Tag: ExPASy

Entry EC 4.2.1.141                Enzyme                                  Name 2-dehydro-3-deoxy-D-arabinonate dehydratase Class Lyases;Carbon-oxygen lyases;Hydro-lyasesBRITE hierarchy Sysname 2-dehydro-3-deoxy-D-arabinonate hydro-lyase (2,5-dioxopentanoate-forming) Reaction(IUBMB) 2-dehydro-3-deoxy-D-arabinonate = 2,5-dioxopentanoate + H2O [RN:R09186] Reaction(KEGG) Substrate 2-dehydro-3-deoxy-D-arabinonate [CPD:C03826] Product Comment The enzyme participates in pentose oxidation pathways that convert pentose sugars to the tricarboxylic acid cycle intermediate 2-oxoglutarate. History EC 4.2.1.141 created 2013 Pathway…

KEGG ENZYME: 3.4.21.67     ENZYME: 3.4.21.67 Help Entry EC 3.4.21.67                Enzyme                                  Name endopeptidase So;E. coli cytoplasmic proteinase;proteinase So;Escherichia coli serine proteinase So Class Hydrolases;Acting on peptide bonds (peptidases);Serine endopeptidasesBRITE hierarchy Reaction(IUBMB) Hydrolysis of proteins, but not Bz-Tyr-OEt, Ac-Phe-beta-naphthylester, or Bz-Arg-OEt Comment An Escherichia coli cytoplasmic endopeptidase formerly included in EC 3.4.21.14. Inhibited…

Entry EC 2.1.1.308                Enzyme                                  Name cytidylyl-2-hydroxyethylphosphonate methyltransferase;Fom3;S-adenosyl-L-methionine:methylcob(III)alamin:2-hydroxyethylphosphonate methyltransferase (incorrect);2-hydroxyethylphosphonate methyltransferase (incorrect) Class Transferases;Transferring one-carbon groups;MethyltransferasesBRITE hierarchy Sysname S-adenosyl-L-methionine:cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} C-methyltransferase Reaction(IUBMB) 2 S-adenosyl-L-methionine + cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} + reduced acceptor = S-adenosyl-L-homocysteine + 5′-deoxyadenosine + L-methionine + cytidine 5′-{[hydroxy(2-hydroxypropyl)phosphonoyl]phosphate} + oxidized acceptor [RN:R12497] Reaction(KEGG) Substrate S-adenosyl-L-methionine [CPD:C00019]; cytidine 5′-{[hydroxy(2-hydroxyethyl)phosphonoyl]phosphate} [CPD:C22216]; reduced acceptor [CPD:C00030]…

Entry EC 2.4.1.383                Enzyme                                  Name GDP-Man:alpha-L-Rha-(1->3)-alpha-D-Gal-PP-Und beta-1,4-mannosyltransferase;wbaO (gene name);rfbO (gene name) Class Transferases;Glycosyltransferases;HexosyltransferasesBRITE hierarchy Sysname GDP-alpha-D-mannose:alpha-L-rhamnopyranosyl-(1->3)-alpha-D-galactopyranosyl-diphospho-ditrans,octacis-undecaprenol 4II-beta-mannosyltransferase (configuration inverting) Reaction(IUBMB) GDP-alpha-D-mannose + alpha-L-Rha-(1->3)-alpha-D-Gal-PP-Und = GDP + beta-D-Man-(1->4)-alpha-L-Rha-(1->3)-alpha-D-Gal-PP-Und [RN:R12745] Reaction(KEGG) Substrate GDP-alpha-D-mannose [CPD:C00096]; alpha-L-Rha-(1->3)-alpha-D-Gal-PP-Und Product GDP [CPD:C00035]; beta-D-Man-(1->4)-alpha-L-Rha-(1->3)-alpha-D-Gal-PP-Und Comment The enzyme participates in the biosynthesis of the O antigens produced by group E…

