Tag: fastp

Package: fastp Version: 0.23.2+dfsg-1 Severity: normal Tags: ftbfs upstream patch User: debian-ri…@lists.debian.org Usertags: riscv64 Dear maintainer, fastp currently fails to build from source on riscv64: | g++ ./obj/adaptertrimmer.o ./obj/basecorrector.o ./obj/duplicate.o ./obj/evaluator.o ./obj/fastareader.o ./obj/fastqreader.o ./obj/filter.o ./obj/filterresult.o ./obj/htmlreporter.o ./obj/jsonreporter.o ./obj/main.o ./obj/nucleotidetree.o ./obj/options.o ./obj/overlapanalysis.o ./obj/peprocessor.o ./obj/polyx.o ./obj/processor.o ./obj/read.o ./obj/readpool.o ./obj/seprocessor.o ./obj/sequence.o ./obj/stats.o ./obj/threadconfig.o…

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Sat, 11 Dec 2021 16:48:03 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Andreas Tille <ti…@debian.org> Closes: 1001520 Changes: fastp (0.23.2+dfsg-2) unstable; urgency=medium . * Team upload. . [ Aurelien Jarno…

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Tue, 07 Dec 2021 22:34:23 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Dylan Aïssi <dai…@debian.org> Changes: fastp (0.23.2+dfsg-1) unstable; urgency=medium . * New upstream version Checksums-Sha1: ec111e7b906daea45f0d73214acf8e32a8e48a76 1968 fastp_0.23.2+dfsg-1.dsc fd0b6eb0418f668424b0dd74ea14b0252fd45c5b…

N50 is too short in de novo assembly 1 Hello, I am freshman of bioinformatics! I got illumina short reads (2×150bp) of a beetle, in which reference genome doesn’t exist. Pleas see below.Total sequences after trimming by fastp are about 320,000,000×2, and the genome size is estimated as about 530Mbp…

Forum:Do you need a deduplication tool for FASTQ data in fastp? 2 Hi, I am the author of fastp, a tool to provide ultra-fast all-in-one FASTQ preprocessing functions. This tool has received 500+ stars in github (github.com/OpenGene/fastp), and has been cited for 40+ times since its paper published in Bioinformatics…

News:fastp 0.22 released, with new FASTQ deduplication feature. 0 fastp is a fast all-in-one preprocessing tool for FASTQ data. Now a new version v0.22.0 has been released, with a FASTQ deduplication feature. Specify -D or –dedup to enable this option. fastp • 16 views • link 2 hours ago by…

project number: PRJNA505380 An example of Run accession: SRR8244780 Issue: Inconsistency between the library layout of Run and data source. As the library layout both in ENA and SRA labeled, Runs in Bioproject PRJNA505380 should be pair-end reads data. But some of them only have a single fastq and without…

Removal of host sequences without reference genome 1 Dear all, Suppose to have a collection of viral reads from NGS (Illumina) technology in fastq format. After the usual pre-processing step (addressed by fastp), I need to remove the host sequences (contaminants) without having the reference genome (I cannot use bowtie2…

MarkduplicatesSpark How to speed-up ? 0 Hello all, I would like to know if there is any good option to speed up MarkduplicatesSpark ? I work with human genome with arround 900 millions reads (151 bp). I work on a cluster (with slurm). The command that i used is (with…

So many variants detected. 0 Dear All, I have done variant calling in Germline data that has single sample of each individual and two genes. I did following steps, but after checking results I found too many variants. After Haplotypecaller (the step 6) I found 140900 known variants, and the…

Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…