Tag: DADA2

Study sites Soils were collected from two different sites (ARDEC: Colorado State University’s Agricultural Research, Development and Education Center in Fort Collins, CO; and CPCRC: USDA Columbia Plateau Conservation Research Center in Pendleton, OR). At each site, four replicate plots of no-till corn (ARDEC) or no-till annual wheat (CPCRC) were…

Correct way to remove Nextera adapters from ITS sequences 0 Hi everyone, I think this question has been coming up a few times but it didn’t help me solve my issue. I have FastQ files from ITS amplicon based metagenomic sequencing (ITS1/2) (300 bp) and FastQC tells me that they…

Carlson, J. L., Erickson, J. M., Lloyd, B. B. & Slavin, J. L. Health effects and sources of prebiotic dietary fiber. Curr. Dev. Nutr. 2, nzy005 (2018). Article  PubMed  PubMed Central  Google Scholar  Deehan, E. C. et al. Precision microbiome modulation with discrete dietary fiber structures directs short-chain fatty acid…

Dear all, I am facing a trouble with a command in Qiime2. I am working with Qiime2 from a singularity container, retrieved from the official website. I am trying to use Q2 on some mock communities, in detail I am testing it on Mockrobiota community 2 (found on @gregcaporaso GitHub…

Makhalanyane TP, Valverde A, Gunnigle E, Frossard A, Ramond JB, Cowan DA. Microbial ecology of hot desert edaphic systems. FEMS Microbiol Rev. 2015;39:203–21. Article  CAS  PubMed  Google Scholar  Pointing SB, Belnap J. Microbial colonization and controls in dryland systems. Nat Rev Microbiol. 2012;10:551–62. Article  CAS  PubMed  Google Scholar  Ji M,…

Dada2 in Qiime2: losing reads during merging 0 Hi! I am trying to use dada2 on my 16S paired-end sequences, from a 2 x 150 bp illumina run. But I am losing almost all my reads at the merging step. The FASTQC shows excellent data quality and no adapters in…

I am running DADA2 through QIIME and my demux.qza file is 110GB. After 24Hr I saw it consumed more than 4TB of disk space and the log file is not updating from a certain point.Here I am curious whether it is normal or if there is any glitch and I…

Hi, I followed the dada2 tutorial on 16S and ITS amplicon metagenomic data from soil samples. However, when trying to assign a taxonomic rank to my ASV table using DECIPHER, I only get “NAs”. When using the dada2 native’s Bayesian method, I get “NA” or “Mitochondria” (family). For my 16S…

Subset FASTA file for taxonomy (phylum name) in R 2 Dear all, I would like to subset a FASTA file so that I get the sequences belonging to a certain phylum (in my case: Nematoda). The headers of the FASTA file start with the phylum name, so I thought this…

Klepeis, N. E. et al. The National Human Activity Pattern Survey (NHAPS): A resource for assessing exposure to environmental pollutants. J. Expo. Anal. Environ. Epidemiol. 11, 231–252 (2001). CAS  PubMed  Google Scholar  Richardson, A. et al. Office design and health: A systematic review. N. Z. Med. J. 130, 39–49 (2017)….

Samples used in this observational cohort study (tumor tissue and matched healthy colon tissue, AC-ICAM cohort) are from patients with colon cancer diagnosed at Leiden University Medical Center, the Netherlands, from 2001 to 2015 that did not object for future use of human tissues for scientific research and that were…

Introduction Perturbations in the infant gut microbiome during early life affect growth, development, and long-term health (Sherman, 2010; Carl et al., 2014; Tarr and Warner, 2016). Preterm infants have a physiologically and anatomically immature gastrointestinal tract that is known to be more permeable than that of term infants, and their…

Bacterial metatransciptome antimicrobial resistance genes workflow? 0 Hi everyone! I’m trying to analyse some metatranscriptomics data from different samples, the final goal is to determine wether one group of samples has a higher expression of antimicrobial resistance genes. I’m completely new to RNAseq and I have no clue where to…