Entry EC 1.1.1.352                Enzyme                                  Name 5′-hydroxyaverantin dehydrogenase;HAVN dehydrogenase;adhA (gene name) Class Oxidoreductases;Acting on the CH-OH group of donors;With NAD+ or NADP+ as acceptorBRITE hierarchy Sysname (1’S,5’S)-hydroxyaverantin:NAD+ oxidoreductase Reaction(IUBMB) (1) (1’S,5’S)-hydroxyaverantin + NAD+ = 5′-oxoaverantin + NADH + H+ [RN:R10310]; (2) (1’S,5’R)-hydroxyaverantin + NAD+ = 5′-oxoaverantin + NADH + H+ [RN:R10311] Reaction(KEGG) Substrate…

Entry EC 1.14.12.14               Enzyme                                  Name 2-aminobenzenesulfonate 2,3-dioxygenase;2-aminosulfobenzene 2,3-dioxygenase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With NADH or NADPH as one donor, and incorporation of two atoms of oxygen into the other donorBRITE hierarchy Sysname 2-aminobenzenesulfonate,NADH:oxygen oxidoreductase (2,3-hydroxylating, ammonia-forming) Reaction(IUBMB) 2-aminobenzenesulfonate + NADH + H+ + O2 =…

Entry EC 1.14.14.10               Enzyme                                  Name nitrilotriacetate monooxygenase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname nitrilotriacetate,FMNH2:oxygen oxidoreductase (glyoxylate-forming) Reaction(IUBMB) nitrilotriacetate + FMNH2 + H+ + O2 = iminodiacetate…

Entry EC 1.14.14.85               Enzyme                                  Name 7-deoxyloganate 7-hydroxylase;CYP72A224 (gene name);7-deoxyloganin 7-hydroxylase (incorrect);7-deoxyloganin,[reduced NADPH—hemoprotein reductase]:oxygen oxidoreductase (7alpha-hydroxylating) (incorrect) Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname 7-deoxyloganate,[reduced NADPH—hemoprotein reductase]:oxygen oxidoreductase…

Entry EC 4.2.3.120                Enzyme                                  Name (-)-beta-pinene synthase;beta-geraniolene synthase;(-)-(1S,5S)-pinene synthase;geranyldiphosphate diphosphate lyase (pinene forming) Class Lyases;Carbon-oxygen lyases;Acting on phosphatesBRITE hierarchy Sysname geranyl-diphosphate diphosphate-lyase [cyclizing, (-)-beta-pinene-forming] Reaction(IUBMB) geranyl diphosphate = (-)-beta-pinene + diphosphate [RN:R05766] Reaction(KEGG) Substrate geranyl diphosphate [CPD:C00341] Product Comment Cyclase II of Salvia officinalis (sage) produces about equal parts (-)-alpha-pinene, (-)-beta-pinene and…

Entry EC 1.14.15.24               Enzyme                                  Name beta-carotene 3-hydroxylase;beta-carotene 3,3′-monooxygenase;CrtZ Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname beta-carotene,reduced ferredoxin [iron-sulfur] cluster:oxygen 3-oxidoreductase Reaction(IUBMB) beta-carotene + 4 reduced ferredoxin [iron-sulfur] cluster…

Entry EC 3.4.22.28                Enzyme                                  Name picornain 3C;picornavirus endopeptidase 3C;poliovirus protease 3C;rhinovirus protease 3C;foot-and-mouth protease 3C;poliovirus proteinase 3C;rhinovirus proteinase 3C;coxsackievirus 3C proteinase;foot-and-mouth-disease virus proteinase 3C;3C protease;3C proteinase;cysteine proteinase 3C;hepatitis A virus 3C proteinase;protease 3C;tomato ringspot nepovirus 3C-related protease Class Hydrolases;Acting on peptide bonds (peptidases);Cysteine endopeptidasesBRITE hierarchy Reaction(IUBMB) Selective cleavage of Gln!Gly bond in…

Reagents Activated Factor X (FXa) was purchased from New England Biolabs. Rivaroxaban was purchased from Santa Cruz. For Western blotting and immunofluorescence staining, the following antibodies were used: LOX rabbit polyclonal (ThermoFisher PA1-46020), LOXL2 rabbit monoclonal C-terminal (Abcam ab179810), LOXL2 polyclonal (Abcam ab197779), COLI monoclonal antibody (Invitrogen MA1-26771), COLIV rabbit…

