Tag: ExPASy

EnWik > Expasy

Expasy is an online bioinformatics resource operated by the SIB Swiss Institute of Bioinformatics. It is an extensible and integrative portal which provides access to over 160 databases and software tools and supports a range of life science and clinical research areas, from genomics, proteomics and structural biology, to evolution…

Continue Reading EnWik > Expasy

How To Install libbio-db-swissprot-perl on Kali Linux

In this tutorial we learn how to install libbio-db-swissprot-perl on Kali Linux. libbio-db-swissprot-perl is Database object interface to SwissProt retrieval Introduction In this tutorial we learn how to install libbio-db-swissprot-perl on Kali Linux. What is libbio-db-swissprot-perl SwissProt is a curated database of proteins managed by the Swiss Bioinformatics Institute. Additional…

Continue Reading How To Install libbio-db-swissprot-perl on Kali Linux

KEGG ENZYME: 1.14.19.32

Entry EC 1.14.19.32               Enzyme                                  Name palmitoyl-CoA 14-(E/Z)-desaturase Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With oxidation of a pair of donors resulting in the reduction of O2 to two molecules of waterBRITE hierarchy Sysname palmitoyl-CoA,ferrocytochrome b5:oxygen oxidoreductase (14,15 cis/trans-dehydrogenating) Reaction(IUBMB) (1) palmitoyl-CoA + 2 ferrocytochrome b5 + O2…

Continue Reading KEGG ENZYME: 1.14.19.32

KEGG ENZYME: 3.2.1.104

KEGG ENZYME: 3.2.1.104     ENZYME: 3.2.1.104 Help Entry EC 3.2.1.104                Enzyme                                  Name Class Hydrolases;Glycosylases;Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compoundsBRITE hierarchy Sysname cholesteryl-beta-D-glucoside glucohydrolase Reaction(IUBMB) cholesteryl-beta-D-glucoside + H2O = D-glucose + cholesterol [RN:R01460] Reaction(KEGG) Substrate Product Comment Acts on glucosides of cholesterol and sitosterol, but not on some related sterols…

Continue Reading KEGG ENZYME: 3.2.1.104

Solved ( EXPASY according to translating

( EXPASY according to translating protein sequence) 1- Translate the following unknown sequence to amino acid sequence. Appropriately label amino acid sequences to indicate reading and open reading frames.Unknown sequence: 2- How did you determine which one is the correct reading frame? GGAGAGGTGGAGCCGGTTGCCGGGCCGGGAACATGAGGCAGTGTGCGCTCTTCCTGACCAGCTTGGTTCCTATCGTG CTGGCGCCGCGACCGCCGGACGAGCCGGGCTTCGGCTCCCCTCAGCGACTCGAAAAGCTTGATTCTCTGCTCTCAGA CTACGACATCCTCTCTTTATCCAGCATTCGCCAGCACTCCGTAAGGAAAAGGGATCTGCAGGCCTCAACACACCTAG AGACACTACTAACTTTTTCAGCCTTGAACAGGCATTTTAAATTATACCTGACATCAAGTACTGAACGCTTCTCCCAG AATTTCAAAGTCGTGGTGGTCGATGGGGAAGATGAAAGTGAGTACCCCGTCAAGTGGCAGGACTTCTTCAGTGGACA CGTGGTTGGTGAACCTGACTCTAGGGTTCTCGCCCACATAGGAGATGATGATATTACAGTAAGAATCAACACAGATG GGGCAGAATATAATATAGAGCCACTTTGGAGACTAATTAATGATACTAAAGACAAAAGAGTGTTAGTTTATAAGTCT GAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATATAAAGGCGGATAATGAAGAGTTGCT…

Continue Reading Solved ( EXPASY according to translating

Human GSTO2 shRNA Plasmid | Abbexa Ltd

Price: €675.00 (Size: 150 µg) Click on the image to see the image legend shRNA Plasmid to inhibit GSTO2 expression by RNA interference. This product contains 3 separate slightly different shRNA sequences which knock down human GSTO2 gene specifically. Each vial contains 50 μg of lyophilized shRNA. Target GSTO2 Reactivity…

