Tag: dsDNA

If a long linear dsDNA having blunt ends with 5’GAATTC3′ 3’CTTAGG5′ sequences at four places is cleaved by using EcoR1, how many DNA fragments are formed with cohesive ends on both sides? 1)5 2)4 3)3 4)2?

Question Description If a long linear dsDNA having blunt ends with 5’GAATTC3′ 3’CTTAGG5′ sequences at four places is cleaved by using EcoR1, how many DNA fragments are formed with cohesive ends on both sides? 1)5 2)4 3)3 4)2? for NEET 2022 is part of NEET preparation. The Question and…

Continue Reading If a long linear dsDNA having blunt ends with 5’GAATTC3′ 3’CTTAGG5′ sequences at four places is cleaved by using EcoR1, how many DNA fragments are formed with cohesive ends on both sides? 1)5 2)4 3)3 4)2?

PRC2 direct transfer from G-quadruplex RNA to dsDNA: Implications for RNA-binding chromatin modifiers

Abstract The chromatin-modifying enzyme, Polycomb Repressive Complex 2 (PRC2), deposits the H3K27me3 epigenetic mark to negatively regulate expression at numerous target genes, and this activity has been implicated in embryonic development, cell differentiation, and various cancers. A biological role for RNA binding in regulating PRC2 histone methyltransferase activity is generally…

Continue Reading PRC2 direct transfer from G-quadruplex RNA to dsDNA: Implications for RNA-binding chromatin modifiers

Solved What is the major factor in stabilizing dsDNA

Transcribed image text: What is the major factor in stabilizing dsDNA (double-stranded DNA)? [2 points] Consider the statement “pure hydrocarbons do not form monolayers on water”. Provide an explanation for this statement [ 2 points] Consider the following pairs of fatty acids and underline the fatty acid in each pair…

Continue Reading Solved What is the major factor in stabilizing dsDNA

Extra-hematopoietic immunomodulatory role of the guanine-exchange factor DOCK2

Cell isolation, reprogramming and culture Approval was obtained for human cell and tissue sample collection and genetic reprogramming from the Institutional Review Board (protocols 19–252, 18–243, 21–060, 19–284 and 415-E/1776/4-2014, Ethics Committee of the province of Salzburg). Adult samples were collected in accordance with the Declaration of Helsinki after written…

Continue Reading Extra-hematopoietic immunomodulatory role of the guanine-exchange factor DOCK2

Solved Which of the following statements about PCR is FALSE?

Transcribed image text: Which of the following statements about PCR is FALSE? Check all that apply. PCR uses a heat-stable DNA polymerase. After every cycle of replication, there is a linear increase in the amount of DNA present. Every round of replication starts with the denaturation of dsDNA molecules. If…

Continue Reading Solved Which of the following statements about PCR is FALSE?

Low Prevalence of Anti-TNF-Induced Lupus in Patients With Inflammatory Bowel Disease

The incidence and clinical and serologic characteristics of anti-tumor necrosis factor (TNF)-induced lupus (ATIL) in patients with inflammatory bowel disease (IBD) were evaluated in a systematic review published in International Immunopharmacology. Researchers used PubMed, Ovid Embase, Medline, and Cochrane CENTRAL databases from inception through April 2022 for studies describing ATIL…

Continue Reading Low Prevalence of Anti-TNF-Induced Lupus in Patients With Inflammatory Bowel Disease

Isolation of a Host-Confined Phage Metagenome Allows the Detection of Phages Both Capable and Incapable of Plaque Formation

doi: 10.1007/978-1-0716-2795-2_14. Affiliations Expand Affiliations 1 Institute of Microbiology and Genetics, Georg August University Göttingen, Göttingen, Germany. ines.friedrich@uni-goettingen.de. 2 Institute of Microbiology and Genetics, Georg August University Göttingen, Göttingen, Germany. rhertel@gwdg.de. 3 Institute of Biotechnology, BTU Cottbus-Senftenberg, Senftenberg, Germany. rhertel@gwdg.de. Item in Clipboard Ines Friedrich et al. Methods Mol Biol. 2023….