Transcribed image text: Perform the following Expasy analyses. Provide screenshots of analyses for both translate and protparam calculations. a) Translate the recA gene sequence to protein using “EXPASY: translate” tool. Copy and paste the RecA protein sequence into your answer sheet. (1 point) b) Use “EXPASY Protparam” tool to calculate…

Entry EC 1.3.99.39                Enzyme                                  Name carotenoid phi-ring synthase;crtU (gene name) (ambiguous) Class Oxidoreductases;Acting on the CH-CH group of donors;With unknown physiological acceptorsBRITE hierarchy Sysname carotenoid beta-ring:acceptor oxidoreductase/methyltranferase (phi-ring-forming) Reaction(IUBMB) carotenoid beta-end group + 2 acceptor = carotenoid phi-end group + 2 reduced acceptor [RN:R12115] Reaction(KEGG) Substrate carotenoid beta-end group [CPD:C21915]; acceptor [CPD:C00028]…

Entry EC 1.1.1.237                Enzyme                                  Name hydroxyphenylpyruvate reductase;HPPR Class Oxidoreductases;Acting on the CH-OH group of donors;With NAD+ or NADP+ as acceptorBRITE hierarchy Sysname (R)-3-(4-hydroxyphenyl)lactate:NAD(P)+ oxidoreductase Reaction(IUBMB) (1) (R)-3-(4-hydroxyphenyl)lactate + NAD(P)+ = 3-(4-hydroxyphenyl)pyruvate + NAD(P)H + H+ [RN:R03337 R03339]; (2) (R)-3-(3,4-dihydroxyphenyl)lactate + NAD(P)+ = 3-(3,4-dihydroxyphenyl)pyruvate + NAD(P)H + H+ [RN:R03373 R12252] Reaction(KEGG) Substrate (R)-3-(4-hydroxyphenyl)lactate…

Entry EC 1.14.14.57               Enzyme                                  Name taurochenodeoxycholate 6alpha-hydroxylase;CYP3A4;CYP4A21;taurochenodeoxycholate 6alpha-monooxygenase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname taurochenodeoxycholate,[reduced NADPH—hemoprotein reductase]:oxygen oxidoreductase (6alpha-hydroxylating) Reaction(IUBMB) (1) taurochenodeoxycholate + [reduced NADPH—hemoprotein reductase]…

Introduction Cyanide-containing compounds are known as nitriles and are widely distributed in the natural environment. They are generated by different plants in various forms, such as ricinine, phenyl acetonitrile, cyanogenic glycosides, and β -cyanoalanine (Sewell et al., 2003). Anthropogenic activities have substantially influenced the production of vast quantities of nitrile…

KEGG ENZYME: 2.5.1.118     ENZYME: 2.5.1.118 Help Entry EC 2.5.1.118                Enzyme                                  Name beta-(isoxazolin-5-on-2-yl)-L-alanine synthase Class Transferases;Transferring alkyl or aryl groups, other than methyl groups;Transferring alkyl or aryl groups, other than methyl groups (only sub-subclass identified to date)BRITE hierarchy Sysname O-acetyl-L-serine:isoxazolin-5-one 2-(2-amino-2-carboxyethyl)transferase Reaction(IUBMB) O-acetyl-L-serine + isoxazolin-5-one = 3-(5-oxoisoxazolin-2-yl)-L-alanine + acetate [RN:R10839] Reaction(KEGG) Substrate…

Entry EC 3.4.22.43                Enzyme                                  Name cathepsin V;Cathepsin L2;cathepsin U Class Hydrolases;Acting on peptide bonds (peptidases);Cysteine endopeptidasesBRITE hierarchy Reaction(IUBMB) The recombinant enzyme hydrolyses proteins (serum albumin, collagen) and synthetic substrates (Z-Phe-Arg-NHMec > Z-Leu-Arg-NHMec > Z-Val-Arg-NHMec) Comment Cathepsin V is a human lysosomal cysteine endopeptidase of family C1 (papain family) that is maximally active…