Continue Reading Human GSTO2 shRNA Plasmid | Abbexa Ltd

Bioconductor – cleaver

    This package is for version 2.13 of Bioconductor; for the stable, up-to-date release version, see cleaver. Cleavage of polypeptide sequences Bioconductor version: 2.13 In-silico cleavage of polypeptide sequences. The cleavage rules are taken from: web.expasy.org/peptide_cutter/peptidecutter_enzymes.html Author: Sebastian Gibb [aut, cre] Maintainer: Sebastian Gibb <mail at sebastiangibb.de> Citation (from…

Continue Reading Bioconductor – cleaver

Expasy – Wikipedia @ WordDisk

Expasy is an online bioinformatics resource operated by the SIB Swiss Institute of Bioinformatics. It is an extensible and integrative portal which provides access to over 160 databases and software tools and supports a range of life science and clinical research areas, from genomics, proteomics and structural biology, to evolution…

Continue Reading Expasy – Wikipedia @ WordDisk

KEGG ENZYME: 1.14.14.86

Entry EC 1.14.14.86               Enzyme                                  Name ent-kaurene monooxygenase;ent-kaurene oxidase (misleading) Class Oxidoreductases;Acting on paired donors, with incorporation or reduction of molecular oxygen;With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donorBRITE hierarchy Sysname ent-kaur-16-ene,[reduced NADPH—hemoprotein reductase]:oxygen oxidoreductase (hydroxylating) Reaction(IUBMB) ent-kaur-16-ene + 3 [reduced NADPH—hemoprotein…

Continue Reading KEGG ENZYME: 1.14.14.86

Can an enzyme have multiple EC numbers?

Can an enzyme have multiple EC numbers? 2 Can an enzyme have multiple EC numbers? I have used run_dbcan and taken the hotpep output to identify all carbohydrate active enzymes in my metagenomic sample. I have more unique EC numbers than enzymes in the output when those EC numbers are…

Continue Reading Can an enzyme have multiple EC numbers?

comparing and aligning two sequences to spot protein level differences using Expasy / Uniprot clustalO : bioinformatics

Hi there, confused student. I’ve been using expasy translate to convert two nucleotide sequences into protein where I can then see open reading frames. By then using uniprot clustalO I hoped to paste the open reading frames for both sequences and align them to spot any differences between the two….

Continue Reading comparing and aligning two sequences to spot protein level differences using Expasy / Uniprot clustalO : bioinformatics

Biopython Contact Map | Contact Information Finder

Listing Results Biopython Contact Map Protein Contact Maps using Biopython Warwick 9 hours ago Warwick.ac.uk View All Protein Contact Maps using Biopython. When working with protein 3D structures, a contact map is usually defined as a binary matrix with the rows and columns representing the residues of two different chains….

Continue Reading Biopython Contact Map | Contact Information Finder

highly accurate protein structure prediction with alphafold

In: StatPearls [Internet]. team at our virtual booth on the exhibitor tab. Published online 22 07; DOI: 10.1038/s41586-021-03819-2. Extended Data Fig. Found insideAn important feature of this work is the S-plus subroutines provided for analyzing actual data sets. Coupled with the discussion of new theoretical research, the book should benefit…

Continue Reading highly accurate protein structure prediction with alphafold

KEGG ORTHOLOGY: K15816

Entry EC 4.2.1.128                Enzyme                                  Name lupan-3beta,20-diol synthase;LUP1 (gene name) Class Lyases;Carbon-oxygen lyases;Hydro-lyasesBRITE hierarchy Sysname (3S)-2,3-epoxy-2,3-dihydrosqualene hydro-lyase (lupan-3beta,20-diol-forming) Reaction(IUBMB) lupan-3beta,20-diol = (3S)-2,3-epoxy-2,3-dihydrosqualene + H2O [RN:R09743] Reaction(KEGG) Substrate lupan-3beta,20-diol [CPD:C19863] Product (3S)-2,3-epoxy-2,3-dihydrosqualene [CPD:C01054]; H2O [CPD:C00001] Comment The reaction occurs in the reverse direction. The recombinant enzyme from Arabidopsis thaliana gives a 1:1 mixture of…

Continue Reading KEGG ORTHOLOGY: K15816