Tag: dsDNA

Investigation of the Flipping Dynamics of 1, N6-Ethenoadenine in Alkyladenine DNA Glycosylase

dataset posted on 2024-02-09, 02:43 authored by Bin Liu, Yanping Qi, Xiaowei Wang, Xin Gao, Yuan Yao, Lu Zhang Alkyladenine DNA glycosylase (AAG) is an essential enzyme responsible for maintaining genome integrity by repairing several DNA lesions damaged by alkylation or deamination. Understanding how it can recognize and excise the…

Continue Reading Investigation of the Flipping Dynamics of 1, N6-Ethenoadenine in Alkyladenine DNA Glycosylase

Structure-guided discovery of anti-CRISPR and anti-phage defense proteins

Identification of putative anti-crispr proteins using structural features To identify Acrs in phage genomes, we began by retrieving ~66.5 million proteins from Integrated Microbial Genomes Virus database (IMG/VR)37. We excluded large proteins because over 90% of known Acrs contain less than 200 amino acids38 (Fig. 1A, Supplementary Data 1). To reduce computational…

Continue Reading Structure-guided discovery of anti-CRISPR and anti-phage defense proteins

Clinical algorithm model based on cfDNA to predict SLE disease activity

Background: Circulating cell-free DNA (cfDNA) has been widely used as a new liquid-biopsy marker. Dysregulation of cfDNA has been found in patients with systemic lupus erythematosus (SLE). However, the detailed association between cfDNA and SLE has not been thoroughly studied. Methods: Plasma samples were collected from 88 patients with active…

Continue Reading Clinical algorithm model based on cfDNA to predict SLE disease activity

cfDNA Standards For Molecular Testing

Multiplexed ctDNA fragments (~150bp) mixed with nucleosomally fragmented wildtype cfDNA background in human plasma. The cell-derived ctDNA fragments are generated by Anchor’s unique multiplexed gene-editing method and are nucleosomally fragmented to around 150bp. The cell-derived variants are suitable for both the amplicon-based and capture-based methods. The synthetic ctDNA fragments are…

Continue Reading cfDNA Standards For Molecular Testing

Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3)

Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3) | 10.1515/cclm.2004.049 ◂ ↓ save donate to Sci-Hub from 1 USD and more González, C., Garcia-Berrocal, B., Herráez, O., Navajo, J. A., & ManuelGonzález-Buitrago, J. (2004). Anti-nucleosome, anti-chromatin, anti-dsDNA and…

Continue Reading Sci-Hub | Anti-nucleosome, anti-chromatin, anti-dsDNA and anti-histone antibody reactivity in systemic lupus erythematosus. Clinical Chemistry and Laboratory Medicine (CCLM), 42(3)

Double Stranded DNA (dsDNA) (Nuclear Marker) – CloneID – DSD/958

Double Stranded DNA (dsDNA) (Nuclear Marker) – CloneID – DSD/958 | Scientist.com Skip to Main Content Go to Main Navigation Details Gene ID: Not Applicable Uniprot: Not Applicable Gene Name: Not Applicable Applications: IHC Species Reactivity: Human Clonality: Monoclonal Host: Mouse Clone ID: DSD/958 Protein Target: Not Applicable Supplied As:…

Continue Reading Double Stranded DNA (dsDNA) (Nuclear Marker) – CloneID – DSD/958

High-sensitivity two-color detection of double-stranded DNA with a confocal fluorescence gel scanner using ethidium homodimer and thiazole orange

High-sensitivity two-color detection of double-stranded DNA with a confocal fluorescence gel scanner using ethidium homodimer and thiazole orange – Texas A&M University (TAMU) Scholar Search form   Overview   Research   Identity   Additional Document Info   Other   View All   Overview abstract Ethidium homodimer (EthD; lambda Fmax 620…

Continue Reading High-sensitivity two-color detection of double-stranded DNA with a confocal fluorescence gel scanner using ethidium homodimer and thiazole orange

Enhancement and inactivation effect of CRISPR/Cas12a via extending hairpin activators for detection of transcription factors

Li Q, Song ZL, Zhang YX, Zhu LN, Yang Q, Liu XF, Sun XF, Chen XX, Kong RM, Fan GC, Luo XL (2023) Synergistic Incorporation of two ssDNA activators enhances the trans-cleavage of CRISPR/Cas12a. Anal Chem 95:8879–8888 Article  CAS  PubMed  Google Scholar  Ma JY, Wang SY, Du YC, Wang DX,…

Continue Reading Enhancement and inactivation effect of CRISPR/Cas12a via extending hairpin activators for detection of transcription factors

Summary of Genomics and Transcriptomics – DNA sequencing I. Goal II. Methodology A. Sanger DNA

DNA sequencing I. Goal II. Methodology A. Sanger DNA sequencing ● Up to 900 base pairs ● Primer extension with labeled ddNTPs (radioactive or fluorescent) ● Prior knowledge on target needed ● Difficult to detect variation in mixtures ● High accuracy + still in use for genotyping When it is…

Continue Reading Summary of Genomics and Transcriptomics – DNA sequencing I. Goal II. Methodology A. Sanger DNA

correlations of longitudinal antibody measurements.

Antidouble stranded DNA antibody assays in systemic lupus erythematosus: correlations of longitudinal antibody measurements. Publication ,  Journal Article Ward, MM; Pisetsky, DS; Christenson, VD Published in: J Rheumatol To determine whether different assays of antidouble stranded DNA (anti-dsDNA) antibodies provide comparable information in quantitative antibody assessment over time, longitudinal correlations between…

Continue Reading correlations of longitudinal antibody measurements.

China develops new ASF vaccine candidate

The current findings on the development of a new ASF vaccine candidate were published in the Journal of Virology. Only Vietnam developed and approved a commercial vaccine against ASF thus far. Recent reports show there is hope for more vaccine development as scientists from Australia and the USA are also…

Continue Reading China develops new ASF vaccine candidate

Potent latency reversal by Tat RNA-containing nanoparticle enables multi-omic analysis of the HIV-1 reservoir

Participants and blood collection A total of n = 23 HIV-1 seropositive individuals on stably suppressive ART were included in this study (Supplementary Table 1). Participants were recruited at Ghent University Hospital. 2/23 individuals are female, 21/23 are male; the limited representation of female individuals in our study is a direct reflection of…

Continue Reading Potent latency reversal by Tat RNA-containing nanoparticle enables multi-omic analysis of the HIV-1 reservoir

Biosensors | Free Full-Text | DNA Probes for Cas12a-Based Assay with Fluorescence Anisotropy Enhanced Due to Anchors and Salts

3.1. Design of Experiments To search optimal structures of ssDNA probes with anchors, we operated with the following assumptions: (1) the anchor should be an easily accessible compound, (2) it should be readily incorporated into the ssDNA probe, (3) it should provide a significant difference in FA before and after…