Entry EC 1.1.1.423                Enzyme                                  Name (1R,2S)-ephedrine 1-dehydrogenase;EDH;ephedrine dehydrogenase Class Oxidoreductases;Acting on the CH-OH group of donors;With NAD+ or NADP+ as acceptorBRITE hierarchy Sysname (-)-(1R,2S)-ephedrine:NAD+ 1-oxidoreductase Reaction(IUBMB) (-)-(1R,2S)-ephedrine + NAD+ = (S)-2-(methylamino)-1-phenylpropan-1-one + NADH + H+ [RN:R12560] Reaction(KEGG) Substrate Product Comment The enzyme, characterized from the bacterium Arthrobacter sp. TS-15, acts on a…

Entry EC 1.14.13.23               Enzyme                                  Name 3-hydroxybenzoate 4-monooxygenase;3-hydroxybenzoate 4-hydroxylase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With NADH or NADPH as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname 3-hydroxybenzoate,NADPH:oxygen oxidoreductase (4-hydroxylating) Reaction(IUBMB) 3-hydroxybenzoate + NADPH + H+ + O2 = 3,4-dihydroxybenzoate…

Entry EC 1.1.1.396                Enzyme                                  Name bacteriochlorophyllide a dehydrogenase;bchC (gene name) Class Oxidoreductases;Acting on the CH-OH group of donors;With NAD+ or NADP+ as acceptorBRITE hierarchy Sysname 3-deacetyl-3-(1-hydroxyethyl)bacteriochlorophyllide-a:NAD+ oxidoreductase (bacteriochlorophyllide a-forming) Reaction(IUBMB) (1) 3-deacetyl-3-(1-hydroxyethyl)bacteriochlorophyllide a + NAD+ = bacteriochlorophyllide a + NADH + H+ [RN:R09055]; (2) 3-devinyl-3-(1-hydroxyethyl)chlorophyllide a + NAD+ = 3-acetyl-3-devinylchlorophyllide a +…

Stairs CW, Leger MM, Roger AJ. Diversity and origins of anaerobic metabolism in mitochondria and related organelles. Philos Trans R Soc B: Biol Sci. 2015;370:20140326. Article  Google Scholar  Eme L, Spang A, Lombard J, Stairs CW, Ettema TJG. Archaea and the origin of eukaryotes. Nat Rev Microbiol. 2017;15:711–23. Article  CAS …

Transcribed image text: Now, refine your information using the ProtScale tools at the ExPASy bioinformatics resource portal. Each of the PDB Protein Feature Views was created with a UniProt Knowledgebase ID. – For glycophorin A, the UniProtKB ID is P02724. – For myoglobin, the UniProtKB ID is P02185. – For…

KEGG ORTHOLOGY: K19961     ORTHOLOGY: K19961 Help Entry K19961                      KO                                      Symbol chnD Name 6-hydroxyhexanoate dehydrogenase [EC:1.1.1.258] Pathway map01220   Degradation of aromatic compounds Brite KEGG Orthology (KO) [BR:ko00001] 09100 Metabolism  09111 Xenobiotics biodegradation and metabolism   00930 Caprolactam degradation    K19961  chnD; 6-hydroxyhexanoate dehydrogenaseEnzymes [BR:ko01000] 1. Oxidoreductases  1.1  Acting on the CH-OH group of donors   1.1.1  With NAD+ or NADP+ as acceptor    1.1.1.258  6-hydroxyhexanoate dehydrogenase     K19961  chnD; 6-hydroxyhexanoate…

Transcribed image text: CHM/BIO 4361 Protein Concentration Lab Additional Questions 1.) Using the primary sequences provided, compare the molecular weights and relative Trp and Tyr content percentages of our two proteins to the extinction coefficients given by Expasy ProtParam (assuming fully formed disulfides for all). Because ProtParam depends only on…

question6. Using the ExPASy translate tool, provide a protein translation of the transcript sequence, and indicate the size in nucleotides of: 1) the complete nucleotide sequence; 2) the 5’ untranslated region (UTR); 3) the 3’ UTR; and 4) the open reading frame (ORF; indicate which reading frame you selected) ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA…

3.Run a standard protein-protein BLAST of the globin sequence GLB5_PETMA against the SWISSPROT database; write down the number of hits and the E value of the least significant hit. Now run PSI-Blast with the same sequence; write down the number of hits and E value of the least significant hit…