Continue Reading Isolation of a Host-Confined Phage Metagenome Allows the Detection of Phages Both Capable and Incapable of Plaque Formation

Simultaneous ultrasensitive ADP and ATP quantification based on CRISPR/Cas12a integrated ZIF-90@Ag3AuS2@Fe3O4 nanocomposites

doi: 10.1016/j.bios.2022.114784. Online ahead of print. Affiliations Expand Affiliations 1 Key Laboratory of Marine Environmental Corrosion and Bio-fouling, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China; University of the Chinese Academy of Sciences, Beijing, 100039, China; Open Studio for Marine Corrosion and Protection, Pilot National Laboratory for Marine…

Continue Reading Simultaneous ultrasensitive ADP and ATP quantification based on CRISPR/Cas12a integrated ZIF-90@Ag3AuS2@Fe3O4 nanocomposites

Metagenomic analysis of viromes in tissues of wild Qinghai vole from the eastern Tibetan Plateau

Overview of the viromes In all, 41 wild Qinghai voles were collected from pasture habitats located on the eastern Tibetan Plateau, China (Fig. 1). Tissue samples from liver, lung, spleen, small intestine (with content), and feces (large intestinal content) of each vole were disrupted, and viral RNA was extracted. The RNA…

Continue Reading Metagenomic analysis of viromes in tissues of wild Qinghai vole from the eastern Tibetan Plateau

Phage Therapy market 2022 extent USD 296.62% billion by 2027 | expected to grow at a compound annual growth rate of 10.91% | no of page 126

In the “Phage Therapy” Market Size 2022 | No. of Pages: 126 Furthermore, research categorizes the global Phage Therapy market by top players/brands, region, type and end user, including driving elements, Upstream Markets, and the general market circumstance. On the basis of product type this (DsDNA Bacteriophage, SsDNA Bacteriophage, SsRNA…

Continue Reading Phage Therapy market 2022 extent USD 296.62% billion by 2027 | expected to grow at a compound annual growth rate of 10.91% | no of page 126

Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis | Journal of Neuroinflammation

Langlois JA, Rutland-Brown W, Wald MM. The epidemiology and impact of traumatic brain injury: a brief overview. J Head Trauma Rehabil. 2006;21:375–8. doi.org/10.1097/00001199-200609000-00001. Article  PubMed  Google Scholar  Cao HQ, Dong ED. An update on spinal cord injury research. Neurosci Bull. 2013;29:94–102. doi.org/10.1007/s12264-012-1277-8. Article  PubMed  Google Scholar  O’Donnell MJ, Xavier D,…

Continue Reading Emerging role of STING signalling in CNS injury: inflammation, autophagy, necroptosis, ferroptosis and pyroptosis | Journal of Neuroinflammation

Sequence-Specific Recognition of Double-Stranded DNA by Using Only PNAs in Parallel with Natural Nucleobases | Biological and Medicinal Chemistry | ChemRxiv

Abstract The sequence-specific recognition of double-stranded DNA (dsDNA) is a key property for the control of DNA function. Peptide nucleic acid (PNA) can be utilised for the direct recognition of dsDNA via the formation of a unique invasion complex. Strand invasion by PNA induces local changes in the structure of…

Continue Reading Sequence-Specific Recognition of Double-Stranded DNA by Using Only PNAs in Parallel with Natural Nucleobases | Biological and Medicinal Chemistry | ChemRxiv

GenScript, Avectas Partner on Cell Therapy Manufacturing

NEW YORK – GenScript and Ireland’s Avectas said on Tuesday that they’re partnering to develop a non-viral cell therapy manufacturing process. Under the terms of the agreement, their research teams will apply Avectas’ Solupore technology to permeabilize target cell membranes to deliver GenScript’s GenCRISPR single guide RNA, CRISPR-Cas9 protein, and GenExact…