Continue Reading Biosensors | Free Full-Text | DNA Probes for Cas12a-Based Assay with Fluorescence Anisotropy Enhanced Due to Anchors and Salts

Anti-dsDNA Antibody – Laboratory Test Catalog

Test Name Alias Anti-Double Stranded DNA | dsDNA Antibody level | 7161 Interface Order Alias 55121 Collection Instructions Specimen Collection: Blood Container(s): Gold Top (Serum Separator-SST Gel) Preferred Volume to Collect: 5.0 mL Minimum Volume to Collect: 1.0 mL Neonate Volume to Collect: 1.0 mL Capillary collect ok: Yes Microtainer acceptable: Yes Collection…

Continue Reading Anti-dsDNA Antibody – Laboratory Test Catalog

Solved 42. Polymerase chain reaction (PCR) is a technique

Transcribed image text: 42. Polymerase chain reaction (PCR) is a technique used to amplify (copy) DNA and is critical to the DNA cloning process. Suppose a single, linear molecule of double-stranded DNA (dSDNA) is amplified by PCR. After three PCR cycles, how many molecules of dsDNA will there be (assume…

Continue Reading Solved 42. Polymerase chain reaction (PCR) is a technique

Bioactive glycans in a microbiome-directed food for children with malnutrition

Collection and handling of biospecimens obtained from participants in the randomized controlled clinical study of the efficacy of MDCF-2 The human study entitled ‘Community-based clinical trial with microbiota-directed complementary foods (MDCFs) made of locally available food ingredients for the management of children with primary moderate acute malnutrition (MAM)’ was approved…

Continue Reading Bioactive glycans in a microbiome-directed food for children with malnutrition

Benchmarking DNA isolation methods for marine metagenomics

Scheme of the study The overall pipeline of our study is presented in Fig. 1 and is described in detail in the methods section. We processed three types of samples: fresh water, sea sediment, and digestive system of a marine invertebrate M. gigas (“gut flora”). These samples were treated in triplicates…

Continue Reading Benchmarking DNA isolation methods for marine metagenomics

Understanding lupus: Chronic lifelong autoimmune disease

KUALA LUMPUR (Bernama) — When Dr Thipa Paneer Chelvam, 32, was diagnosed with lupus – a chronic disease that can cause inflammation and pain in any part of the body – she was in a state of denial.   “I was in denial for many years. Accepting a chronic illness…

Continue Reading Understanding lupus: Chronic lifelong autoimmune disease

DNA Organization and Replication: Key Concepts, Diagrams, and

DNA Organization and Replication – Key Label the diagram with the following terms: Labels: Polynucleotide DNA strand: 3ʹend, 5ʹend, sugar-phosphate bonds, nucleotides; Nucleotide: sugar, phosphate, nitrogenous base; Nitrogenous bases: pyrimidines, purines, adenine, guanine, cytosine, thymine, uracil; Sugars: deoxyribose and ribose. State three ways DNA and RNA polynucleotides differ. 1. DNA…

Continue Reading DNA Organization and Replication: Key Concepts, Diagrams, and

Human RAD52 stimulates the RAD51-mediated homology search

Introduction Homologous recombination (HR) is an evolutionarily conserved process that plays a pivotal role in genome stability, diversity, and plasticity. HR is indeed a key repair pathway able to faithfully repair DNA damages including double-strand breaks (DSBs) and DNA gaps by copying the error-free information from the template DNA normally…

Continue Reading Human RAD52 stimulates the RAD51-mediated homology search

Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…

Continue Reading Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland

Foods | Free Full-Text | Isothermal Amplification and CRISPR/Cas12a-System-Based Assay for Rapid, Sensitive and Visual Detection of Staphylococcus aureus

1. Introduction Staphylococcus aureus [1], one of the top five foodborne pathogens, has a common and strong aggressiveness in humans and can secrete multiple toxic proteins (Pathogenic enterotoxins, Hemolysin, PVL) [1,2] which can cause bacteraemia, endocarditis, meningitis, toxic shock syndrome, pneumonia and other dangerous infectious diseases [3]. Moreover, the worldwide…

Continue Reading Foods | Free Full-Text | Isothermal Amplification and CRISPR/Cas12a-System-Based Assay for Rapid, Sensitive and Visual Detection of Staphylococcus aureus

Biosensors | Free Full-Text | CRISPR/Cas12a-Based Detection Platform for Early and Rapid Diagnosis of Scrub Typhus

1. Introduction Orientia tsutsugamushi (OT) is an obligate intracellular parasite bacteria and the causative agent of scrub typhus (ST), which is associated with acute febrile illness (AFI) [1] and transmitted by mites through an infected chigger bite (in the larval stage). This disease, which was earlier believed to be endemic…

Continue Reading Biosensors | Free Full-Text | CRISPR/Cas12a-Based Detection Platform for Early and Rapid Diagnosis of Scrub Typhus

Resin acids play key roles in shaping microbial communities during degradation of spruce bark

Bark preparation Spruce bark was obtained from the Iggesund pulp and paper mill (Iggesund, Holmen AB, Sweden), from a bark pile resulting from stripping of spruce logs at the mill after harvest, with the average age of trees at harvest being ~70 years. The bark was left to dry at…

Continue Reading Resin acids play key roles in shaping microbial communities during degradation of spruce bark

Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation

Sample collection A total of nine species of marine fish were collected across three different sampling days (September 7th, 9th, and 12th 2022) under IACUC Animal Use Protocol S12219 (Supplementary Data 1). Six species were collected using a speargun donated by a local fisher. Fish were transported back to shore, euthanized,…

Continue Reading Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation

Freshwater Viral Metagenome Analyses Targeting dsDNA Viruses

doi: 10.1007/978-1-0716-3515-5_3. Affiliations Expand Affiliations 1 Division of Environmental Materials, Honam National Institute of Biological Resources, Mokpo, Republic of Korea. 2 Department of Biological Sciences and Bioengineering, Inha University, Incheon, Republic of Korea. chojc@inha.ac.kr. Item in Clipboard Kira Moon et al. Methods Mol Biol. 2024. Show details Display options Display options…

Continue Reading Freshwater Viral Metagenome Analyses Targeting dsDNA Viruses

DNA polymerases in precise and predictable CRISPR/Cas9-mediated chromosomal rearrangements | BMC Biology

Cell culture The human endometrial carcinoma HEC-1-B cells were cultured in the modified Eagle’s medium (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 5% (v/v) CO2 incubator. The human embryonic kidney HEK293T cells were cultured in the Dulbecco’s modified Eagle’s medium (DMEM) supplemented…

Continue Reading DNA polymerases in precise and predictable CRISPR/Cas9-mediated chromosomal rearrangements | BMC Biology