Hello all, I’m looking for guidance on how to write a non-interactive job script for qiime2. The HPC I have access to uses LSF and docker images, which are both new to me. So far, I have been creating an interactive shell to use qiime2 (I created a .sh file…

Anderson MJ (2001) A new method for non‐parametric multivariate analysis of variance. Austral Ecol 26(1):32–46 Google Scholar  Anderson MJ (2004) PERMDISP: a FORTRAN computer program for permutational analysis of multivariate dispersions (for any two-factor ANOVA design) using permutation tests. Department of Statistics, University of Auckland, New Zealand, 24. Aykanat T,…

Tried to create an environment using Conda and was not able to do so. Have copy pasted the message below. Would be grateful to know what the issue is and how to resolve the issue. (base) C:\Users\Mathangi Janakiraman>wget data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.yml–2023-05-11 12:54:47– data.qiime2.org/distro/core/qiime2-2023.2-py38-linux-conda.ymlResolving data.qiime2.org (data.qiime2.org)… 54.200.1.12Connecting to data.qiime2.org (data.qiime2.org)|54.200.1.12|:443… connected.ERROR: cannot verify…

Participant selection and sample collection Informed consent was obtained for five adult volunteers. The study protocols were reviewed and approved by the Advarra Institutional Review Board (Advarra, Inc., Columbia, MD). All analyses were performed according to the relevant guidelines and regulations. Fecal collection was completed by self-sampling, which has proven…

Global tuberculosis report 2020. (Geneva: World Health Organization; 2020. Licence: CC BY-NC-SA 3.0 IGO). Acuña-Villaorduna, C. et al. Intensity of exposure to pulmonary tuberculosis determines risk of tuberculosis infection and disease. Eur. Respir. J. 51, 1. doi.org/10.1183/13993003.01578-2017 (2018). Article  Google Scholar  Reichler, M. R. et al. Duration of exposure among…

How to demultiplex a pooled fastq sequence file and extract each sample sequences 0 Hello all, I have a pooled sequence file named “ERR1806550_1.fastq.gz” containing single-end sequences. Now, I want to demultiplex this sequence file and extract 37 sample sequences of my interest from it. These are the barcode sequences…

Hi,is there an option in the dada2 plugin under qiime2 for “priors” specific sequences as reported in the dada2 tutorial for pseudo-pooling?benjjneb.github.io/dada2/pseudo.html Hello Alberto, Welcome to the forums! You can sort of do this within the Qiime2 pipeline.docs.qiime2.org/2023.2/plugins/available/dada2/denoise-paired/ While you can’t provide expected sequences, you can use–p-pooling-method pseudoto enable pseudo-pooling,…

Several studies have indicated the importance of gut microbes in maintaining human health. These microbes are also associated with fundamental physiologic processes, such as aging, drug response, nutrition, and pathophysiologic states (e.g., cardiovascular, metabolic, oncologic, neurological, and autoimmune diseases). To better understand the causal effects between gut microbes and disease…

Hello, New user here, still trying to set up a workflow that works… I got as far as assigning Taxonomy using a pre-trained database (silva138_AB_V4_classifier.qza).However, there are still some unassigned sequences left. When I want to make a barplot, I get an error because some ‘ Feature IDs found in…

klterwelp (Kat Terwelp) April 20, 2023, 2:45pm 1 Version of qiime2: qiime2-2023.2 installed with conda on an HPC. I’m following the classifier training tutorial. Below is the code I’m using for importing the reference sequences from HOMD to a .qza file. I’ve also attached the resulting .qza file: ref-seqs.qza (19.3…

For the initial test of this protocol, DNA extraction, PCR, Nanopore library preparation, Nanopore sequencing, and subsequent data analysis were conducted at sea aboard the R/V Atlantic Condor in August 2021 [26]. This investigational effort resulted in the sequencing and analysis of deep sea sediment samples within hours of their…