Continue Reading GenScript, Avectas Partner on Cell Therapy Manufacturing

Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3

In vitro reconstitution of Escherichia coli CRISPR-Cas3 interference E. coli CRISPR-Cas3 is generally well-characterized type I CRISPR complexes in vitro and in vivo32,33,37,38. However, recombinant EcoCas3 protein is difficult to purify because of poor solubility and propensity to aggregate at 37 °C25,26,30,39. Co-expression of HtpG chaperon40 and/or low temperature growth at…

Continue Reading Dynamic mechanisms of CRISPR interference by Escherichia coli CRISPR-Cas3

NODULIN HOMEOBOX is required for heterochromatin homeostasis in Arabidopsis

NDX is a heterochromatin-associated factor To understand the genome-wide regulatory roles of NDX, we first analyzed its genomic distribution. For this, we performed chromatin immunoprecipitation sequencing (ChIP-seq) in 10-day old Arabidopsis seedlings expressing N-terminally and C-terminally tagged NDX fusion proteins (flag-NDX/ndx1-1(FRI)/flc-2 and NDX-GFP/ndx1-1(FRI)/flc-2, respectively) expressed from their endogenous promoter21,32. The…

Continue Reading NODULIN HOMEOBOX is required for heterochromatin homeostasis in Arabidopsis

Live-seq enables temporal transcriptomic recording of single cells

Biological materials RAW264.7, 293T and HeLa cells were obtained from ATCC. RAW264.7 cells with Tnf-mCherry reporter and relA-GFP fusion protein (RAW-G9 clone) were kindly provided by I.D.C. Fraser (National Institutes of Health). The IBA cell line derived from the stromal vascular fraction of interscapular brown adipose tissue of young male…

Continue Reading Live-seq enables temporal transcriptomic recording of single cells

Solved 7. Use the dsDNA sequence below to answer the

Transcribed image text: 7. Use the dsDNA sequence below to answer the following questions. AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT 7a. During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5′ and 3′ ends of each strand….

Continue Reading Solved 7. Use the dsDNA sequence below to answer the

Solved Put the steps of HIV replication in the correct

Put the steps of HIV replication in the correct order. Below is a sequence of events. Place them in the order they should occur, number 1 being the first item. Select the step number from the drop down next to each item. Items to order: 1. DNA polymerase makes the…

Continue Reading Solved Put the steps of HIV replication in the correct

Three families of Asgard archaeal viruses identified in metagenome-assembled genomes

Liu, Y. et al. Expanded diversity of Asgard archaea and their relationships with eukaryotes. Nature 593, 553–557 (2021). CAS  PubMed  Google Scholar  Dombrowski, N., Teske, A. P. & Baker, B. J. Expansive microbial metabolic versatility and biodiversity in dynamic Guaymas Basin hydrothermal sediments. Nat. Commun. 9, 4999 (2018). PubMed  PubMed…

Continue Reading Three families of Asgard archaeal viruses identified in metagenome-assembled genomes

A Differential Immune Regulatory Role of EGR2 in B6/lpr Versus Normal B6 Mice.docx

Previous studies have reported that deletion of the transcription factor, early growth response protein 2 (EGR2), in normal C57BL/6 (B6) resulted in the development of lupus-like autoimmune disease. However, increased EGR2 expression has been noted in human and murine lupus, which challenges the notion of the autoimmune suppressive role of…

Continue Reading A Differential Immune Regulatory Role of EGR2 in B6/lpr Versus Normal B6 Mice.docx

RCSB PDB – 7SBA: Structure of type I-D Cascade bound to a dsDNA target

CRISPR-Cas systems are adaptive immune systems that protect prokaryotes from foreign nucleic acids, such as bacteriophages. Two of the most prevalent CRISPR-Cas systems include type I and type III. Interestingly, the type I-D interference proteins contain characteristic features of both type I and type III systems … CRISPR-Cas systems are…