Solved The helicase motors of RecD and RecB pull the

The helicase motors of RecD and RecB pull the double–stranded DNA (dsDNA) into the pin of RecC, thus separating the duplex into 5‘– and 3‘–tailed single strands. The 3‘ tail follows a channel through the complex, emerging at the nuclease active site. The 5‘ tail is threaded through a different…

Continue Reading Solved The helicase motors of RecD and RecB pull the

Serum IgE anti-dsDNA autoantibodies in patients with proliferative lupus nephritis are associated with tubulointerstitial inflammation

doi: 10.1080/0886022X.2023.2273981. Epub 2023 Dec 7. Affiliations Expand Affiliations 1 Renal Division, Department of Medicine, Peking University First Hospital, Beijing, PR China. 2 Institute of Nephrology, Peking University, Beijing, PR China. 3 Key Laboratory of Renal Disease, Ministry of Health of China, Beijing, PR China. 4 Key Laboratory of Chronic…

Continue Reading Serum IgE anti-dsDNA autoantibodies in patients with proliferative lupus nephritis are associated with tubulointerstitial inflammation

Error in StarDist groovy script for QuPath – Usage & Issues

I’m trying to adapt a StarDist groovy script to run StarDist on a dsDNA channel in a MIBI image stack. I’ve entered the path to the model and changed “DAPI” to “dsDNA”. When I run the script, I get the following error: ERROR: Mismatch of count of formal and actual…

Continue Reading Error in StarDist groovy script for QuPath – Usage & Issues

Arcticzymes

T4 DNA Ligase is an ATP and Mg2+ dependent dsDNA ligase which catalyses the formation of a phosphodiester bond between 3’-hydroxyl and 5’-phosphate termini in duplex DNA, duplex RNA and some DNA/RNA hybrids. T4 DNA Ligase is active on both blunt-end and cohesive-end substrates. It is also completely inactivated by…

Continue Reading Arcticzymes

Genomic DNA extraction optimization and validation for genome sequencing using the marine gastropod Kellet’s whelk [PeerJ]

Introduction Rapidly advancing next generation sequencing technologies such as whole genome sequencing, genotyping-in-thousands by sequencing (GT-seq), and restriction-site-associated DNA sequencing (RAD-seq), are becoming more available and affordable for non-model organisms (Park & Kim, 2016; Ellegren, 2014; Van Wyngaarden et al., 2017; Bootsma et al., 2020). However, applying these technologies to…

Continue Reading Genomic DNA extraction optimization and validation for genome sequencing using the marine gastropod Kellet’s whelk [PeerJ]

96tests | Mouse Double stranded DNA (dsDNA) Antibody IgG

Mouse Double stranded DNA (dsDNA) IgG ELISA Kit is an ELISA Kit against Mouse Double stranded DNA (dsDNA) IgG. Target Double stranded DNA (dsDNA) IgG Reactivity Mouse Tested Applications ELISA Recommended dilutions Optimal dilutions/concentrations should be determined by the end user. Storage Shipped at 4 °C. Upon receipt, store the…

Continue Reading 96tests | Mouse Double stranded DNA (dsDNA) Antibody IgG

Can DNA and 3D classification protocols be used to solve cases of deceased and unidentified women?

How to identifie ddDNA and sdDNA?5 answersDouble-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) can be identified using different methods. One approach is the use of peptide nucleic acid (PNA) for the direct recognition of dsDNA. Another method involves quantitating dsDNA in an aqueous sample solution by measuring its fluorescence intensity….

Continue Reading Can DNA and 3D classification protocols be used to solve cases of deceased and unidentified women?

Assembly mechanism of the inflammasome sensor AIM2 revealed by single molecule analysis

Pathogenic dsDNA prompts AIM2 assembly leading to the formation of the inflammasome, a multimeric complex that triggers the inflammatory response. The recognition of foreign dsDNA involves AIM2 self-assembly concomitant with dsDNA binding. However, we lack mechanistic and kinetic information on the formation and propagation of the assembly, which can shed…

Continue Reading Assembly mechanism of the inflammasome sensor AIM2 revealed by single molecule analysis

Efficient elimination of MELAS-associated m.3243G mutant mitochondrial DNA by an engineered mitoARCUS nuclease

mitoARCUS localizes to the mitochondrial matrix To evaluate the ability of mitoARCUS to specifically cleave m.3243G mutant mtDNA, cell lines containing varying levels of the mutation were generated. All of these cell lines were isolated from the same parental m.3243A>G cybrid cell line. Levels of the m.3243G mutation of each…

Continue Reading Efficient elimination of MELAS-associated m.3243G mutant mitochondrial DNA by an engineered mitoARCUS nuclease

Cas9 is mostly orthogonal to human systems of DNA break sensing and repair

Fig 1. Cleavage of the oligonucleotide or the plasmid substrates by Cas9/sgRNA in the presence of PARP1 and PARP2. Cas9/sgRNA (10 nM) was incubated with 32P-labelled dsDNA1*/2 or dsDNA1/2* (10 nM; A, B) or with pLK1 DNA (10 ng/μl; C, D) and the indicated amounts of NAD+, PARP1 (A, C)…

Continue Reading Cas9 is mostly orthogonal to human systems of DNA break sensing and repair

Trafficking and effect of released DNA in cGAS-STING signaling pathway activation and cardiovascular disease

1Hubei Key Laboratory of Diabetes and Angiopathy, Hubei University of Science and Technology, China 2Army Medical University, China 3Xianning Medical College, Hubei University of Science and Technology, China The final, formatted version of the article will be published soon. Notify me …

Continue Reading Trafficking and effect of released DNA in cGAS-STING signaling pathway activation and cardiovascular disease

Comparison of Tests for Systemic Lupus Erythematosus Diagnosis and Disease Monitoring

Systemic lupus erythematosus (SLE) is characterized by autoantibody production, with anti-dsDNA antibodies (anti-dsDNA) being a key indicator for SLE diagnosis and disease monitoring. A new study compared the results of two different tests that measure anti-dsDNA, an enzyme immunoassay (EIA, a blood or urine analysis that can help diagnose many infections…

Continue Reading Comparison of Tests for Systemic Lupus Erythematosus Diagnosis and Disease Monitoring

CRISPR and Cas Genes Market scrutinized in the new analysis

CRISPR and Cas Genes Market Size, Share & Trends Analysis Report by Product Type (Vector-based Cas and DNA-free Cas), by Service Type (Cell Line Engineering, gRNA design, Microbial Gene Editing and DNA Synthesis), by Application (Genome Engineering, Disease Models, Functional Genomics and Other) and by End Users (Biotechnology Companies &…