Entry EC 2.5.1.141                Enzyme                                  Name heme o synthase;ctaB (gene name);COX10 (gene name) Class Transferases;Transferring alkyl or aryl groups, other than methyl groups;Transferring alkyl or aryl groups, other than methyl groups (only sub-subclass identified to date)BRITE hierarchy Sysname (2E,6E)-farnesyl-diphosphate:protoheme IX farnesyltranstransferase Reaction(IUBMB) (2E,6E)-farnesyl diphosphate + protoheme IX + H2O = diphosphate + ferroheme…

Papillomaviruses are non-enveloped, double-stranded DNA (dsDNA) viruses with a circular genome. Infection with these viruses can lead to several clinical symptoms ranging from subclinical, cutaneous, and mucosal warts to cancerous lesions in vertebrate hosts.  A new study published in the journal Biology Letters identifies two novel lineages of papillomaviruses by mining…

Using the ExPASy translate tool, provide a protein translation of the following transcript sequence and indicate the size in nucleotides of: 1) the complete nucleotide sequence; 2) the 5’ untranslated region (UTR); 3) the 3’ UTR; and 4) the open reading frame (ORF; indicate which reading frame you selected). AATCTCTAGCTCGCTCGCGCTCCCTCTCCCCGGGCCGTGGAAAGGATCCCACTTCCGGTGGGGTGTCATG…

Transcribed image text: Discuss icosahedral structure in terms of triangulation (T) number. How does T number affect virion size, unit and subunit number? IF given T you need to be able to determine number of units and subunits. = Go to h and perform the T calculation for three other…

The gene expression of Mamu-E is regulated by extensive alternative splicing that is conserved among HLA-E isoforms To accurately define Mamu-E transcript structures, we aimed to use high-quality, full-length transcript sequences obtained by long-read transcriptome sequencing41. Since the sequences of MHC genes are very similar, it was critical that we…

Expasy is an online bioinformatics resource operated by the SIB Swiss Institute of Bioinformatics. It is an extensible and integrative portal which provides access to over 160 databases and software tools and supports a range of life science and clinical research areas, from genomics, proteomics and structural biology, to evolution…

In this tutorial we learn how to install libbio-db-swissprot-perl on Kali Linux. libbio-db-swissprot-perl is Database object interface to SwissProt retrieval Introduction In this tutorial we learn how to install libbio-db-swissprot-perl on Kali Linux. What is libbio-db-swissprot-perl SwissProt is a curated database of proteins managed by the Swiss Bioinformatics Institute. Additional…

Entry EC 1.14.19.32               Enzyme                                  Name palmitoyl-CoA 14-(E/Z)-desaturase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With oxidation of a pair of donors resulting in the reduction of O2 to two molecules of waterBRITE hierarchy Sysname palmitoyl-CoA,ferrocytochrome b5:oxygen oxidoreductase (14,15 cis/trans-dehydrogenating) Reaction(IUBMB) (1) palmitoyl-CoA + 2 ferrocytochrome b5 + O2…

KEGG ENZYME: 3.2.1.104     ENZYME: 3.2.1.104 Help Entry EC 3.2.1.104                Enzyme                                  Name Class Hydrolases;Glycosylases;Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compoundsBRITE hierarchy Sysname cholesteryl-beta-D-glucoside glucohydrolase Reaction(IUBMB) cholesteryl-beta-D-glucoside + H2O = D-glucose + cholesterol [RN:R01460] Reaction(KEGG) Substrate Product Comment Acts on glucosides of cholesterol and sitosterol, but not on some related sterols…