Kavini_D (Kavini D) April 14, 2023, 7:48am 1 I have been running into an issue while using the denoising program. I have ran it 3 times now and it seems to suddenly stop working once it reaches the cleaning chimeras part of the program. It doesn’t appear to show any…

To maximize reproducibility, a list of the reagents and resources used in this study, as well as their source and identifier, is provided in Supplementary Table 5. Experimental model and subject details Oral swab samples were obtained from bottlenose dolphins (Tursiops truncatus) managed by the U.S. Navy MMP Biosciences Division, Space…

All experimental procedures were conducted at the University of Illinois at Urbana-Champaign and followed protocols approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Illinois at Urbana-Champaign under protocol number 17172. All ARRIVE, and IACUC guidelines and regulations were followed during the entire duration of…

Handa IT, Aerts R, Berendse F, Berg MP, Bruder A, Butenschoen O, et al. Consequences of biodiversity loss for litter decomposition across biomes. Nature. 2014;509:218–21. Article  CAS  PubMed  Google Scholar  Roux S, Adriaenssens EM, Dutilh BE, Koonin EV, Kropinski AM, Krupovic M, et al. Minimum information about an uncultivated virus…

Wei_Zhang (Wei Zhang) April 5, 2023, 4:22pm 1 Hello everyone, I apply qiime2 to my 16S rRNA sequencing data, which is an amplification of the V4 region with a primer pair of “GTGCCAGCMGCCGCGGTAA” and “GGACTACHVGGGTWTCTAAT”. Whereas I use the cutadapt plugin to remove the primer with different commands below, some…

Apologies if this is a naive question or not the correct platform to ask, new to AWS, not finding answers online, and this site has help with r challenges before. I am working with sequencing data in r (dada2 package). Based on some research, using AWS EC2 rstudio seemed like…

qiime version: qiime2-2022.11conda environment Hi everyone, Starting from the sequences obtained from an Illumina MiSeq 300×2 paired end run, I performed an analysis on eDNA using qiime2 and the 16s primer for invertebrates. I also performed the same analysis using another software (OBItools3) on the same dataset.What I noticed is…

First (and last?) time running qiime. All I am trying to do at the moment is demultiplex. Qiime cutadapt is unable parse my metadata file no matter what I do to it. I’ve spent hours trying to fix this ridiculous bug. It seems most likely that the cutadapt plugin isn’t…

Background: Illumina sequencing platform requires base diversity in the initial 11 cycles for efficient cluster identification and colour matrix estimation. This limitation yields low-quality data for amplicon libraries having homogeneous base composition. Spike-in of PhiX library ensures base diversity but reduces the overall number of sequencing reads for data analysis….

Breitbart M, Bonnain C, Malki K, Sawaya NA. Phage puppet masters of the marine microbial realm. Nat Microbiol. 2018;3:754–66. Article  CAS  PubMed  Google Scholar  Suttle CA. Marine viruses—major players in the global ecosystem. Nat Rev Microbiol. 2007;5:801–12. Article  CAS  PubMed  Google Scholar  Breitbart M. Marine viruses: truth or dare. Ann…

Principal findings of the study In this re-analysis of fifteen placental microbiota studies, of the ASVs which were ranked in the top five ASVs for relative abundance in any one study, Lactobacillus ASVs were clearly the most prevalent across studies. Yet, Lactobacillus ASV prevalence was explained by background DNA contamination,…

I’ve been trying to run dada2 in python, with the sources available in Qiime2. However I have not been able to extend the use of this API. I can’t know the arguments of many available methods and functions, for example how I could specify the equivalent of “–p-n-threads” or “–p-min-fold-parent-over-abundance”,…

