Tag: fastp

../ fastp_0.20.0+dfsg-1build1.debian.tar.xz 22-Mar-2020 16:49 3892 fastp_0.20.0+dfsg-1build1.dsc 22-Mar-2020 16:49 2004 fastp_0.20.0+dfsg-1build1_amd64.deb 22-Mar-2020 17:11 191764 fastp_0.20.0+dfsg.orig.tar.xz 22-Jul-2019 17:13 64664 fastp_0.20.1+dfsg-1.debian.tar.xz 27-Apr-2020 19:01 3940 fastp_0.20.1+dfsg-1.dsc 27-Apr-2020 19:01 1961 fastp_0.20.1+dfsg-1_amd64.deb 27-Apr-2020 20:21 192944 fastp_0.20.1+dfsg.orig.tar.xz 27-Apr-2020 19:01 64864 fastp_0.23.2+dfsg-2.debian.tar.xz 11-Dec-2021 23:24 8476 fastp_0.23.2+dfsg-2.dsc 11-Dec-2021 23:24 1993 fastp_0.23.2+dfsg-2_amd64.deb 11-Dec-2021 23:24 172754 fastp_0.23.2+dfsg.orig.tar.xz 08-Dec-2021 05:28 82224 …

Cho, C. et al. Haploinsufficiency of protamine-1 or-2 causes infertility in mice. Nat. Genet. 28, 82–86 (2001). Article  CAS  PubMed  Google Scholar  Oliva, R. Protamines and male infertility. Hum. Reprod. Update 12, 417–435 (2006). Article  CAS  PubMed  Google Scholar  Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biol….

Bacteria Strain Cori.ST1911 was isolated from fresh stool of 20-week-old C57/BL6J mice fed a HFD at the Animal Center of the West China Hospital of Sichuan University. Briefly, faecal particles were ground with a glass grinding rod and suspended in sterile phosphate-buffered saline (PBS). After gradient dilution, the suspension was…

Hu T, Chitnis N, Monos D, Dinh A. Next-generation sequencing technologies: an overview. Hum Immunol. 2021;82(11):801–11. Article  CAS  Google Scholar  Jeon SA, Park JL, Park SJ, Kim JH, Goh SH, Han JY, Kim SY. Comparison between MGI and Illumina sequencing platforms for whole genome sequencing. Genes Genomics. 2021;43(7):713–24. Article  CAS …

How to trim miRNA reads? 1 Hi there, I am new to bioinformatics. I am trying to prepare fasta.gz files for uploading onto CPSS, a websever for miRNA-seq datasets. My data is from Gene Omnibus db. Basically the sample fasta file appears like this: ;>SRR1658346.1 HISEQ1:187:D0NWFACXX:3:1101:2565:2050 length=51 ATCATACAAGGACAATTTCTTTTAACGTCGTATGCCGTCTTCTGCTTGNAA >SRR1658346.2 HISEQ1:187:D0NWFACXX:3:1101:2654:2232…

Introduction Sepsis is one of the major diseases that poses a serious threat to human health, and its incidence and in-hospital mortality rates remain high despite the continuous updating of sepsis guidelines.1 Its main clinical manifestations are elevated body temperature, chills, and rapid heart rate, and it is most common…

Why does the Pair-End RNA library exhibit a significant disparity between the mapping results of R2 compared to R1? 0 We conducted total mRNA RNA-seq using Illumina technology and encountered significant disparity in the mapping between R2 and R1. We are considering potential issues with trimming; we utilized FastQC and…

This is a guide for preparing for importing RNA-Seq FASTQ files to Subio Platform on a Mac computer. If you use a Windows10 machine, please go to the guide for Windows10. Subio Platform utilizes the following tools to process the RNA-Seq FASTQ files. fastp to trim adapters and filter low-quality…

Wang, A. L. & Wang, C. C. Viruses of the protozoa. Annu. Rev. Microbiol. 45, 251–263 (1991). Article  CAS  PubMed  Google Scholar  Banik, G., Stark, D., Rashid, H. & Ellis, J. Recent advances in molecular biology of parasitic viruses. Infect. Disord. – Drug Targets 14, 155–167 (2015). Article  Google Scholar …

Dobson, G. E. On a new genus and species of Rhinolophidae, with description of a new species of Vesperus, and notes on some other species of insectivorous bats from Persia. J. Asiat. Soc. Bengal. 40, 455–461 (1871). Google Scholar  Bates, P., Bumrungsri, S., Francis, C., Csorba, G. & Furey, N….

