Tag: fastp

Genetic characterization of two G8P[8] rotavirus strains isolated in Guangzhou, China, in 2020/21: evidence of genome reassortment | BMC Infectious Diseases

Mokomane M, Kasvosve I, Melo Ed, Pernica JM, Goldfarb DM. The global problem of childhood diarrhoeal diseases: emerging strategies in prevention and management. Ther Adv Infect Dis. 2018;5(1):29–43. PubMed  Google Scholar  Organization WH. Rotavirus vaccines: WHO position paper–July 2021. Weekly Epidemiol Rec. 2021;96(28):301–219. Google Scholar  Bucardo F, Reyes Y, Svensson…

Continue Reading Genetic characterization of two G8P[8] rotavirus strains isolated in Guangzhou, China, in 2020/21: evidence of genome reassortment | BMC Infectious Diseases

Download FastP.A.Y.E Free for Android – FastP.A.Y.E APK Download

FastP.A.Y.E is a financial wellbeing solution that facilitates flexible salary advances. It provides access to financial education, a benefits assessment calculator, and a host of other financial wellbeing tools. Access your hard earned pay quicker than ever with FastP.A.Y.E, the Ethical Financial Wellbeing app. We work with employers to help…

Continue Reading Download FastP.A.Y.E Free for Android – FastP.A.Y.E APK Download

Reporting results from fastp Read GC content

Reporting results from fastp Read GC content 1 Hi, I have some QC results for a Paired end seq before and after filtering (Mouse samples). I am unable to interpret the plot Read GC content and I am not sure if the results are fine in this case. I am…

Continue Reading Reporting results from fastp Read GC content

Strange Per base sequence content of fastqc

Hi, all! I download fastq.gz files of GSE162708 from ENA which only have 2 files of each sample(usually scRNA-seq has 3 files I1 , R1 & R2 ). Then I run fastp as following Then I get QC report , but I can’t understand why Per base sequence content of…

Continue Reading Strange Per base sequence content of fastqc

fasta MSA Sequence input/output stream

Bio::AlignIO::fasta(3) fasta MSA Sequence input/output stream SYNOPSIS Do not use this module directly. Use it via the Bio::AlignIO class. DESCRIPTION This object can transform Bio::SimpleAlign objects to and from fasta flat files. This is for the fasta alignment format, not for the FastA sequence analysis program. To process the alignments…

Continue Reading fasta MSA Sequence input/output stream

Phylogenomic analysis of Syngnathidae reveals novel relationships, origins of endemic diversity and variable diversification rates | BMC Biology

Stölting KN, Wilson AB. Male pregnancy in seahorses and pipefish: beyond the mammalian model. Bioessays. 2007;29:884–96. PubMed  Google Scholar  Whittington CM, Friesen CR. The evolution and physiology of male pregnancy in syngnathid fishes. Biol Rev Camb Philos Soc. 2020;95:1252–72. PubMed  Google Scholar  Rosenqvist G, Berglund A. Sexual signals and mating…

Continue Reading Phylogenomic analysis of Syngnathidae reveals novel relationships, origins of endemic diversity and variable diversification rates | BMC Biology

Fastp file merge append | Develop Paper

Interpretation of fastq file formatwww.jianshu.com/p/39115d21ee17 Sometimes, the sequencing results of a species will return two double ended fastps.r1.fq.gz l1.fq.gzr2.fq.gz l2.fq.gzThe content of sequencing data is actually one piece, but it is divided into two parts during transmission.When we use it, we are used to merging it into a double ended…

Continue Reading Fastp file merge append | Develop Paper

Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

Vamosi, J. C., Magallon, S., Mayrose, I., Otto, S. P. & Sauquet, H. Macroevolutionary patterns of flowering plant speciation and extinction. Annu. Rev. Plant Biol. 69, 685–706 (2018). CAS  PubMed  Google Scholar  Rhymer, J. M. & Simberloff, D. Extinction by hybridization and introgression. Annu. Rev. Ecol. Syst. 27, 83–109 (1996)….

Continue Reading Genomic variation from an extinct species is retained in the extant radiation following speciation reversal

Snakemake using multi inputs – Stackify

You need to define target output files using rule all. SAMPLES = [‘1’, ‘2’, ‘3’, ‘4’] rule all: input: expand(“sample{sample}.R{read_no}.fq.gz.out”, sample=SAMPLES, read_no=[‘1’, ‘2’]) rule fastp: input: reads1=”sample{sample}.R1.fq.gz”, reads2=”sample{sample}.R2.fq.gz” output: reads1out=”sample{sample}.R1.fq.gz.out”, reads2out=”sample{sample}.R2.fq.gz.out” shell: “fastp -i {input.reads1} -I {input.reads2} -o {output.reads1out} -O {output.reads2out}” This is the output of command snakemake -np, with…

