FastQC to consistently apply adapter and quality trimming to FastQ files, with extra functionality for RRBS data. Installation Trim Galore is a a Perl wrapper around two tools: Cutadapt and FastQC. To use, ensure that these two pieces of software are available…

Continue Reading ChaoXianSen/TrimGalore – Giters

Valine tRNA levels and availability regulate complex I assembly in leukaemia

1. Rapino, F. et al. Codon-specific translation reprogramming promotes resistance to targeted therapy. Nature 558, 605–609 (2018). CAS  PubMed  Google Scholar  2. Goodarzi, H. et al. Modulated expression of specific tRNAs drives gene expression and cancer progression. Cell 165, 1416–1427 (2016). CAS  PubMed  PubMed Central  Google Scholar  3. Wolfe, A….

Continue Reading Valine tRNA levels and availability regulate complex I assembly in leukaemia

Zooplankton diversity monitoring strategy for the urban coastal region using metabarcoding analysis

1. Eyun, S. Phylogenomic analysis of Copepoda (Arthropoda, Crustacea) reveals unexpected similarities with earlier proposed morphological phylogenies. BMC Evol. Biol. 17, 23 (2017). PubMed  PubMed Central  Google Scholar  2. Eyun, S. et al. Evolutionary history of chemosensory-related gene families across the Arthropoda. Mol. Biol. Evol. 34, 1838–1862 (2017). CAS  PubMed …

Continue Reading Zooplankton diversity monitoring strategy for the urban coastal region using metabarcoding analysis

cutadapt / trim-paired / option “front” and “adapter” – User Support

Hello, I have sequences in paired end that have both primers in R1 and R2 files.For exemple, a sequence in the forward ( R1 ) file :In bold the 2 primers : GTACACACCGCCCGTCGCTCCTACCGATACCGGGTGATCCGGTGAACCTTTTGGACCGTTTTTCGGAAAAATAAGTAAACCATATCACCTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGACCAAGTCTCTGCTACCGTACGTCTTCTTAATCTCGTATGCCGTCTTCTGCTTGAAAATTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG A sequence In the reverse ( R2 ) file: TGATCCTTCTGCAGGTTCACCTACGGAAACCTTGTTACGACTTCTCCTTCCTCTAGGTGATATGGTTTACTTATTTTTCCGAAAAACGGTCCAAAAGGTTCACCGGATCACCCGGTATCGGTAGGAGCGACGGGCGGTGTGTACTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAACGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG I wish to remove the primers to…

Continue Reading cutadapt / trim-paired / option “front” and “adapter” – User Support

Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Continue Reading Issue with installing QIIME2 2021.11 on Windows 10 – Technical Support

How to remove Illumina TruSeq Index adapters reverse (R2 reads )

How to remove Illumina TruSeq Index adapters reverse (R2 reads ) 0 I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads). TruSeq_Index_Adapter reverse compliment cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC TruSeq_Index_Adapter cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG…

Continue Reading How to remove Illumina TruSeq Index adapters reverse (R2 reads )

FASTQC not showing adapters—cutadapt sanity check—

Hello a newbie here, I am reanalyzing an article (GSE83931) for training purpose. I have two concerns/question. 1- I performed FASTQC on the sequences followed by multiqc. When I look at the reports individually it doesn’t show any adapter sequence. (please see pic1). (Authors reported the they used Trimmomatic to…

Continue Reading FASTQC not showing adapters—cutadapt sanity check—

An epigenetic basis of inbreeding depression in maize

INTRODUCTION Charles R. Darwin documented inbreeding depression as growth disadvantages from self-fertilization compared to outcrossing in many plants (1). Prevailing hypotheses suggest that inbreeding depression results from the exposure of deleterious recessive alleles and/or loss of overdominant alleles due to increased homozygosity (2, 3) or reduced recombination frequency in some…

Continue Reading An epigenetic basis of inbreeding depression in maize

Analysis of shRNA/CRISPR screens in 2021

I’ve used Mageck for CRISPR screens and it works great. A few things: It, by default, doesn’t allow mismatches between read and library but still I’ve always had good (>= ~80%) mapping rates; I’ve had better mapping results with paired-end reads (because if one read fails to align because of…

Continue Reading Analysis of shRNA/CRISPR screens in 2021

Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

1. Lee, M.-R. et al. Mycobacterium abscessus complex infections in humans. Emerg. Infect. Dis. 21, 1638–1646 (2015). CAS  PubMed  PubMed Central  Google Scholar  2. Prince, D. S. et al. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321, 863–868 (1989). CAS  PubMed  Article  Google…

Continue Reading Global phylogenomic analyses of Mycobacterium abscessus provide context for non cystic fibrosis infections and the evolution of antibiotic resistance

Why does Cutadapt output much larger files than I am inputting?

Why does Cutadapt output much larger files than I am inputting? 0 I am using usegalaxy.org to work with paired end RNAseq data. I am using Cutadapt to trim adapter sequences, and the Cutadapt output files are larger than the files I am inputting. Example, my first sample SRR6467550, the…

Continue Reading Why does Cutadapt output much larger files than I am inputting?

how to demultiplex paired end reads when R1 and R2 are identified by two different substrings?

I am struggling with finding a solution to a problem which seems easy but it’s not. I found many many questions that seems to be related (and I believe they are) but they are confusing and you never know which one fits your case. So there we go. I’ll try…

Continue Reading how to demultiplex paired end reads when R1 and R2 are identified by two different substrings?