Continue Reading RCSB PDB – 7SBA: Structure of type I-D Cascade bound to a dsDNA target

icddr,b Lab Services : Test Details

Anti dsDNA Similar Tests Antibody to ds-DNA, Anti-double-stranded DNA Specimen Required Blood What is being tested? Quantitative detection of ds-DNA antibodies (one of a group of autoantibodies called antinuclear antibodies) in human sera.  While anti-dsDNA may be present at a low level with a number of disorders, it is primarily…

Continue Reading icddr,b Lab Services : Test Details

Frontiers | A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiae

Introduction The clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) protein systems naturally exist in prokaryotes. They are RNA-mediated defense mechanisms to protect bacteria and archaea from invading nucleic acids (Barrangou et al., 2007). CRISPR–Cas systems are classified into two classes (1 and 2). Class 2 CRISPR–Cas require a single…

Continue Reading Frontiers | A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiae

Binding of the HSF-1 DNA-binding domain to multimeric C. elegans consensus HSEs is guided by cooperative interactions

The heat-shock response is represented by a small set of genes in C. elegans We initially aimed at identifying those HSE-containing promoters that are most strongly upregulated under heat-stress conditions. Given that the HSR is complex in nematodes we used data from several heat-shock studies based on microarray and RNAseq…

Continue Reading Binding of the HSF-1 DNA-binding domain to multimeric C. elegans consensus HSEs is guided by cooperative interactions

When the strands of dsdna are separated this is called?

You are learning about: “When the strands of dsdna are separated this is called?”. This is a “hot” question with 2,820,000 searches/month. Let’s fleetserviceshocrv.com learn more about When the strands of dsdna are separated this is called? in this article. How do scientists name the ends of the DNA strands?…

Continue Reading When the strands of dsdna are separated this is called?

Molecular mechanism of ZDHHC18-mediated palmitoylation of cGAS in innate immunity inhibition

Detection of double-stranded DNA by cGAS triggers innate immune responses. ZDHHC18-mediated palmitoylation of cGAS sheds light on a novel posttranslational modification that leads to the fine-tuning of cGAS-mediated innate immune responses. Credit: The EMBO Journal (2022). DOI: 10.15252/embj.2021109272 Cyclic GMP-AMP synthase (cGAS), a double-stranded DNA (dsDNA) sensing protein, plays an…

Continue Reading Molecular mechanism of ZDHHC18-mediated palmitoylation of cGAS in innate immunity inhibition

WGS Facilitates Gene Editing System Upgrade

Researchers at the Korean Institute of Life Sciences and Technology engineered an efficient, miniaturized CRISPR-Cas gene-editing system that may be more easily packed into vectors for clinical applications. Their system employs the Cas variant Cas12f1 with a guide RNA (gRNA) remodeled to mitigate off-target effects, a design that could potentially…

Continue Reading WGS Facilitates Gene Editing System Upgrade

Loyola eCommons – Undergraduate Research and Engagement Symposium: Effects of DNA looping behavior using smFRET

  Anticipated Graduation Year 2022 Abstract This study developed a single-molecule-based assay to track the looping of dsDNA molecules. DNA encodes our genetic information through a combination of four nucleotides; base pairing forms dsDNA molecules in a double-helical form. The genome achieves a three-dimensional architecture; the mechanical properties of dsDNA…

Continue Reading Loyola eCommons – Undergraduate Research and Engagement Symposium: Effects of DNA looping behavior using smFRET

Glycosylation of anti-dsDNA autoantibodies linked to SLE disease activity

medwireNews: Among patients with systemic lupus erythematosus (SLE), glycosylation patterns of anti-double-stranded (ds)DNA immunoglobulin (Ig)G autoantibodies differ from those of total IgG and correlate with disease activity, suggests research published in eBioMedicine. Discussing the background to their study, Junna Ye (Shanghai Jiao Tong University School of Medicine, China) and colleagues…

Continue Reading Glycosylation of anti-dsDNA autoantibodies linked to SLE disease activity

Pollinator sharing, copollination, and speciation by host shifting among six closely related dioecious fig species

Sampling Six dioecious fig species (F. erecta, F. formosana, F. vaccinioides, F. abelii, F. pyriformis, and F. variolosa) and their pollinator wasp species were examined in this study. As mentioned in the Introduction, these fig species were considered to be well suited for this study because they are distributed in…

