Tag: fastp
Genetic characterization of two G8P[8] rotavirus strains isolated in Guangzhou, China, in 2020/21: evidence of genome reassortment | BMC Infectious Diseases
Mokomane M, Kasvosve I, Melo Ed, Pernica JM, Goldfarb DM. The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. Ther Adv Infect Dis. 2018;5(1):29–43. PubMed Google Scholar Organization WH. Rotavirus vaccines: WHO position paper–July 2021. Weekly Epidemiol Rec. 2021;96(28):301–219. Google Scholar Bucardo F, Reyes Y, Svensson…
Download FastP.A.Y.E Free for Android – FastP.A.Y.E APK Download
FastP.A.Y.E is a financial wellbeing solution that facilitates flexible salary advances. It provides access to financial education, a benefits assessment calculator, and a host of other financial wellbeing tools. Access your hard earned pay quicker than ever with FastP.A.Y.E, the Ethical Financial Wellbeing app. We work with employers to help…
Reporting results from fastp Read GC content
Reporting results from fastp Read GC content 1 Hi, I have some QC results for a Paired end seq before and after filtering (Mouse samples). I am unable to interpret the plot Read GC content and I am not sure if the results are fine in this case. I am…
Strange Per base sequence content of fastqc
Hi, all! I download fastq.gz files of GSE162708 from ENA which only have 2 files of each sample(usually scRNA-seq has 3 files I1 , R1 & R2 ). Then I run fastp as following Then I get QC report , but I can’t understand why Per base sequence content of…
fasta MSA Sequence input/output stream
Bio::AlignIO::fasta(3) fasta MSA Sequence input/output stream SYNOPSIS Do not use this module directly. Use it via the Bio::AlignIO class. DESCRIPTION This object can transform Bio::SimpleAlign objects to and from fasta flat files. This is for the fasta alignment format, not for the FastA sequence analysis program. To process the alignments…
Phylogenomic analysis of Syngnathidae reveals novel relationships, origins of endemic diversity and variable diversification rates | BMC Biology
Stölting KN, Wilson AB. Male pregnancy in seahorses and pipefish: beyond the mammalian model. Bioessays. 2007;29:884–96. PubMed Google Scholar Whittington CM, Friesen CR. The evolution and physiology of male pregnancy in syngnathid fishes. Biol Rev Camb Philos Soc. 2020;95:1252–72. PubMed Google Scholar Rosenqvist G, Berglund A. Sexual signals and mating…
Fastp file merge append | Develop Paper
Interpretation of fastq file formatwww.jianshu.com/p/39115d21ee17 Sometimes, the sequencing results of a species will return two double ended fastps.r1.fq.gz l1.fq.gzr2.fq.gz l2.fq.gzThe content of sequencing data is actually one piece, but it is divided into two parts during transmission.When we use it, we are used to merging it into a double ended…
Genomic variation from an extinct species is retained in the extant radiation following speciation reversal
Vamosi, J. C., Magallon, S., Mayrose, I., Otto, S. P. & Sauquet, H. Macroevolutionary patterns of flowering plant speciation and extinction. Annu. Rev. Plant Biol. 69, 685–706 (2018). CAS PubMed Google Scholar Rhymer, J. M. & Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27, 83–109 (1996)….