Salter, S. J. et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 12, 87 (2014). Article  PubMed  PubMed Central  Google Scholar  Weyrich, L. S. et al. Laboratory contamination over time during low-biomass sample analysis. Mol. Ecol. Resour. 19, 982–996 (2019). Article  CAS  PubMed  PubMed Central …

Human ethics statement This study was approved by the Human Ethical Review Committee of Khon Kaen University, Thailand (HE641434) following the principles of the Declaration of Helsinki. Before stool samples were collected, participants were required to complete and sign written informed-consent forms. Participants and samples All samples came from residents…

I am using QIIME2 (2023 release) on a HPCC setupIn trying to make a barplot I have encountered an issue I do not understand the possible origin of.As background for this I will explain the path so far: dada2 is used to denoise samples, generating repseqs.qza, table.qza, stats.qza Taxonomy is…

HiI ran Dada2 on a pair of forward and reverse reads of one sample on qiime2-2023.2 and itdemux.qza (1.2 MB)gives the following error: An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more. debug file contains: Running external command line…

Hello, I run Dada2 using the following command I got the error. I am a new user so I don’t understand what is the cause of error? $ qiime dada2 denoise-paired –verbose –p-n-threads 4 –p-trim-left-f 17 –p-trim-left-r 21 –p-trunc-len-f 290 –p-trunc-len-r 250 –i-demultiplexed-seqs demux.qza –o-table table.qza –o-representative-sequences rep-seqs.qza –o-denoising-stats stats-dada2.qza…

I have phyloseq object where sequence table were builded by using the function mergeSequenceTables from DADA2 package, to merge ten sequence tables from different runs. The sample_data consist of two columns 1)containing sample names same as sequence table column names and 2)study name from which samples comes from. Using this…

excluded in the analysis. Solve optimization problems using an R interface to NLopt. The overall false discovery rate is controlled by the mdFDR methodology we In this formula, other covariates could potentially be included to adjust for confounding. depends on our research goals. W, a data.frame of test statistics. enter…

1. Introduction Soil harbors high abundance and diversity of prokaryotic microorganisms, with 1 g of soil containing up to 10 billion microbial cells (Torsvik and Øvreås, 2002) and 103–106 phylotypes (Bickel and Or, 2020), including many microorganisms that play critical biogeochemical roles (Crowther et al., 2019). With continuous expansion of prokaryotic…

Fuhrman, J. A. Microbial community structure and its functional implications. Nature 459, 193–199 (2009). Article  CAS  PubMed  Google Scholar  Graham, E. B. et al. Microbes as engines of ecosystem function: when does community structure enhance predictions of ecosystem processes? Front. Microbiol. 7, 214 (2016). Article  PubMed  PubMed Central  Google Scholar …

Croft, M. T., Lawrence, A. D., Raux-Deery, E., Warren, M. J. & Smith, A. G. Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature doi.org/10.1038/nature04056 (2005). Article  PubMed  Google Scholar  Kazamia, E. et al. Mutualistic interactions between vitamin B12-dependent algae and heterotrophic bacteria exhibit regulation. Environ. Microbiol. doi.org/10.1111/j.1462-2920.2012.02733.x…

Hallegraeff, G. M. Ocean climate change, phytoplankton community responses, and harmful algal blooms: A formidable predictive challenge 1. J. Phycol. 46, 220–235 (2010). Article  CAS  Google Scholar  Itakura, S. & Imai, I. Economic impacts of harmful algal blooms on fisheries and aquaculture in western Japan—An overview of interannual variability and…

Man (Tamang) February 15, 2023, 2:07am 1 Hi there,I have been downloading the NCBI SRA fastq project files and most of them have fastq sequences per sample basis. However, in some of the project file submitted to the SRA (Gopalakrishnan et al 2018 Science,www.science.org/doi/10.1126/science.aan4236#supplementary-materials ), I find that there is…