Continue Reading CRISPR and Cas Genes Market scrutinized in the new analysis

Communication between small cytosolic dsDNA and autophagy inhibits CGAS (cyclic GMP-AMP synthase) activation

doi: 10.1080/15548627.2023.2285612. Online ahead of print. Affiliations Expand Affiliation 1 Key Laboratory of Molecular Biology on Infectious Disease, Ministry of Education, Chongqing Medical University, Chongqing, P.R. China. Item in Clipboard Yu-Wei Luo et al. Autophagy. 2023. Show details Display options Display options Format AbstractPubMedPMID doi: 10.1080/15548627.2023.2285612. Online ahead of print. Affiliation…

Continue Reading Communication between small cytosolic dsDNA and autophagy inhibits CGAS (cyclic GMP-AMP synthase) activation

Comparative analysis of contemporary anti-double stranded DNA (anti-dsDNA) antibody assays for systemic lupus erythematosus

1Clinic of Internal Medicine III, Department of Oncology, Hematology, Rheumatology and Clinical Immunology, University Hospital Bonn, Germany 2Institute for Medical Biometry, Informatics and Epidemiology, University of Bonn, Germany 3Institute of Clinical Chemistry and Clinical Pharmacology, University Hospital Bonn, Germany The final, formatted…

Continue Reading Comparative analysis of contemporary anti-double stranded DNA (anti-dsDNA) antibody assays for systemic lupus erythematosus

Advances in structure-guided mechanisms impacting on the cGAS-STING innate immune pathway

doi: 10.1016/bs.ai.2023.08.001. Epub 2023 Sep 12. Affiliations Expand Affiliations 1 College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, Zhejiang, P.R. China. 2 College of Pharmaceutical Sciences, Zhejiang University, Hangzhou, Zhejiang, P.R. China; School of Biomedical Engineering, Hubei University of Medicine, Shiyan, Hubei, P.R. China. 3 Structural Biology Program, Memorial Sloan-Kettering Cancer…

Continue Reading Advances in structure-guided mechanisms impacting on the cGAS-STING innate immune pathway

The Mla system of diderm Firmicute Veillonella parvula reveals an ancestral transenvelope bridge for phospholipid trafficking

Bacterial strains and growth conditions Veillonella parvula SKV38 was grown in SK medium (10 g/L tryptone [Difco], 10 g/L yeast extract [Difco], 0.4 g/L disodium phosphate, 2 g/L sodium chloride, and 10 ml/L 60% [wt/vol] sodium DL-lactate; described in ref. 51. Cultures were incubated at 37 °C in anaerobic conditions, either in anaerobic bags (GENbag anaero;…

Continue Reading The Mla system of diderm Firmicute Veillonella parvula reveals an ancestral transenvelope bridge for phospholipid trafficking

Megakaryocytes possess a STING pathway that is transferred to platelets to potentiate activation

Introduction Host defence against infection relies on two important systems: the immune and the coagulation systems. Platelets are anucleate cells produced by megakaryocytes and are responsible for blood clotting and haemostasis (Lefrancais et al, 2017). They are also very abundant and play unexpected roles in immune responses (Maouia et al,…

Continue Reading Megakaryocytes possess a STING pathway that is transferred to platelets to potentiate activation

Empowering optical tweezers with ‘biometric eyes’

a, The diagrammatic sketch of the three components in the solution: DNA@AuNS conjugate, CRISPR/Cas12a complex, and target ssDNA. b, Optical setup, the BS, SPF, and TL are beam splitter, short pass filter, and tube lens (f=200 mm), respectively. Additional details of the setup are provided in the Materials and Methods…

Continue Reading Empowering optical tweezers with ‘biometric eyes’

Iron derived from NCOA4-mediated ferritinophagy causes cellular senescence via the cGAS-STING pathway

Materials and reagents Tert-butyl hydroperoxide (TBH) were purchased from Sigma-Aldrich (St. Louis, USA). Ferric ammonium citrate (FAC) and D-galactose (D-gal) was obtained from Selleck (Shanghai, China) and Aladdin (Shanghai, China), respectively. Deferoxamine (DFO), Mito-TEMPO (Mito-T), 3-Methyladenine (3-MA), Chloroquine (CQ), Bafilomycin A1 (Baf-A1), and H-151 were purchased from MedChemExpress (NJ, USA)….

Continue Reading Iron derived from NCOA4-mediated ferritinophagy causes cellular senescence via the cGAS-STING pathway

Hep B – information for hepatitisB – Hepatitis B: dsDNA virus Can survive outside the body for up to

Hepatitis B: dsDNA virus Can survive outside the body for up to 7 days! Only about 5% of acute cases become chronic in adults, while 90% become chronic in children! Transmission Parenteral route (percutaneously, mucosal contact, sexual contact, OR perinatal) Screening Recommendations High risk behaviors, Conditional risk exposures, HIV infection,…

Continue Reading Hep B – information for hepatitisB – Hepatitis B: dsDNA virus Can survive outside the body for up to

Antinuclear Antibodies (ANA) Screen, Reflex ANA IFA dsDNA Antibodies – Lab Results explained

Antinuclear Antibodies (ANA) are a group of autoantibodies that target substances found in the nucleus of a cell. The ANA screen is a preliminary test used to detect the presence of these antibodies in the blood, which may indicate the presence of an autoimmune disorder. When an ANA screen yields…

Continue Reading Antinuclear Antibodies (ANA) Screen, Reflex ANA IFA dsDNA Antibodies – Lab Results explained

Clinical implications of discordance between anti-dsDNA antibodies by multiplex flow immunoassay and Crithidia luciliae assay in a multiethnic racial cohort of patients with SLE

WHAT IS ALREADY KNOWN ON THIS TOPIC A gold standard assay for anti-dsDNA antibodies (anti-dsDNA) antibody detection in SLE diagnosis and disease activity monitoring does not exist. Of the two most used assays, enzyme immunoassays (EIAs) are considered to be more sensitive and less specific compared with Crithidia luciliae immunofluorescence…

Continue Reading Clinical implications of discordance between anti-dsDNA antibodies by multiplex flow immunoassay and Crithidia luciliae assay in a multiethnic racial cohort of patients with SLE

RCSB PDB – 8PBD: RAD51 filament on dsDNA bound by the BRCA2 c-terminus

ATPQuery on ATP Download Ideal Coordinates CCD File&nbsp CA [auth C]FA [auth D]IA [auth E]LA [auth F]OA [auth G] CA [auth C],FA [auth D],IA [auth E],LA [auth F],OA [auth G],RA [auth H],UA [auth I],V [auth A],XA [auth J],Z [auth B] Less ADENOSINE-5′-TRIPHOSPHATEC10 H16 N5 O13 P3ZKHQWZAMYRWXGA-KQYNXXCUSA-N CAQuery on CA Download…

Continue Reading RCSB PDB – 8PBD: RAD51 filament on dsDNA bound by the BRCA2 c-terminus

Rapid detection of avian influenza virus based on CRISPR-Cas12a | Virology Journal

Materials Escherichia coli strains expressing the LbCas12a protein, plasmids containing the AIV M and NP genes, and H1–H16 subtypes of AIV, newcastle disease virus (NDV), infectious bursal disease virus (IBDV), and infectious bronchitis virus (IBV) were conserved in the State Key Laboratory of Harbin Veterinary Research Institute (HVRI), Chinese Academy…

Continue Reading Rapid detection of avian influenza virus based on CRISPR-Cas12a | Virology Journal

Does rapamycin have a therapeutic benefit in lupus with high antibody levels to dsDNA?