Pair ended short reads assemble to multiple references with a plasmid also inside 0 Hello, I am new to bioinformatics and am having trouble doing an assembly and alignment. First I will describe my sample data, I have Illumina MiSeq data of pair ended reads on a yeast organism. This…

Boukouvala, M. C. et al. Lymantria dispar (L.) (Lepidoptera: Erebidae): Current Status of Biology, Ecology, and Management in Europe with Notes from North America. Insects 13 (2022). Keena M. A., Richards, J. Y. Comparison of Survival and Development of Gypsy Moth Lymantria dispar L. (Lepidoptera: Erebidae) Populations from Different Geographic…

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. Article  PubMed  Google Scholar  Giaquinto AN, Sung H, Miller KD, Kramer JL, Newman LA,…

Wang, P. et al. The genome evolution and domestication of tropical fruit mango. Genome Biol 21 (2020). Tang, C. et al. The rubber tree genome reveals new insights into rubber production and species adaptation. Nat Plants 2 (2016). Bredeson, J. V. et al. Sequencing wild and cultivated cassava and related…

In a FastQ to BAM pipeline where only adapter trimming is performed, I’ve noticed a potential discrepancy in read counts between the initial FastQ files and their resulting BAM file. Specifically, I’m seeking clarification on whether the following statement holds true: “Total number of reads in R1 and R2 FastQ…

Introduction Rapidly advancing next generation sequencing technologies such as whole genome sequencing, genotyping-in-thousands by sequencing (GT-seq), and restriction-site-associated DNA sequencing (RAD-seq), are becoming more available and affordable for non-model organisms (Park & Kim, 2016; Ellegren, 2014; Van Wyngaarden et al., 2017; Bootsma et al., 2020). However, applying these technologies to…

Oppler Z, Keeffe K, McCoy K, Brisson D. Evolutionary genetics of Borrelia. Curr Issues Mol Biol. 2021;42:97–112. doi.org/10.21775/cimb.042.097.2. Article  PubMed  Google Scholar  Margos G, Fingerle V, Cutler S, Gofton A, Stevenson B, Estrada-Peña A. Controversies in bacterial taxonomy: the example of the genus Borrelia. Ticks Tick Borne Dis. 2020;11:101335. doi.org/10.1016/j.ttbdis.2019.101335….

Analysis of Roche KAPA Target Enrichment kit experimental data obtained on an Illumina sequencing system is most frequently performed using a variety of publicly available, open-source analysis tools. The typical variant calling analysis workflow consists of sequencing read quality assessment, read filtering, mapping against the reference genome, duplicate removal, coverage…

Parte AC, Sardà Carbasse J, Meier-Kolthoff JP, Reimer LC, Göker M. List of Prokaryotic names with standing in nomenclature (LPSN) moves to the DSMZ. Int J Syst Evol Microbiol. 2020;70:5607–12. Article  PubMed  PubMed Central  Google Scholar  Saxena AK, Kumar M, Chakdar H, Anuroopa N, Bagyaraj DJ. Bacillus species in soil…

Van Valen, L. A new evolutionary law. Evol. Theory 1, 1–30 (1973). Google Scholar  Woolhouse, M. E. J., Webster, J. P., Domingo, E., Charlesworth, B. & Levin, B. R. Biological and biomedical implications of the co-evolution of pathogens and their hosts. Nat. Genet. 32, 569–577 (2002). Article  CAS  PubMed  Google…

Commission, S. P. Pharmacopoeia of the People’s Republic of China (Pharmacopoeia of the People’s Republic of China, 2020). Google Scholar  Sun, X. & Sun, F. Shennong Materia Medica Classic (People’s Health Publishing House, 1963). Google Scholar  Huang, C. Flora of China Vol. 43 (Science Press, 1997). Google Scholar  Hu, J….