Sequencing statistics NGS was used across the V3-V4 region of the 16S rRNA gene to sequence 24 environmental samples. The mean number of ASVs per sample obtained after DADA2 was 72,050 ± 31,480, ranging from 22,568 to 143,267. From a total of 1,729,209 contigs remaining after quality control and removal of chimeras,…

Hello, I have a question regarding computer settings. The lab I belong to is currently in the process of setting up microbiome research, and is experiencing difficulties in purchasing a computer needed for BI analysis. Qiime2 analysis was performed by installing a virtual machine on a Windows computer with 16GB…

eduseb (Eduardo) February 13, 2023, 5:01pm 1 Hello everyone! I’m currently trying to run dada2 denoise-paired. However, it results in the following error: “Plugin error from dada2:An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more.” Anyone has a clue…

Fmadere (Ferra Madere) February 9, 2023, 3:58am 1 Hello All, A few months ago I ran some 16S sequencing data through Qiime2. I am now attempting to do some further analysis of the data using Valencia, a nearest-centroid based algorithm for the classification of human vaginal microbial community into state…

Ethics statement All animal experiments were performed in compliance with the Regulations for the Care and Use of Laboratory Animals issued by the Ministry of Science and Technology of the People’s Republic of China, which enforces the ethical use of animals. The protocol was approved by Institutional Animal Care and…

filterAndTrim : Error in add(bin) : record does not start with ‘@’ 0 Hello I’m using dada 2 version ‘1.22.0’ on windows 10, I have list of compressed (.gz ) fastq files, when I use the function filterAndTrim I get this error message : Error in add(bin) : record does…

Cause of short sequences in Amplicon Sequencing? 0 Hello, Amplicon sequencing was performed across 9 samples and then I used DAD2 to analyze the variants. 83 Variants were found and below are my top 5: 1.AGTGCTTAAAGACTATTGTTTTATTCCCAAATTGTTCTCTTAATTTTATAACTATCTTATTTAAAGTGTCATTCCATTTTGCTCTACTAAGGTTACAATGTGCTTGTCTTATATCTCCTATTATTTCTCCTGTTGTATAAAATGCTCTGCCTGGTCCTATATTTATACTTTTT 2.ATTGCTTAAAGATTATTGTTTTATTATTTCCAAATTGTTCTCTTAATTTGCTAGCTATCTGTTTTAAAGTGGCATTCCATTTTGCTCTACTAATGTTACAATGTGCTTGTCTCATATTTCCTATTTTTCCTATTGTAACAAATGCTCTCCCTGGTCCCCTCTGGATACGGATACTTTTT 3.GTGCTTAAAGACTATTGTTTTATTCCCAAATTGTTCTCTTAATTTTATAACTATCTTATTTAAAGTGTATCTCCTATTATTTCTCCTGTTGTATAAAATGCTCTGCCTGGTCCTATATTTATACTTTTT 4.AGTGCCTGGTCCTATATTTATACTTTTT 5.AGTGCTTAAAGACTATTGTTTTATTAAAATGCTCTGCCTGGTCCTATATTTATACTTTTT The first three are as expected but what are these…

Katra, I. et al. Richness and diversity in dust stormborne biomes at the Southeast Mediterranean. Sci. Rep. 4, 5265 (2014). Article  CAS  Google Scholar  Kellogg, C. A. & Griffin, D. W. Aerobiology and the global transport of desert dust. Trends Ecol. Evolution 21, 638–644 (2006). Article  Google Scholar  Mazar, Y.,…

1 Introduction Cervical cancer (CC) remains the fourth most common cancer in women worldwide, with 604,127 new cases in 2020 and more than 341,831 deaths, accounting for nearly 8% of all female cancer-related deaths annually (Sung et al., 2021). This common infection-related neoplasm and its premalignant precursor are caused by high-risk…

Hi,I have two questions regarding 300 PE reads pre-trimmed by quality and then imported in qiime2.2022.11. First, I was wondering if the different lengths among forward and reverse reads would be a problem to qiime2 in the merging phase. Moreover, I would like to know if their pre-trimming could affect…