Continue Reading Pollinator sharing, copollination, and speciation by host shifting among six closely related dioecious fig species

What Is Considered A High Level Of Anti Dsdna

What Is Considered A High Level Of Anti Dsdna? 75.0 IU/mL Positive Negative is considered normal. What is a high level of anti-dsDNA? The presence of anti-dsDNA antibodies often suggests more serious lupus, such as lupus nephritis (kidney lupus). When the disease is active, especially in the kidneys, high amounts…

Continue Reading What Is Considered A High Level Of Anti Dsdna

Tacrolimus Measures Up in Lupus Nephritis Trial

In a phase III trial, oral tacrolimus (Prograf) proved non-inferior to intravenous cyclophosphamide for treating lupus nephritis, researchers said. Among 158 patients randomized to tacrolimus, 83.0% achieved complete or partial responses after 24 weeks versus 75.0% of 156 assigned to intravenous cyclophosphamide, according to Zhaohui Zheng, MD, of Zhengzhou University…

Continue Reading Tacrolimus Measures Up in Lupus Nephritis Trial

STING agonist diABZI induces PANoptosis and DNA mediated acute respiratory distress syndrome (ARDS)

This article was originally published here Cell Death Dis. 2022 Mar 25;13(3):269. doi: 10.1038/s41419-022-04664-5. ABSTRACT Stimulator of interferon genes (STING) contributes to immune responses against tumors and may control viral infection including SARS-CoV-2 infection. However, activation of the STING pathway by airway silica or smoke exposure leads to cell death,…

Continue Reading STING agonist diABZI induces PANoptosis and DNA mediated acute respiratory distress syndrome (ARDS)

Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction

Abstract The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or resection of DNA double strand breaks. Loaded at the 5′-recessed end of a dsDNA-ssDNA junction by the RAD17-RFC clamp loader…

Continue Reading Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction

Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

In nature, microbes have evolved different systems to sense external stimuli. Synthetic biology approaches (1) repurpose these systems as biosensors to specifically and sensitively detect various targets of interest. Although various highly sensitive and specific laboratory-based analytical methods (including high-performance liquid chromatography and mass spectrometry) can detect small-molecule targets, they…

Continue Reading Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

The correlation between the levels of anti-dsDNA IgA antibody and the severity of systemic lupus erythematosus based on cutaneous vasculitis

Método el estudio transversal se realizó en las instalaciones para pacientes ambulatorios del Hospital Wahidin Sudirohusodo y el Hospital Universitario Hasanuddin en Makassar desde septiembre de 2020 hasta febrero de 2021. La investigación de los niveles de IgA anti-ds-DNA en pacientes con LES se realizó en dos grupos: grupo A…

Continue Reading The correlation between the levels of anti-dsDNA IgA antibody and the severity of systemic lupus erythematosus based on cutaneous vasculitis

LAMP-CRISPR-Cas12a-lateral flow immunochromatographic strip | IDR

Introduction About 700,000 people die from “superbugs” globally every year. Antibiotic abuse is the culprit of extensive spread of superbugs. Currently, carbapenemase-producing organisms are among the most important pathogens of hospital infections. Especially the plasmid-mediated highly transmissible carbapenem-resistant Enterobacterales (CRE) has become an important public health issue of global concern….

Continue Reading LAMP-CRISPR-Cas12a-lateral flow immunochromatographic strip | IDR

Virology: Module 2 Flashcards | Quizlet

Virology: Module 2 Flashcards | Quizlet   attachment/entry, translation of viral mRNA into viral proteins, replication, assembly, release of viruses from cell steps of infection for viruses? a cell possesses the functional receptor for a virus – virus can bind, possibly enter, but replication isn’t guaranteed a cell does not…