What are the genetic mechanisms of SLE? 5 answers What are the uses of mycophenylate sodium? 3 answers What is the difference between mycophenolate sodium and mycophenylate mofetil? 3 answers What is the difference between mycophenolate sodium, mycophenylate mofetil and mycophenolic acid? 3 answers Why was mycophenolate sodium FDA approved…

Continue Reading Does rapamycin have a therapeutic benefit in lupus with high antibody levels to dsDNA?

Establishment of RT-RPA-Cas12a assay for rapid and sensitive detection of human rhinovirus B | BMC Microbiology

Clinical samples Thirty nasopharyngeal aspirates were collected from individuals with symptoms of respiratory tract infections, and tested positive for HRV-A (5 clinical samples), HRV-B (20 clinical samples), or HRV-C-positive (5 clinical samples) based on the method, as previously described [27]. Ten other specimens were tested negative for HRV-B, including human…

Continue Reading Establishment of RT-RPA-Cas12a assay for rapid and sensitive detection of human rhinovirus B | BMC Microbiology

Solved Practice Problems: Cloning, Primer Design and

Practice Problems: Cloning, Primer Design and Sequencing. Suppose that you have the following sequence for dsDNA: What is the palindromic sequence in the left–hand side? Label 5‘ and 3‘ ends What is the palindromic sequence in the right–hand side? Label 5‘ and 3‘ ends Design a primer for sequencing the…

Continue Reading Solved Practice Problems: Cloning, Primer Design and

Recovery of microbial DNA by agar-containing solution from extremely low-biomass specimens including skin

Ethical considerations This study complies with relevant institutional, national, and international guidelines and legislation. The Ethics Committee at the RIKEN Center for Integrative Medical Sciences (H30-4) approved this study, and written informed consent was obtained from all volunteers who provided specimens. Sampling solutions The AgST solution was prepared as follows:…

Continue Reading Recovery of microbial DNA by agar-containing solution from extremely low-biomass specimens including skin

Development of a portable on-site applicable metagenomic data generation workflow for enhanced pathogen and antimicrobial resistance surveillance

Sample collection and spiking Chicken fecal samples were collected and processed as follows: one spoonful of fecal material (≈ 1 g) was collected and stored in a DNA/RNA Shield™ Fecal Collection Tube R1101 containing 9 ml of DNA/RNA-shield (Zymo Research, Irvine, CA, USA), according to the manufacturer’s instructions. The sample was mixed…

Continue Reading Development of a portable on-site applicable metagenomic data generation workflow for enhanced pathogen and antimicrobial resistance surveillance

A solution of your PCR product has a concentration of

A solution of your PCR product has a concentration of 5μgmL and a NaCl concentration of 0.2M. For a path length of 1cm and an ε for dsDNA =20gcm**(L), draw a graph showing the OD of your solution as you raise its temperature from 50–99°C. On your graph, please indicate…

Continue Reading A solution of your PCR product has a concentration of

Establishment of dsDNA-dsDNA interactions by the condensin complex.

journal contribution posted on 2023-11-09, 14:27 authored by Minzhe Tang, Georgii Pobegalov, Hideki Tanizawa, Zhuo A Chen, Juri Rappsilber, Maxim Molodtsov, Ken-ichi Noma, Frank Uhlmann Condensin is a structural maintenance of chromosomes (SMC) complex family member thought to build mitotic chromosomes by DNA loop extrusion. However, condensin variants unable to…

Continue Reading Establishment of dsDNA-dsDNA interactions by the condensin complex.

Ten E.coli cells with 15N-dsDNA are incubated in medium containing 14N

Doubtnut is No.1 Study App and Learning App with Instant Video Solutions for NCERT Class 6, Class 7, Class 8, Class 9, Class 10, Class 11 and Class 12, IIT JEE prep, NEET preparation and CBSE, UP Board, Bihar Board, Rajasthan Board, MP Board, Telangana Board etc NCERT solutions for…

Continue Reading Ten E.coli cells with 15N-dsDNA are incubated in medium containing 14N

Circular extrachromosomal DNA promotes tumor heterogeneity in high-risk medulloblastoma

Statistical methods Statistical tests, test statistics and P values are indicated where appropriate in the main text. Categorical associations were established using the chi-squared test of independence if n > 5 for all categories and Fisherʼs exact test otherwise. For both tests, the Python package scipy.stats v1.5.3 implementation was used64. Multiple hypothesis corrections…

Continue Reading Circular extrachromosomal DNA promotes tumor heterogeneity in high-risk medulloblastoma

Mechanism and therapeutic potential of targeting cGAS-STING signaling in neurological disorders | Molecular Neurodegeneration

Hemmi H, et al. A toll-like receptor recognizes bacterial DNA. Nature. 2000;408(6813):740–5. Article  CAS  PubMed  Google Scholar  Unterholzner L, et al. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol. 2010;11(11):997–1004. Article  CAS  PubMed  PubMed Central  Google Scholar  Chiu YH, Macmillan JB, Chen ZJ. RNA polymerase III detects…

Continue Reading Mechanism and therapeutic potential of targeting cGAS-STING signaling in neurological disorders | Molecular Neurodegeneration

Why does the clinical manifestation of lupus nephritis not improve after dsDNA turns negative?

The clinical manifestation of lupus nephritis may not improve after dsDNA turns negative due to the presence of other autoantibodies and the complex pathogenesis of the disease. Lupus nephritis is a manifestation of systemic lupus erythematosus (SLE), an autoimmune disease characterized by autoantibody production. While anti-dsDNA antibodies are commonly associated…

Continue Reading Why does the clinical manifestation of lupus nephritis not improve after dsDNA turns negative?

Rapid in situ RNA imaging based on Cas12a thrusting strand displacement reaction | Nucleic Acids Research

Abstract RNA In situ imaging through DNA self-assembly is advantaged in illustrating its structures and functions with high-resolution, while the limited reaction efficiency and time-consuming operation hinder its clinical application. Here, we first proposed a new strand displacement reaction (SDR) model (Cas12a thrusting SDR, CtSDR), in which Cas12a could overcome…

Continue Reading Rapid in situ RNA imaging based on Cas12a thrusting strand displacement reaction | Nucleic Acids Research

Anti-dsDNA laboratory test: What is it?