I am using QIIME2 and R packages for microbiome analysis.I think QIIME2 is the best tool, especially for researchers who are about to begin the microbiome analysis. My question is about the decontamination process. I have the fastq files of 16s microbiome sequences from skin tissue samples. The sequence files…

Animals As female mice/rats resist to HFD-induced obesity and NAFLD, male mice/rats were used to induce obesity and NAFLD model by HFD50. Male Wistar (~180 g body weight; 8 weeks old) rats were purchased from Shandong Laboratory Animal Center with the permission number of SCXK 2014–0007 and raised under thermoneutral housing…

Seilacher, A. Arbeitskonzept zur konstruktions-morphologie. Lethaia 3, 393–396 (1970). Google Scholar  Seilacher, B. A., Reif, W.-E. & Westphal, F. Sedimentological, ecological and temporal patterns of fossil Lagerstätten. Philos. Trans. R. Soc. Lond. B 311, 5–23 (1985). ADS  Google Scholar  Gibbons, N. E. & Reed, G. B. The effect of autolysis…

Classification of snow algae in the ice core based on ITS2 sequences We used high-throughput sequencing to obtain DNA sequences of algae from 19 layers of an ice core drilled on a glacier in central Asia, dated from present time to 8000 years ago (Fig. 1 and Table S1). In total, 17,016…

Sample collection Colobanthus quitensis samples were collected at King George Island near the Henryk Arctowski Polish Antarctic Station, Maritime Antarctica (62°14’ S, 58°48’ W) during the summer season (February 2018). Samples were collected inside the Antarctic Specially Protected Area (ASPA) 128 using permits provided by The Chilean Antarctic Institute (INACH)…

Smid, E. J. et al. Practical implications of the microbial group construction of undefined mesophilic starter cultures. Microb. Cell Factories 13, S2. doi.org/10.1186/1475-2859-13-S1-S2 (2014). Article  Google Scholar  Stadhouders, J. & Leenders, G. J. M. Spontaneously developed mixed-strain cheese starters. Their behaviour in direction of phages and their use within the…

Sign Up Log In Log In Popular installing qiime2 with conda – executing transaction timeoutUser Support Cannot run DADA2 in the tutorialsTechnical Support meta analysis and weird looking emperor plot of beta-analysisUser Support QIIME 2 2022.8 is now available!Announcements Qiime Plugin error from fragment-insertionTechnical Support [RESOLVED] Notice to Multi-User System…

recently i receive rowdata from NGS center..and i start analysis using QIIME2 i want ‘cutadapt’, so i ask primer sequence to NGS center..but center reply to me “it is secret” if it is neccessery, i request to NGS center…. thank u for reading Hi @svbreqwaiu01, You do not need to…

Details Posted: 03-May-22 Location: Chicago, Illinois Type: Full-time Salary: Open Categories: Research – Laboratory/Non-Laboratory Staff/Administrative Location: Hyde Park Campus Job Description: Provides technical expertise in the selection, validation, and implementation of the appropriate internal and external data analytic and bioinformatic solutions needed to analyze specimens, process and integrate data, and…

translateMetagenome2AGORA 0 Hi I would like to work with the Cobra Microbiome modelling toolbox, I still need to upgrade matlab to work with it but I am already going through the manual and I wondered whether someone has experience with using the translateMetagenome2AGORA function on output of DADA2 pipeline? in…

Hi everyone, I am currently in the process of removing unwanted taxa (Kingdom=”Eukaryota”, Family=”Mitochondria”, and Order=”Chloroplast”) from a phyloseq object I created. This phyloseq object was created using my outputs from DADA2 (OTU table, taxonomy table, and metadata file). I have saved a taxonomy table in CSV format at every…