I ran Jellyfish > zcat V*_R1.fastp.fq.gz | jellyfish count -t 2 -C -m 21 -s 5G –quality-start=33 -o reads.jf > cat reads.jf 000001535{“alignment”:8,”canonical”:true,”cmdline”:[“count”,”-t”,”2″,”-C”,”-m”,”21″,”-s”,”5G”,”–quality-start=33″,”-o”,”reads.jf”],”counter_len”:4,”exe_path”:”/mnt/hpccs01/work/x/miniconda2/envs/jellyfish/bin/jellyfish”,”format”:”binary/sorted”,”hostname”:”cl5n014″,”key_len”:42,”matrix1″:{“c”:42,”columns”:[7114389000,2192333556,7375600293,3957177567,1753639420,5791419737,7660672264,3955008356,2531272710,4865888693,6095688361,6974692332,2128614574,2258809230,885814170,1703365744,5945426963,375951490,7217126865,6145592432,7418978358,2071372677,3810558711,7150470371,5456096994,5475478,7949231332,5100019741,6318414384,7141154869,3543742516,6024410566,5605745954,575704984,8124532068,1053004640,2675922405,1674046033,5535382637,1853889752,1425936082,3907867046],”identity”:false,”r”:33},”max_reprobe”:126,”pwd”:”/mnt/hpccs01/scratch/x/y/fastpDNA”,”reprobes”:[1,1,3,6,10,15,21,28,36,45,55,66,78,91,105,120,136,153,171,190,210,231,253,276,300,325,351,378,406,435,465,496,528,561,595,630,666,703,741,780,820,861,903,946,990,1035,1081,1128,1176,1225,1275,1326,1378,1431,1485,1540,1596,1653,1711,1770,1830,1891,1953,2016,2080,2145,2211,2278,2346,2415,2485,2556,2628,2701,2775,2850,2926,3003,3081,3160,3240,3321,3403,3486,3570,3655,3741,3828,3916,4005,4095,4186,4278,4371,4465,4560,4656,4753,4851,4950,5050,5151,5253,5356,5460,5565,5671,5778,5886,5995,6105,6216,6328,6441,6555,6670,6786,6903,7021,7140,7260,7381,7503,7626,7750,7875,8001],”size”:8589934592,”time”:”Wed Nov 22 14:46:48 2023″,”val_len”:7} However, when I ran jellyfish histo -t 2 reads.jf > reads.histo. The output is empty. What did I miss? Read more here: Source…

Jellyfish problem with Failed to open input file ‘reads.jf’ 0 Hi, I can’t get jellyfish running with two different ways: Method 1 jellyfish count -t 10 -C -m 21 -s 10G –quality-start=33 -o reads.jf <(zcat V350181330_L03_R1.fastp.fq.gz) <(zcat V350181330_L04_R1.fastp.fq.gz) 26897 Killed jellyfish count -t 10 -C -m 21 -s 10G –quality-start=33…

Microbial community profiling using 16S rRNA amplicon sequencing allows for taxonomic characterization of diverse microorganisms. While amplicon sequence variant (ASV) methods are increasingly favored for their fine-grained resolution of sequence variants, they often discard substantial portions of sequencing reads during quality control, particularly in datasets with large number samples. We…

RNA star taking more than 24h to complete 2nd pass 0 Hello all, I am very new to star alignment and rna seq in general. I have 20 mouse rna bulk samples which I am trying to align to a reference genome, after performing QC filtering and trimming. To align,…

Trimming pair end fastq files merged not interleaved 1 Hello, I have a set of fastq files from BGI data that I want to trimm from adapters. They are paired end, but I don’t have two files per library, but one: The forward and reverse reads are in the same…

Quality filtering prior to pseudoalignment 0 Hi, I have often read (and anecdotally confirmed) that adapter removal, quality trimming and such are not necessary for simple estimation of transcript relative abundance in a pseudoalignment framework. My tool of choice is Kallisto, and I am doing bulk RNAseq on a NextSeq,…

mvdbeek November 10, 2023, 9:13am 1 Is it possible to catch expressions that access (potentially) undefined variables before runtime ? Take as an example the following diff as applied to github.com/common-workflow-library/bio-cwl-tools/blob/91c42fb809ce18eafe16155cca0abf362270c0fe/fastp/fastp.cwl: diff –git a/fastp/fastp.cwl b/fastp/fastp.cwl index 575c91f..b6be4eb 100755 — a/fastp/fastp.cwl +++ b/fastp/fastp.cwl @@ -19,7 +19,7 @@ baseCommand: fastp arguments: -…

1. Introduction Cervical cancer (CC) is the third most common cancer in women worldwide and has a high mortality rate among women. In 2008, CC was responsible for 275,000 deaths, thereby being the fourth leading cause of cancer death in females worldwide.[1,2] In China, CC is the second most…

Aizawa M, Yoshimaru H, Saito H, Katsuki T, Kawahara T, Kitamura K et al. (2009) Range‐wide genetic structure in a north‐east Asian spruce (Picea jezoensis) determined using nuclear microsatellite markers. J Biogeogr 36(5):996–1007 Article  Google Scholar  Alexander DH, Novembre J, Lange K (2009) Fast model-based estimation of ancestry in unrelated…