The anti-dsDNA test is a blood test used to detect antibodies against double-stranded DNA. Antibodies are molecules produced by the immune system to combat foreign substances and pathogens. In some autoimmune diseases, these antibodies mistakenly attack the body’s cells and components. One specific antibody, Anti-dsDNA, specifically recognizes and binds to…

Continue Reading Anti-dsDNA laboratory test: What is it?

The DNA-binding induced (de)AMPylation activity of a Coxiella burnetii Fic enzyme targets Histone H3

Statistics and reproducibility Anti-AMP IP for LC-MS/MS analysis was performed in three independent biological replicates (n = 3). TSA assay data represents technical triplicates. Time-resolved (de)AMPylation analyzed by LC-MS was performed as biological triplicates. CD measurements were performed in technical triplicates. Anisotropy data is shown as technical triplicates. Anisotropy measurements were repeated…

Continue Reading The DNA-binding induced (de)AMPylation activity of a Coxiella burnetii Fic enzyme targets Histone H3

from Signalling Networks to Targeted Intervention [Abstract]

Int J Biol Sci 2024; 20(1):152-174. doi:10.7150/ijbs.84890 This issue Cite Review Jiahui Gong1, Xilong Gao2, Shaoyang Ge3, Hongliang Li4, Ran Wang2,5, Liang Zhao1,2,6✉ 1. College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China.2. Key Laboratory of Functional Dairy, Department of Nutrition and Health, China…

Continue Reading from Signalling Networks to Targeted Intervention [Abstract]

Human dsDNA Autoantibody (IgG) ELISA kit

This product is an ELISA kit for the determination of dsDNA Autoantibody in human Plasma or Serum. It is highly sensitive and available for the detection of dsDNA Autoantibody as low as 1.0 IU/mL . Datasheet Specifications Sensitivity 1.0 IU/mL (0 to 200 IU/mL) …

Continue Reading Human dsDNA Autoantibody (IgG) ELISA kit

RPA biosensors for rapid zoonoses screening

Introduction Since the emergence of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) in 2019, this coronavirus has spread to more than 200 countries, cumulatively infecting 672 million people and causing 6.84 million deaths. Moreover, the emergence of numerous variant strains (α, β, γ, δ, and Omicron) presents a serious challenge for…

Continue Reading RPA biosensors for rapid zoonoses screening

Solved Place the following events in the order they occur by

Transcribed image text: Place the following events in the order they occur by listing their assigned letters in that order. When formatting your answer, there should be no spaces or characters in between e.g. ABCDEF A. Cas 9 cuts both strands to generate a double-strand break. B. Cas9 unwinds dsDNA….

Continue Reading Solved Place the following events in the order they occur by

Researchers capture high-resolution images of magnesium ions interacting with CRISPR gene-editing enzyme

AceCas9 and its metal dependence. a, Top: domain organization of AceCas9 shown as colored blocks in the direction from the N terminus to the C terminus. The regions corresponding to the structural domains are colored and labeled, and the relevant residues are labeled. RuvC-I–RuvC-III, discontinuous segments of the RuvC domain;…

Continue Reading Researchers capture high-resolution images of magnesium ions interacting with CRISPR gene-editing enzyme

Widespread and largely unknown prophage activity, diversity, and function in two genera of wheat phyllosphere bacteria

Isolation of phyllosphere isolates All bacterial strains were isolated in June 2021 from the flag leaves of four wheat cultivars (Sheriff, Heerup, Rembrandt and Kvium) grown in an experimental field in Høje Taastrup, near Copenhagen, Denmark. Wheat flag leaves were picked, pooled, and either washed or blended prior to dilution…

Continue Reading Widespread and largely unknown prophage activity, diversity, and function in two genera of wheat phyllosphere bacteria

Single-nucleus DNA sequencing reveals hidden somatic loss-of-heterozygosity in Cerebral Cavernous Malformations

Ethical statement Our research complies with all relevant ethical regulations, including the Declaration of Helsinki and has been approved by the Institutional Review Boards of University of Chicago, Duke University and the Alliance to Cure Cavernous Malformations. Cerebral cavernous malformation lesions All human CCM tissue specimens have been previously reported18,19…

Continue Reading Single-nucleus DNA sequencing reveals hidden somatic loss-of-heterozygosity in Cerebral Cavernous Malformations

Catalytically inactive long prokaryotic Argonaute systems employ distinct effectors to confer immunity via abortive infection

Bacterial strains and phages Escherichia coli DH5a was routinely grown in Lysogeny broth (LB) medium and used for plasmid cloning, while E. coli BL21 (DE3) was used for protein production and the in vivo assays. E. coli phages T5, T7 and Lambda-vir are gifts from Shi Chen lab (Wuhan University,…

Continue Reading Catalytically inactive long prokaryotic Argonaute systems employ distinct effectors to confer immunity via abortive infection

Epigenetic regulation during cancer transitions across 11 tumour types

Specimen data All samples for MM, OV, BRCA, PDAC, UCEC, CRC, CESC/AD, SKCM and HNSCC, as well as 2 NATs for GBM and 1 NAT for ccRCC were collected with informed consent in concordance with Institutional Review Board (IRB) approval at the School of Medicine at Washington University in St…

Continue Reading Epigenetic regulation during cancer transitions across 11 tumour types

Mouse genome rewriting and tailoring of three important disease loci

BAC plasmids Human (CH17-203N23, CH17-449P15 and CH17-339H2) and mouse (RP23-51O13, RP23-75P20 and RP23-204E8) BACs were purchased from BACPAC Resources Center. Yeast–bacterium shuttle vector pLM1050 was modified by L. Mitchell based on a previous study28. pWZ699 was constructed by inserting a cassette containing pPGK-ΔTK-SV40pA transcription unit and the Actb gene into…

Continue Reading Mouse genome rewriting and tailoring of three important disease loci

Solved DNA viruses:Match the following characteristics for

DNA viruses:Match the following characteristics for the following DNA viruses. Only one answer foreach term and no answer is used more than once.TERMS POSSIBLE ANSWERS 1) Class I: dsDNA (+/-) virus A) Requires synthesis of DNA (-) before mRNA(+) can be transcribed. 2) Class II: ssDNA (+) virus. B) Can…

Continue Reading Solved DNA viruses:Match the following characteristics for

Longitudinal study of patients with discrepant results in CLIFT and a solid-phase dsDNA antibody assay: does a gold standard dsDNA assay exist?

What is already known on this topic The Crithidia luciliae indirect immunofluorescence test (CLIFT) has long been regarded as the gold standard in the diagnosis of SLE, but its limited sensitivity has been well documented. Solid phase assays are more sensitive for measuring double-stranded DNA (dsDNA) antibodies, but they have…

Continue Reading Longitudinal study of patients with discrepant results in CLIFT and a solid-phase dsDNA antibody assay: does a gold standard dsDNA assay exist?