( EXPASY according to translating protein sequence) 1- Translate the following unknown sequence to amino acid sequence. Appropriately label amino acid sequences to indicate reading and open reading frames.Unknown sequence: 2- How did you determine which one is the correct reading frame? GGAGAGGTGGAGCCGGTTGCCGGGCCGGGAACATGAGGCAGTGTGCGCTCTTCCTGACCAGCTTGGTTCCTATCGTG CTGGCGCCGCGACCGCCGGACGAGCCGGGCTTCGGCTCCCCTCAGCGACTCGAAAAGCTTGATTCTCTGCTCTCAGA CTACGACATCCTCTCTTTATCCAGCATTCGCCAGCACTCCGTAAGGAAAAGGGATCTGCAGGCCTCAACACACCTAG AGACACTACTAACTTTTTCAGCCTTGAACAGGCATTTTAAATTATACCTGACATCAAGTACTGAACGCTTCTCCCAG AATTTCAAAGTCGTGGTGGTCGATGGGGAAGATGAAAGTGAGTACCCCGTCAAGTGGCAGGACTTCTTCAGTGGACA CGTGGTTGGTGAACCTGACTCTAGGGTTCTCGCCCACATAGGAGATGATGATATTACAGTAAGAATCAACACAGATG GGGCAGAATATAATATAGAGCCACTTTGGAGACTAATTAATGATACTAAAGACAAAAGAGTGTTAGTTTATAAGTCT GAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATATAAAGGCGGATAATGAAGAGTTGCT…

Price: €675.00 (Size: 150 µg) Click on the image to see the image legend shRNA Plasmid to inhibit GSTO2 expression by RNA interference. This product contains 3 separate slightly different shRNA sequences which knock down human GSTO2 gene specifically. Each vial contains 50 μg of lyophilized shRNA. Target GSTO2 Reactivity…

In which year was the first molecular biology server Expasy developed? – GKToday …

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see cleaver. Cleavage of polypeptide sequences Bioconductor version: 2.13 In-silico cleavage of polypeptide sequences. The cleavage rules are taken from: web.expasy.org/peptide_cutter/peptidecutter_enzymes.html Author: Sebastian Gibb [aut, cre] Maintainer: Sebastian Gibb <mail at sebastiangibb.de> Citation (from…

Expasy is an online bioinformatics resource operated by the SIB Swiss Institute of Bioinformatics. It is an extensible and integrative portal which provides access to over 160 databases and software tools and supports a range of life science and clinical research areas, from genomics, proteomics and structural biology, to evolution…

Entry EC 1.14.14.86               Enzyme                                  Name ent-kaurene monooxygenase;ent-kaurene oxidase (misleading) Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname ent-kaur-16-ene,[reduced NADPH—hemoprotein reductase]:oxygen oxidoreductase (hydroxylating) Reaction(IUBMB) ent-kaur-16-ene + 3 [reduced NADPH—hemoprotein…

Can an enzyme have multiple EC numbers? 2 Can an enzyme have multiple EC numbers? I have used run_dbcan and taken the hotpep output to identify all carbohydrate active enzymes in my metagenomic sample. I have more unique EC numbers than enzymes in the output when those EC numbers are…

Hi there, confused student. I’ve been using expasy translate to convert two nucleotide sequences into protein where I can then see open reading frames. By then using uniprot clustalO I hoped to paste the open reading frames for both sequences and align them to spot any differences between the two….

Listing Results Biopython Contact Map Protein Contact Maps using Biopython Warwick 9 hours ago Warwick.ac.uk View All Protein Contact Maps using Biopython. When working with protein 3D structures, a contact map is usually defined as a binary matrix with the rows and columns representing the residues of two different chains….

In: StatPearls [Internet]. team at our virtual booth on the exhibitor tab. Published online 22 07; DOI: 10.1038/s41586-021-03819-2. Extended Data Fig. Found insideAn important feature of this work is the S-plus subroutines provided for analyzing actual data sets. Coupled with the discussion of new theoretical research, the book should benefit…

Entry EC 4.2.1.128                Enzyme                                  Name lupan-3beta,20-diol synthase;LUP1 (gene name) Class Lyases;Carbon-oxygen lyases;Hydro-lyasesBRITE hierarchy Sysname (3S)-2,3-epoxy-2,3-dihydrosqualene hydro-lyase (lupan-3beta,20-diol-forming) Reaction(IUBMB) lupan-3beta,20-diol = (3S)-2,3-epoxy-2,3-dihydrosqualene + H2O [RN:R09743] Reaction(KEGG) Substrate lupan-3beta,20-diol [CPD:C19863] Product (3S)-2,3-epoxy-2,3-dihydrosqualene [CPD:C01054]; H2O [CPD:C00001] Comment The reaction occurs in the reverse direction. The recombinant enzyme from Arabidopsis thaliana gives a 1:1 mixture of…