Advances in the analysis of amplicon sequence datasets have introduced a methodological shift in how research teams investigate microbial biodiversity, away from sequence identity-based clustering (producing Operational Taxonomic Units, OTUs) to denoising methods (producing amplicon sequence variants, ASVs). While denoising methods have several inherent properties that make them desirable compared…

Predict Functional potential microbial communities – phyloseq Silva 0 Hi, Does anyone have good tutorials/resources on how to predict the metabolic potential from microbiome data. I have preprocessed using DADA2, resulting in a phyloseq object. I assigned taxonomy with SILVA database. I found this Tax4fun package in R implemented in…

I’m running dada2 on paired end data and getting the same error over and over again. My data are from an 150 PE run on an Illumina iSeq machine, sequencing a 16s fragment for vertebrates. The samples were demultiplexed by Casava based on the i5 and i7 adapters. Some samples…

Hello all, I have been having issues installing packages that I really need to use. Basically, I cannot download either Phyloseq or dada2 and I believe it’s because I don’t have GenomeInfoDbData. But at the same time, I cannot install GenomeInfoDbData because I can’t seem to update the dependencies (“fansi”…

This is to the part of the question “replace actual sequences with OTU ids (Phyloseq/dada2)?” I contacted the phyloseq/dada2 developers and based on Susan Holmes’ reply (github.com/joey711/phyloseq/issues/1030) I came up with this piece of code to replace the amplicon sequences with a numbered OTU header. Further discussion can be found…

Hi everyone,I analyzed my pacbio data according to this PR, but an error was happened: Error in h(simpleError(msg, call)) : Error: invalid class “SRFilterResult” object: superclass “Mnumeric” no t defined in the environment of the object’s class stop Traceback (most recent call last): File “/home/xxx/miniconda3/envs/qiime2-2021.4/lib/python3.8/site- packages/q2_dada2/_denoise.py”, line 361, in denoise_ccs…

Hello, I have sequences in paired end that have both primers in R1 and R2 files.For exemple, a sequence in the forward ( R1 ) file :In bold the 2 primers : GTACACACCGCCCGTCGCTCCTACCGATACCGGGTGATCCGGTGAACCTTTTGGACCGTTTTTCGGAAAAATAAGTAAACCATATCACCTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCAGAAGGATCAAGACCAAGTCTCTGCTACCGTACGTCTTCTTAATCTCGTATGCCGTCTTCTGCTTGAAAATTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG A sequence In the reverse ( R2 ) file: TGATCCTTCTGCAGGTTCACCTACGGAAACCTTGTTACGACTTCTCCTTCCTCTAGGTGATATGGTTTACTTATTTTTCCGAAAAACGGTCCAAAAGGTTCACCGGATCACCCGGTATCGGTAGGAGCGACGGGCGGTGTGTACTGTAGAACCATGTCGTCAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAACGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG I wish to remove the primers to…

Hello, qiime2 users community! I have the following set-up: a huge collection of .fastq files which I would like to process with the dada2 pipeline a remote cluster of servers with the separated storage where those files are stored, and the working machines for computing. Question: Is it possible to…

Hi QIIME support team, I’m attempting to install QIIME2 on my Windows 10 machine. I installed Anaconda3, then set up conda to run in Git Bash: echo “. ${PWD}/conda.sh” >> ~/.bashrc Once I restarted Git Bash and activated Conda, I installed python-wget because installation of wget kept getting the following…

Which files from PacBio output files to use in downstream analysis in R 0 I just received Pacbio sequences of 16S gene from the core facility. After download, I got 5 files for each sample with following suffix: .ccs.bam longest.bam scraps.bam subreads.bam whitelist From readings, I believe that I should…

How to map SILVA taxa names to NCBI IDs (in R)? 0 Hi, How to map taxonomy assigned using SILVA database to NCBI ID (preferably in R)? I’m using R Dada2 and SILVA database to assign taxonomy: Bacteria > Firmicutes > Bacilli > Lactobacillales > Enterococcaceae > Enterococcus I need…