Phase separation in cGAS-STING signaling

Sun L, Wu J, Du F, Chen X, Chen ZJ. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 2013; 339(6121): 786–791 Article  CAS  PubMed  Google Scholar  Wu J, Sun L, Chen X, Du F, Shi H, Chen C, Chen ZJ. Cyclic GMP-AMP…

Continue Reading Phase separation in cGAS-STING signaling

Beyond ATGC: enzymatic synthesis and nanopore sequencing of 12-letter supernumerary DNA to unlock xenobiology’s potential

Challenging the rules of Nature with unnatural base pairing xenonucleic acids (XNAs) The 4-letter DNA code Nature utilizes (A, T, G, C) is the backbone of the central dogma and the very blueprint of life itself. Our ability to manipulate this code is also the driver of biotechnological progress; everything…

Continue Reading Beyond ATGC: enzymatic synthesis and nanopore sequencing of 12-letter supernumerary DNA to unlock xenobiology’s potential

Solved The indirect fluorescent antibody detection of

The indirect fluorescent antibody detection of anti-dsDNA uses which of the following as the antigen source? A) Hep 2 cell cultures B) mouse stomach sections C) Crithidia lucilliae kinetoplast D) monkey kidney cellsWhat type of antibodies are indicated by a positive peripheral or rim pattern observed on an ANA test?…

Continue Reading Solved The indirect fluorescent antibody detection of

CRISPR and Cas Genes Market Share, Trends, Future Outlook,

Global CRISPR and Cas genes market is anticipated to grow at a CAGR of 13.5% during the forecast period (2023-2030). The technological advancements in CRISPR & Cas gene systems have contemporarily revolutionized the area of cancer research and therapeutics. As the prevalence of genetic diseases and complex medical conditions continues…

Continue Reading CRISPR and Cas Genes Market Share, Trends, Future Outlook,

Increased binding of anti-dsDNA antibodies to short oligonucleotides modified with topoisomerase I reveals a potential new enzyme function independent from DNA relaxation | BMC Research Notes

Lee MP, Brown SD, Chen A, Hsieh TS. DNA topoisomerase I is essential in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1993;90(14):6656–60. doi.org/10.1073/pnas.90.14.6656. [published Online First: Epub Date]|. Article  CAS  PubMed  PubMed Central  Google Scholar  Morham SG, Kluckman KD, Voulomanos N, Smithies O. Targeted disruption of the mouse…

Continue Reading Increased binding of anti-dsDNA antibodies to short oligonucleotides modified with topoisomerase I reveals a potential new enzyme function independent from DNA relaxation | BMC Research Notes

COVID-19 Vaccines Have Not Been Shown to Alter DNA, Cause Cancer

SciCheck Digest Small amounts of DNA from the manufacturing process may remain in the mRNA COVID-19 vaccines. Purification and quality control steps ensure any leftover DNA is present within regulatory limits. There isn’t reason to think that this residual DNA would alter a person’s DNA or cause cancer, contrary to claims made…

Continue Reading COVID-19 Vaccines Have Not Been Shown to Alter DNA, Cause Cancer

The parapoxvirus Orf virus inhibits dsDNA-mediated type I IFN expression via STING-dependent and STING-independent signalling pathways

The parapoxvirus Orf virus inhibits dsDNA-mediated type I IFN expression via STING-dependent and STING-independent signalling pathways | Microbiology Society 1887 This is a required field Please enter a valid email address Approval was a Success Invalid data An Error Occurred Approval was partially successful, following selected items could…

Continue Reading The parapoxvirus Orf virus inhibits dsDNA-mediated type I IFN expression via STING-dependent and STING-independent signalling pathways

PDF (read online) Lesser Known Large dsDNA Viruses (Current Topics in Microbiology and Immunology,

Lesser Known Large dsDNA Viruses (Current Topics in Microbiology and Immunology, 328) Read and Download Lesser Known Large dsDNA Viruses (Current Topics in Microbiology and Immunology, 328) Download : Lesser Known Large dsDNA Viruses (Current Topics in Microbiology and Immunology, 328) Read : Lesser Known Large dsDNA Viruses (Current Topics…

Continue Reading PDF (read online) Lesser Known Large dsDNA Viruses (Current Topics in Microbiology and Immunology,

Contrary to viral claim, regulatory agencies knew of residual DNA in COVID-19 mRNA vaccines; no evidence this poses health concern

CLAIM Regulatory agencies didn’t know of residual DNA contamination in COVID-19 RNA vaccines; residual DNA could integrate into our DNA and cause cancer DETAILS Factually inaccurate: Health Canada stated that it was aware of residual DNA in COVID-19 mRNA vaccines before the vaccines were authorized. A dossier submitted by BioNTech…

Continue Reading Contrary to viral claim, regulatory agencies knew of residual DNA in COVID-19 mRNA vaccines; no evidence this poses health concern

RCSB PDB – 8EAE: Structure of Ternary Complex of cGAS with dsDNA and Bound 5-pppG(2,5)pI

VLO (Subject of Investigation/LOI)Query on VLO Download Ideal Coordinates CCD File&nbsp Download Instance Coordinates  G [auth A],J [auth C] [[(2~{R},3~{R},4~{R},5~{R})-5-(2-azanyl-6-oxidanylidene-1~{H}-purin-9-yl)-4-[[(2~{R},3~{S},4~{R},5~{R})-3,4-bis(oxidanyl)-5-(6-oxidanylidene-1~{H}-purin-9-yl)oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-3-oxidanyl-oxolan-2-yl]methoxy-oxidanyl-phosphoryl] phosphono hydrogen phosphateC20 H27 N9 O21 P4QIEFBLFMZQEZSF-INFSMZHSSA-N  Ligand Interaction Read more here: Source link

Continue Reading RCSB PDB – 8EAE: Structure of Ternary Complex of cGAS with dsDNA and Bound 5-pppG(2,5)pI

Invasive Californian death caps develop mushrooms unisexually and bisexually

Mushroom collecting Sporocarps were collected from various herbaria and during three expeditions to Point Reyes National Seashore (PRNS), California in 2004, 2014 and 2015, and in 2015 from three sites in Portugal. A total of 86 sporocarps were collected: 67 Californian sporocarps (one early herbarium sample dates to 1993), 11…

Continue Reading Invasive Californian death caps develop mushrooms unisexually and bisexually

Amerigo Scientific Unveils CRISPR/Cas Enzymes to Expand

Amerigo Scientific, as a distributor focused on providing critical products and services to biomedical and life science communities, announced the release of a groundbreaking selection of CRISPR/Cas enzymes to its extensive life science portfolio, aimed at further expanding the vast potential of the CRISPR toolbox. This addition brings cutting-edge genetic…

Continue Reading Amerigo Scientific Unveils CRISPR/Cas Enzymes to Expand

[Solved] Which of the following dsDNA fragments would have the highest – Foundations in Molecular Biology and Genetics FW (Mbg2040)