Snakemake using multi inputs – Stackify
You need to define target output files using rule all. SAMPLES = [‘1’, ‘2’, ‘3’, ‘4’] rule all: input: expand(“sample{sample}.R{read_no}.fq.gz.out”, sample=SAMPLES, read_no=[‘1’, ‘2’]) rule fastp: input: reads1=”sample{sample}.R1.fq.gz”, reads2=”sample{sample}.R2.fq.gz” output: reads1out=”sample{sample}.R1.fq.gz.out”, reads2out=”sample{sample}.R2.fq.gz.out” shell: “fastp -i {input.reads1} -I {input.reads2} -o {output.reads1out} -O {output.reads2out}” This is the output of command snakemake -np, with…
FTBFS on riscv64, linked with -lpthread instead of -pthread
Package: fastp Version: 0.23.2+dfsg-1 Severity: normal Tags: ftbfs upstream patch User: debian-ri…@lists.debian.org Usertags: riscv64 Dear maintainer, fastp currently fails to build from source on riscv64: | g++ ./obj/adaptertrimmer.o ./obj/basecorrector.o ./obj/duplicate.o ./obj/evaluator.o ./obj/fastareader.o ./obj/fastqreader.o ./obj/filter.o ./obj/filterresult.o ./obj/htmlreporter.o ./obj/jsonreporter.o ./obj/main.o ./obj/nucleotidetree.o ./obj/options.o ./obj/overlapanalysis.o ./obj/peprocessor.o ./obj/polyx.o ./obj/processor.o ./obj/read.o ./obj/readpool.o ./obj/seprocessor.o ./obj/sequence.o ./obj/stats.o ./obj/threadconfig.o…
Accepted fastp 0.23.2+dfsg-2 (source) into unstable
—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Sat, 11 Dec 2021 16:48:03 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Andreas Tille <ti…@debian.org> Closes: 1001520 Changes: fastp (0.23.2+dfsg-2) unstable; urgency=medium . * Team upload. . [ Aurelien Jarno…
Accepted fastp 0.23.2+dfsg-1 (source) into unstable
—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Tue, 07 Dec 2021 22:34:23 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Dylan Aïssi <dai…@debian.org> Changes: fastp (0.23.2+dfsg-1) unstable; urgency=medium . * New upstream version Checksums-Sha1: ec111e7b906daea45f0d73214acf8e32a8e48a76 1968 fastp_0.23.2+dfsg-1.dsc fd0b6eb0418f668424b0dd74ea14b0252fd45c5b…
N50 is too short in de novo assembly
N50 is too short in de novo assembly 1 Hello, I am freshman of bioinformatics! I got illumina short reads (2×150bp) of a beetle, in which reference genome doesn’t exist. Pleas see below.Total sequences after trimming by fastp are about 320,000,000×2, and the genome size is estimated as about 530Mbp…
Do you need a deduplication tool for FASTQ data in fastp?
Forum:Do you need a deduplication tool for FASTQ data in fastp? 2 Hi, I am the author of fastp, a tool to provide ultra-fast all-in-one FASTQ preprocessing functions. This tool has received 500+ stars in github (github.com/OpenGene/fastp), and has been cited for 40+ times since its paper published in Bioinformatics…
fastp 0.22 released, with new FASTQ deduplication feature.
News:fastp 0.22 released, with new FASTQ deduplication feature. 0 fastp is a fast all-in-one preprocessing tool for FASTQ data. Now a new version v0.22.0 has been released, with a FASTQ deduplication feature. Specify -D or –dedup to enable this option. fastp • 16 views • link 2 hours ago by…
SRA/ENA library layout is inconsistent with the data source
project number: PRJNA505380 An example of Run accession: SRR8244780 Issue: Inconsistency between the library layout of Run and data source. As the library layout both in ENA and SRA labeled, Runs in Bioproject PRJNA505380 should be pair-end reads data. But some of them only have a single fastq and without…
Removal of host sequences without reference genome
Removal of host sequences without reference genome 1 Dear all, Suppose to have a collection of viral reads from NGS (Illumina) technology in fastq format. After the usual pre-processing step (addressed by fastp), I need to remove the host sequences (contaminants) without having the reference genome (I cannot use bowtie2…
MarkduplicatesSpark How to speed-up ?
MarkduplicatesSpark How to speed-up ? 0 Hello all, I would like to know if there is any good option to speed up MarkduplicatesSpark ? I work with human genome with arround 900 millions reads (151 bp). I work on a cluster (with slurm). The command that i used is (with…
So many variants detected.
So many variants detected. 0 Dear All, I have done variant calling in Germline data that has single sample of each individual and two genes. I did following steps, but after checking results I found too many variants. After Haplotypecaller (the step 6) I found 140900 known variants, and the…
illumina adapter specifying and removing using fastp
Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…