Continue Reading Virology: Module 2 Flashcards | Quizlet

Accumulation of polystyrene microplastics induces liver fibrosis by activating cGAS/STING pathway

doi.org/10.1016/j.envpol.2022.118986Get rights and content Highlights • Micro-PS induced DNA damage and release in nucleus and mitochondria. • cGAS/STING pathway activation was involved in inflammation and liver fibrosis. • STING inhibitor alleviated liver fibrosis via blocking proinflammatory signaling. • 0.1 μm micro-PS performed well permeability in cells and accumulated in liver. •…

Continue Reading Accumulation of polystyrene microplastics induces liver fibrosis by activating cGAS/STING pathway

Mobility of Bacterial Protein Hfq on dsDNA: Role of C-Terminus-Mediated Transient Binding

The mobility of protein is fundamental in the machinery of life. Here, we have investigated the effect of DNA binding in conjunction with DNA segmental fluctuation (internal motion) of the bacterial Hfq master regulator devoid of its amyloid C-terminus domain. Hfq is one of the most abundant nucleoid associated proteins…

Continue Reading Mobility of Bacterial Protein Hfq on dsDNA: Role of C-Terminus-Mediated Transient Binding

The cGAS-STING signaling in cardiovascular and metabolic diseases: Future novel target option for pharmacotherapy

Abstract The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) signaling exert essential regulatory function in microbial-and onco-immunology through the induction of cytokines, primarily type I interferons. Recently, the aberrant and deranged signaling of the cGAS-STING axis is closely implicated in multiple sterile inflammatory diseases, including heart failure, myocardial infarction,…

Continue Reading The cGAS-STING signaling in cardiovascular and metabolic diseases: Future novel target option for pharmacotherapy


Phihlikevirus (synonym: PhiH-like viruses) is a genus of viruses in the order Caudovirales, in the family Myoviridae. Bacteria and archaea serve as natural hosts. There is currently only one species in this genus: the type species Halobacterium phage phiH.[1][2] Taxonomy Group: dsDNA [2] Structure Phihlikeviruses are nonenveloped, with a head…

Continue Reading Phihlikevirus

RNA polymerase II trapped on a molecular treadmill: Structural basis of persistent transcriptional arrest by a minor groove DNA binder

Significance Hairpin pyrrole-imidazole (Py-Im) polyamides can be programmed to bind a broad repertoire of DNA sequences. Py-Im small molecules can be used to target cancer-specific coding regions and block transcription elongation. This transcription blockage by Py-Im cannot be rescued by transcription elongation factors, such as TFIIS. The mechanism by which…

Continue Reading RNA polymerase II trapped on a molecular treadmill: Structural basis of persistent transcriptional arrest by a minor groove DNA binder

Anti-dsDNA Testing Specificity for Systemic Lupus Erythematosus: A Systematic Review

Background: Autoantibody specificity in autoimmune diseases is variable due to each patient’s individual spectrum of autoantibodies and the inherent differences between detection methods and tests. Since false-positive results have downstream consequences, we conducted a comprehensive assessment of anti-double stranded DNA (anti-dsDNA) specificity from published studies of systemic lupus erythematosus (SLE)….

Continue Reading Anti-dsDNA Testing Specificity for Systemic Lupus Erythematosus: A Systematic Review

AccuClear Ultra High Sensitivity dsDNA Quantitation Kit with DNA Standard, trial size (200 assays) 31028-T

Description: trial size (200 assays), AccuClear Ultra High Sensitivity dsDNA Quantitation Kit with DNA Standard Category: Nucleic acid quantitation Shipping temperature: 15&deg, C, C to 30&deg Shipping conditions: n/a Storage: 2&deg, C, C to 8&deg Gene target: AccuClear Sensitivity dsDNA Quantitation Kit with DNA trial size (200 assays) Short name:…

Continue Reading AccuClear Ultra High Sensitivity dsDNA Quantitation Kit with DNA Standard, trial size (200 assays) 31028-T

Genus: Ichtadenovirus – Adenoviridae – dsDNA Viruses

Distinguishing features The single known member of this genus, white sturgeon adenovirus 1 (WSAdV-1), is the only confirmed fish adenovirus (Benkő et al., 2002). It was isolated and propagated on a white sturgeon cell line. This host is very divergent from those of other adenoviruses, and phylogenetic calculations and a…