Answer The melting temperature (Tm) of a DNA fragment is determined by its nucleotide composition. Specifically, DNA fragments with a higher proportion of Guanine (G) and Cytosine (C) base pairs will have a higher Tm because G-C base pairs form three hydrogen bonds, compared to the two formed by Adenine…

Continue Reading [Solved] Which of the following dsDNA fragments would have the highest – Foundations in Molecular Biology and Genetics FW (Mbg2040)

Solved 5. Listed below is the dsDNA sequence for an E. coli

Transcribed image text: 5. Listed below is the dsDNA sequence for an E. coli gene. Transcription begins at the red underlined C/G pair. 3′-CACAGGCAGATTATAACACTCTACAATATAGGGCGGCAGTTGTGGTAGTT-5′ 60 80 100 5′-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3′ 3′- TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5′ A. Where would the promoter be relative to the start site? B. What are the first 16 nucleotides of the…

Continue Reading Solved 5. Listed below is the dsDNA sequence for an E. coli

A look at dsDNA & Vaccines as Causative Agents (With Christie Grace)

Support the streamtipjar.wetalkyoulisten.com/www.buymeacoffee.com/DrKevinMcCairn(PayPal) paypal.me/raccooncommander?country.x=GB&locale.x=en_GBwww.patreon.com/join/4229182?www.subscribestar.com/kevin-w-mccairn-ph-dwww.mccairndojo.com/www.mccairndojo.comwww.wtyl.liveMusic Xurios, Radz, Pa11elellives, Astral Throb, OneStepTooFarJoin our Discord, the invite can be found on:www.mccairndojo.com/Twitter @wtyl_liveTelegram:t.me/kevin_w_mccairn_phdResearch History – Kevin W. McCairn Ph.D.www.researchgate.net/profile/Kevin_McCairnBitcoin:34JZjBeTrG2w9AVB8Tpdt1PVt78UoWrMZVBitcoin Cash:qqfuagsmg9xk5gsptke88y42jan8x5mauyj2yng2hpEthereum:0xB8bE2a9A2edCbb77A6a2Cd289032Cecad3C92aFEEthereum Classic0xE4fa23aBBdA9B0c8DEa5d7Bfc2665E25dE83B58FLitecoin:MFVDyqCNpMfFnDPWTtaxVtgCcPpkaTeeuyXRP-Wallet:rw2ciyaNshpHe7bCHo4bRWq6pqqynnWKQgXRP-Tag:470905637mRNA Vaccines, Biowarfare Read more here: Source link

Continue Reading A look at dsDNA & Vaccines as Causative Agents (With Christie Grace)

TLR9 regulates the autophagy-lysosome pathway to promote dendritic cell maturation and activation by activating the TRAF6-cGAS-STING pathway

doi: 10.1002/kjm2.12769. Online ahead of print. Affiliations Expand Affiliations 1 Department of Rheumatology & Immunology, Hainan General Hospital, Hainan Affiliated Hospital of Hainan Medical University, Haikou, Hainan Province, People’s Republic of China. 2 Traditional Chinese Medicine Department, Boao Yiling Life Care Center, Qionghai, Hainan Province, People’s Republic of China. 3…

Continue Reading TLR9 regulates the autophagy-lysosome pathway to promote dendritic cell maturation and activation by activating the TRAF6-cGAS-STING pathway

Inactive S. aureus Cas9 downregulates alpha-synuclein and reduces mtDNA damage and oxidative stress levels in human stem cell model of Parkinson’s disease

Cloning of CRISPR/sgRNA lentiviral constructs with fluorescent selection markers A tetracycline-inducible promoter (TRE3G) was used to control the expression of S. aureus dCas9 in a lentiviral vector. To facilitate selection of cells by FACS, pHR:TRE3G-SadCas9-2xKRAB-p2a-tdTomato (Addgene ID #209298) was subcloned from a pHR:TRE3G-SadCas9-2xKRAB-p2a-zeo (A gift from Professor Stanley Qi), where zeocin…

Continue Reading Inactive S. aureus Cas9 downregulates alpha-synuclein and reduces mtDNA damage and oxidative stress levels in human stem cell model of Parkinson’s disease

B cell polygenic risk scores associate with anti-dsDNA antibodies and nephritis in systemic lupus erythematosus

Objective: B cell function and autoantibodies are important in SLE pathogenesis. In this work, we aimed to investigate the impact of cumulative SLE B cell genetics on SLE subphenotype and autoantibody profile. Methods: Female patients with SLE (n=1248) and healthy controls (n=400) were genotyped using Illumina’s Global Screening Array. Two…

Continue Reading B cell polygenic risk scores associate with anti-dsDNA antibodies and nephritis in systemic lupus erythematosus

Generation of UL128-shRNA transduced fibroblasts for the release of cell-free virus from clinical human cytomegalovirus isolates

Human cytomegalovirus (HCMV) is a herpesvirus that is widespread in the population worldwide [1,2], where it remains latent after infection in its host for a lifetime [3–5]. While primary infection or reactivation in immunocompetent individuals usually remains subclinical and causes little or no symptoms, it can cause severe damage in…

Continue Reading Generation of UL128-shRNA transduced fibroblasts for the release of cell-free virus from clinical human cytomegalovirus isolates

DNA damage induced by CDK4 and CDK6 blockade triggers anti-tumor immune responses through cGAS-STING pathway

Patients’ tumor tissues and clinical data This study recruited 125 breast cancer patients for immunohistochemical (IHC) analysis and 10 breast cancer patients for RNA-seq analysis from the Affiliated Tumor Hospital of Nantong University. Tumor tissues collected from surgical patients were fixed with formalin and embedded with paraffin and then examined….

Continue Reading DNA damage induced by CDK4 and CDK6 blockade triggers anti-tumor immune responses through cGAS-STING pathway

using the ssRNA genome as a template The ssDNA is then made into dsDNA which can

using the +ssRNA genome as a template. The ssDNA is then made into dsDNA, which can integrate into the host chromosome and become a permanent part of the host. The integrated viral genome is called aprovirus. The virus now can remain in the host for a long time to establish…

Continue Reading using the ssRNA genome as a template The ssDNA is then made into dsDNA which can

Establishment of dsDNA-dsDNA interactions by the condensin complex

. 2023 Sep 27:S1097-2765(23)00746-3. doi: 10.1016/j.molcel.2023.09.019. Online ahead of print. Affiliations Expand Affiliations 1 Chromosome Segregation Laboratory, The Francis Crick Institute, London NW1 1AT, UK. 2 Mechanobiology and Biophysics Laboratory, The Francis Crick Institute, London NW1 1AT, UK; Department of Physics and Astronomy, University College London, London WC1E 6BT, UK….

Continue Reading Establishment of dsDNA-dsDNA interactions by the condensin complex