Continue Reading Snakemake using multi inputs – Stackify

FTBFS on riscv64, linked with -lpthread instead of -pthread

Package: fastp Version: 0.23.2+dfsg-1 Severity: normal Tags: ftbfs upstream patch User: debian-ri…@lists.debian.org Usertags: riscv64 Dear maintainer, fastp currently fails to build from source on riscv64: | g++ ./obj/adaptertrimmer.o ./obj/basecorrector.o ./obj/duplicate.o ./obj/evaluator.o ./obj/fastareader.o ./obj/fastqreader.o ./obj/filter.o ./obj/filterresult.o ./obj/htmlreporter.o ./obj/jsonreporter.o ./obj/main.o ./obj/nucleotidetree.o ./obj/options.o ./obj/overlapanalysis.o ./obj/peprocessor.o ./obj/polyx.o ./obj/processor.o ./obj/read.o ./obj/readpool.o ./obj/seprocessor.o ./obj/sequence.o ./obj/stats.o ./obj/threadconfig.o…

Continue Reading FTBFS on riscv64, linked with -lpthread instead of -pthread

Accepted fastp 0.23.2+dfsg-2 (source) into unstable

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA256 Format: 1.8 Date: Sat, 11 Dec 2021 16:48:03 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Andreas Tille <ti…@debian.org> Closes: 1001520 Changes: fastp (0.23.2+dfsg-2) unstable; urgency=medium . * Team upload. . [ Aurelien Jarno…

Continue Reading Accepted fastp 0.23.2+dfsg-2 (source) into unstable

Accepted fastp 0.23.2+dfsg-1 (source) into unstable

—–BEGIN PGP SIGNED MESSAGE—– Hash: SHA512 Format: 1.8 Date: Tue, 07 Dec 2021 22:34:23 +0100 Source: fastp Architecture: source Version: 0.23.2+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag…@lists.alioth.debian.org> Changed-By: Dylan Aïssi <dai…@debian.org> Changes: fastp (0.23.2+dfsg-1) unstable; urgency=medium . * New upstream version Checksums-Sha1: ec111e7b906daea45f0d73214acf8e32a8e48a76 1968 fastp_0.23.2+dfsg-1.dsc fd0b6eb0418f668424b0dd74ea14b0252fd45c5b…

Continue Reading Accepted fastp 0.23.2+dfsg-1 (source) into unstable

N50 is too short in de novo assembly

N50 is too short in de novo assembly 1 Hello, I am freshman of bioinformatics! I got illumina short reads (2×150bp) of a beetle, in which reference genome doesn’t exist. Pleas see below.Total sequences after trimming by fastp are about 320,000,000×2, and the genome size is estimated as about 530Mbp…

Continue Reading N50 is too short in de novo assembly

Do you need a deduplication tool for FASTQ data in fastp?

Forum:Do you need a deduplication tool for FASTQ data in fastp? 2 Hi, I am the author of fastp, a tool to provide ultra-fast all-in-one FASTQ preprocessing functions. This tool has received 500+ stars in github (github.com/OpenGene/fastp), and has been cited for 40+ times since its paper published in Bioinformatics…

Continue Reading Do you need a deduplication tool for FASTQ data in fastp?

fastp 0.22 released, with new FASTQ deduplication feature.

News:fastp 0.22 released, with new FASTQ deduplication feature. 0 fastp is a fast all-in-one preprocessing tool for FASTQ data. Now a new version v0.22.0 has been released, with a FASTQ deduplication feature. Specify -D or –dedup to enable this option. fastp • 16 views • link 2 hours ago by…

Continue Reading fastp 0.22 released, with new FASTQ deduplication feature.

SRA/ENA library layout is inconsistent with the data source

project number: PRJNA505380 An example of Run accession: SRR8244780 Issue: Inconsistency between the library layout of Run and data source. As the library layout both in ENA and SRA labeled, Runs in Bioproject PRJNA505380 should be pair-end reads data. But some of them only have a single fastq and without…

Continue Reading SRA/ENA library layout is inconsistent with the data source

Removal of host sequences without reference genome

Removal of host sequences without reference genome 1 Dear all, Suppose to have a collection of viral reads from NGS (Illumina) technology in fastq format. After the usual pre-processing step (addressed by fastp), I need to remove the host sequences (contaminants) without having the reference genome (I cannot use bowtie2…

Continue Reading Removal of host sequences without reference genome

MarkduplicatesSpark How to speed-up ?

MarkduplicatesSpark How to speed-up ? 0 Hello all, I would like to know if there is any good option to speed up MarkduplicatesSpark ? I work with human genome with arround 900 millions reads (151 bp). I work on a cluster (with slurm). The command that i used is (with…

Continue Reading MarkduplicatesSpark How to speed-up ?

So many variants detected.

So many variants detected. 0 Dear All, I have done variant calling in Germline data that has single sample of each individual and two genes. I did following steps, but after checking results I found too many variants. After Haplotypecaller (the step 6) I found 140900 known variants, and the…

Continue Reading So many variants detected.

illumina adapter specifying and removing using fastp

Dear all, Recently, I have been asked to do preprocessing of some fastq files produced by Illumina (I don’t know which machine produced data). This is information of a fastq file (forward); @A00957:111:H5MTHDSX2:3:1101:2718:1063 1:N:0:TCCGCGAA+AGGCTATA CTGACCTCAAGTGATCTACCCACCTCGGTCTCCCAAAGTGCTGGGATTACAGGCAGGAGCCACTGCCCCTGGCCCTAATCATAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGGCGTCTGCTTGAAA when I asked adapter sequences from the company, they provided me them as D710-501 TCCGCGAATATAGCCT…

Continue Reading illumina adapter specifying and removing using fastp