Continue Reading Genus: Ichtadenovirus – Adenoviridae – dsDNA Viruses

A viral genome packaging motor transitions between cyclic and helical symmetry to translocate dsDNA

A viral genome packaging motor transitions between cyclic and helical symmetry to translocate dsDNA – Fingerprint — UTMB Health Research Expert Profiles Sort by Weight Alphabetically Medicine & Life Sciences Biopolymers 100% Virus Assembly 98% Computer-Assisted Image Processing 90% Product Packaging 86% Capsid Proteins 85% Viral Genome 85% Proteasome Endopeptidase…

Continue Reading A viral genome packaging motor transitions between cyclic and helical symmetry to translocate dsDNA

Low concentrations of a silver-based nanocomposite to manage bacterial spot of tomato in the greenhouse.

Abstract Abstract Bacterial spot, caused by four Xanthomonas spp., is one of the most damaging diseases of tomato worldwide. Due to limited disease management options, growers rely heavily on copper-based bactericides, which are often ineffective due to the presence of copper-resistant Xanthomonas strains. This study was undertaken…

Continue Reading Low concentrations of a silver-based nanocomposite to manage bacterial spot of tomato in the greenhouse.

Efficient target cleavage by Type V Cas12a effectors programmed with split CRISPR RNA

doi: 10.1093/nar/gkab1227. Online ahead of print. Regina Shebanova  1 , Natalia Nikitchina  1   2 , Nikita Shebanov  1 , Vladimir Mekler  3 , Konstantin Kuznedelov  3 , Egor Ulashchik  4 , Ruslan Vasilev  5   6 , Olga Sharko  4 , Vadim Shmanai  4 , Ivan Tarassov  2 , Konstantin Severinov  1   3   7 , Nina Entelis  2…

Continue Reading Efficient target cleavage by Type V Cas12a effectors programmed with split CRISPR RNA

Researchers Identify Four Lupus Subgroups Associated with Lupus Outcomes using Long-term Autoantibody Data and Artificial Intelligence

Updated antibody research by Lupus Foundation of America Gary S. Gilkeson Career Development Awardee May Choi identifies subgroups of lupus patients with different outcomes based on long-term autoantibody data with the aid of artificial intelligence. An autoantibody is a type of protein produced when the body’s immune system is attacking…

Continue Reading Researchers Identify Four Lupus Subgroups Associated with Lupus Outcomes using Long-term Autoantibody Data and Artificial Intelligence

Systems biology analysis of human genomes points to key pathways conferring spina bifida risk

Significance Genetic investigations of most structural birth defects, including spina bifida (SB), congenital heart disease, and craniofacial anomalies, have been underpowered for genome-wide association studies because of their rarity, genetic heterogeneity, incomplete penetrance, and environmental influences. Our systems biology strategy to investigate SB predisposition controls for population stratification and avoids…

Continue Reading Systems biology analysis of human genomes points to key pathways conferring spina bifida risk

Recombinase Polymerase Amplification/Cas12a-Based Identification of Xanthomonas arboricola pv. pruni on Peach

doi: 10.3389/fpls.2021.740177. eCollection 2021. Affiliations Expand Affiliations 1 Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, China. 2 Hubei Key Laboratory of Plant Pathology, Huazhong Agricultural University, Wuhan, China. Free PMC article Item in Clipboard Mei Luo et al. Front Plant Sci. 2021. Free PMC article…

Continue Reading Recombinase Polymerase Amplification/Cas12a-Based Identification of Xanthomonas arboricola pv. pruni on Peach

Frontiers | The cGAS-STING Pathway: A Promising Immunotherapy Target

Introduction Invaded by exogenous or endogenous pathogens, the host immune system will be activated accordingly to resist harm and maintain homeostasis, which includes innate immunity and adaptive immunity. As the first line of host immune defense, innate immunity plays a critical role in recognizing extracellular and intracellular pathogens (1, 2)….