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. Article  PubMed  Google Scholar  Llovet JM, Kelley RK, Villanueva A, Singal AG, Pikarsky E,…

Introduction The microbiomes of different host organisms are currently described by using culture-independent sequencing methods (Harvey & Holmes, 2022). Shotgun metagenomic and 16S rDNA sequencing methods are commonly used to identify the taxonomic composition of microbial communities in several studies (de Melo et al., 2020; Mackelprang et al., 2011; Monaco…

I have followed the steps you outlined previously, but I’m encountering errors with both methods, whether I’m using Singularity or running it locally. COMMAND USED FOR MOUNTING: singularity exec -e -B /home/sklab/simran/star_run/library/ctat_genome_lib_build_dir/:/ctat_genome_lib trinityfusion.v0.4.0.simg /usr/local/src/TrinityFusion/CTAT-LR-fusion/ctat-LR-fusion –prep_reference_only -T long_read.fastq(fake)–genome_lib_dir /home/sklab/simran/star_run/library/ctat_genome_lib_build_dir/ COMMAND USED FOR RUNNING SAMPLE: singularity exec -e -B ~/simran/star_run/library/ctat_genome_lib_build_dir/:/ctat_genome_lib_build_dir…

Bacterial strains and phages Escherichia coli DH5a was routinely grown in Lysogeny broth (LB) medium and used for plasmid cloning, while E. coli BL21 (DE3) was used for protein production and the in vivo assays. E. coli phages T5, T7 and Lambda-vir are gifts from Shi Chen lab (Wuhan University,…

Zack TI, Schumacher SE, Carter SL, Cherniack AD, Saksena G, Tabak B, Lawrence MS, Zhang C-Z, Wala J, Mermel CH. Pan-cancer patterns of somatic copy number alteration. Nat Genet. 2013;45:1134–40. Article  CAS  PubMed  PubMed Central  Google Scholar  Dixon JR, Xu J, Dileep V, Zhan Y, Song F, Le VT, Yardımcı…

2.97 880 reviews 100,000+Downloads Free Winner Winner Chicken Dinner With Extreme FPS – Smooth Extreme – HDR 60 Fps We currently don’t have an APK download for this app About FastP – Smooth Extreme 60 Fps HDR+ GFX Tool FastP – Smooth Extreme 60 Fps HDR+ GFX Tool is a…

Sachs JL, Ehinger MO, Simms EL. Origins of cheating and loss of symbiosis in wild Bradyrhizobium. J Evol Biol. 2010;23:1075-89. Carrow HC, Batachari LE, Chu H. Strain diversity in the microbiome: Lessons from Bacteroides fragilis. PLoS Pathog. 2020;16:e1009056. Article  CAS  PubMed  PubMed Central  Google Scholar  Martinez J, Tolosana I, Ok…

Introduction Antimicrobial resistance is a hidden global pandemic that shattered over 4.9 million people in 2019 alone, and the burden is highest, mainly in low-resource settings.1 Drug-resistant tuberculosis (DR-TB) caused by Mycobacterium tuberculosis (Mtb) complex (MTBC), which is resistant to one or more anti-TB drugs, is a leading global public…

Wyles, J. S., Kunkel, J. G. & Wilson, A. C. Birds, behavior, and anatomical evolution. Proc. Natl Acad. Sci. 80, 4394–4397 (1983). Article  CAS  PubMed  PubMed Central  Google Scholar  Lapiedra, O., Sol, D., Carranza, S. & Beaulieu, J. M. Behavioural changes and the adaptive diversification of pigeons and doves. Proc….

        NGS Training Next Generation Sequencing (NGS), a recently evolved technology, have served a lot in the research and development sector of our society. NGS methods are highly parallelized enabling to sequence thousands to millions of molecules simultaneously. This technology results into huge amount of data, which…

Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11. Article  CAS  PubMed  PubMed Central  Google Scholar  Ogawa H, Amagai Y, Koike I, Kaiser K, Benner R. Production of refractory dissolved organic matter by bacteria. Science. 2001;292:917–20. Article  CAS  PubMed  Google Scholar  Liang…

Tutorial:NGS one-liner to call variants 0 This is a tutorial about creating a pipeline for sequence analysis in a single line. It is made for capture/amplicon short read sequencing in mind for human DNA and tested with reference exome sequencing data described here. I share the process and debuging steps…