Continue Reading Frontiers | The cGAS-STING Pathway: A Promising Immunotherapy Target

Optimized two-step electroporation process to achieve efficient non-viral-mediated gene insertion into primary T cells

doi: 10.1002/2211-5463.13292. Online ahead of print. Affiliations Expand Affiliations 1 Cellectis Inc, 430E, 29th street, New York, NY, 10016, USA. 2 8 rue de la croix Jarry, 75013, Paris. Item in Clipboard Ming Yang et al. FEBS Open Bio. 2021. Show details Display options Display options Format AbstractPubMedPMID doi: 10.1002/2211-5463.13292. Online…

Continue Reading Optimized two-step electroporation process to achieve efficient non-viral-mediated gene insertion into primary T cells

US Federal Court Judge Rules BGI Sequencing Chemistries Infringe Illumina Patents

NEW YORK – A Federal Court judge has ruled that BGI’s StandardMPS and CoolMPS products infringe several Illumina patents. In an order issued Thursday, Judge William Orrick of the US District Court for the Northern District of California awarded Illumina’s request for summary judgement on those issues and also rebuffed…

Continue Reading US Federal Court Judge Rules BGI Sequencing Chemistries Infringe Illumina Patents

PacBio sequencing output increased through uniform and directional fivefold concatenation

Strategy and design of the method We sought to develop a simple method to increase the sequencing capability of PacBio CCS to sequence several diverse DNA libraries ~ 870 bp in length that encoded protein variants originating from a directed evolution campaign. To achieve an increase in the throughput of a PacBio sequencing…

Continue Reading PacBio sequencing output increased through uniform and directional fivefold concatenation

Oncogene Concatenated Enriched Amplicon Nanopore Sequencing for rapid, accurate, and affordable somatic mutation detection | Genome Biology

Stochastic Amplicon Ligation. DNA samples for oncology sequencing are typically extracted from FFPE tissues and can have average lengths of less than 500 nt due to accumulated chemical damage [18]. We developed the Stochastic Amplicon Ligation (SAL) method to enzymatically concatenate many short DNA molecules together to utilize the long-read…

Continue Reading Oncogene Concatenated Enriched Amplicon Nanopore Sequencing for rapid, accurate, and affordable somatic mutation detection | Genome Biology

nanopore sequencing stock

It holds a 15% stake in the company and has valued its holding at £340m, giving a valuation of more than £2bn for the company. . While the company’s current shareholders have recorded its value at just over £2bn, analysts . Essay from the year 2011 in the subject Business…

Continue Reading nanopore sequencing stock

Mapping digested synthetic oligos back to original sequences.

Mapping digested synthetic oligos back to original sequences. 0 Hi, I have several synthetic dsDNA of 70bp and I digest them with some enzyme. I am interested to see the exact cut site of the enzyme so I had the products sequenced using MiSeq. They are single-end read. What is…

Continue Reading Mapping digested synthetic oligos back to original sequences.

The LpoA activator is required to stimulate the peptidoglycan polymerase activity of its cognate cell wall synthase PBP1a

Significance Class A penicillin-binding proteins (aPBPs) assemble the bacterial cell wall and are the targets of penicillin and related β-lactam antibiotics. In gram-negative bacteria, the aPBPs require outer membrane lipoproteins to function. However, little is known about how these proteins promote the activity of their cognate synthases in cells. Here,…

Continue Reading The LpoA activator is required to stimulate the peptidoglycan polymerase activity of its cognate cell wall synthase PBP1a

CRISPR-Based Tech Could Revolutionize Antibody-Based Diagnostics

Lead author, Karl Barber with a PICASSO microarray. [Karl Barber, Schmidt Science Fellows] Scientists have used an adaptation of the genome editing technology CRISPR to develop a new peptide display platform that can be used as a tool to identify antibodies in patient blood samples. Researchers from the Howard Hughes…

Continue Reading CRISPR-Based Tech Could Revolutionize Antibody-Based Diagnostics