Tutorial:NGS oneliner 0 This is a tutorial about creating a pipeline for sequence analysis in a single line.I share the process and debuging steps gone through while putting it together.Source is available at: github.com/barslmn/ngsoneliner/I couldn’t make a longer post, complete version of this post: omics.sbs/blog/NGSoneliner/NGSoneliner.html Pipeline # fastp –in1 “$R1″…

Ceballos, G., Ehrlich, P. R. & Raven, P. H. Vertebrates on the brink as indicators of biological annihilation and the sixth mass extinction. Proc. Natl Acad. Sci. USA 117, 13596–13602 (2020). Article  CAS  PubMed  PubMed Central  Google Scholar  Ceballos, G., Ehrlich, P. R. & Dirzo, R. Biological annihilation via the…

Chapman HD, Rathinam T. Focused review: the role of drug combinations for the control of coccidiosis in commercially reared chickens. Int J Parasitol Drugs Drug Resist. 2022;18:32–42. PubMed  PubMed Central  Google Scholar  Peek HW, Landman WJM. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 2011;31:143–61. CAS …

fastP.A.Y.E is very simple and easy to implement and our fair pricing plans are created to suit any company. Whether you have 5 employees or 10,000+, we have a package to suit you, we charge per active users, so you only pay for what you use. Our fastP.A.Y.E Lite plan…

Falkowski P. G., Raven J. A. Aquatic Photosynthesis (Princeton Univ. Press, 2013). Sanchez-Baracaldo, P., Bianchini, G., Wilson, J. D. & Knoll, A. H. Cyanobacteria and biogeochemical cycles through earth history. Trends Microbiol. 30, 143–157 (2022). Article  CAS  PubMed  Google Scholar  Blankenship, R. E. Early evolution of photosynthesis. Plant Physiol. 154,…

Verschuere, L., Rombaut, G., Sorgeloos, P. & Verstraete, W. Probiotic bacteria as biological control agents in aquaculture. Microbiol. Mol. Biol. Rev. 64(4), 655–671 (2000). Article  CAS  PubMed  PubMed Central  Google Scholar  Gomez, G. D. & Balczar, J. L. A review on the interactions between gut microbiota and innate immunity of…

Zhang L, Wang F, Wang L, Wang W, Liu B, Liu J, Chen M, He Q, Liao Y, Yu X, et al. Prevalence of chronic kidney disease in China: a cross-sectional survey. Lancet. 2012;379:815–22. Article  PubMed  Google Scholar  Collaboration GBDCKD. Global, regional, and national burden of chronic kidney disease, 1990–2017:…

How long should the AAA… sequence be at the end of read, so that fastqc and multiqc consider it as poly- tail 0 Good evening, The multiqc report shows the presence of poly- tails in my samples after DNA (!) sequencing even after cleaning with fastp and cutadapt with appropriate…

Taxon sampling and specimen collection All samples were collected legally following local requirements and our research complies with all relevant ethical regulations. Insect specimens were received at NC State University’s Insect Museum, pursuant to CITES permit 08US827653 (GRSCICOLL URI: grbio.org/cool/ij62-iybb). Our dataset contains representatives of 268 species from nine tribes,…

Chikwanha, O. C., P. Vahmani, V. Muchenje, M. E. R. Dugan and C. Mapiye (2018). Nutritional enhancement of sheep meat fatty acid profile for human health and wellbeing. Food research international (Ottawa, Ont.) 104: 25–38. doi.org/10.1016/j.foodres.2017.05.005. Khan R, Raza SHA, Schreurs N, Xiaoyu W, Hongbao W, Ullah I, et al….

Hi, I am keep getting an error when running humann v3.7 humann v3.7 was installed with conda conda install humann -c biobakery –solver=libmambaBefore installing the environment was created and channels were configured as per instructions I downloaded the databases as follow humann_databases –download chocophlan full /home/swijegun/humann/databases/ –update-config yes humann_databases –download…

Introduction The coronavirus infectious diseases-2019 worldwide pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is currently ongoing after being emerged from Wuhan (China) in December 2019 (Ecdc, 2020; Zhu et al, 2020; Spiteri et al, 2020). Up to now, SARS-CoV-2 has infected more than 750 million people and…

Introduction Infection is one of the greatest challenges for critically ill patients and intensivists. Previous investigations reported that 30% to 60% of antimicrobials used in ICUs are unnecessary, inappropriate, or suboptimal,1,2 which might be partly attributed to the many defects of conventional microbiological tests (CMT). Culture is the most commonly…

High amount of intronic/intergenic reads in SMARTer stranded total bulk RNAseq 0 Hello, I have bulk RNAseq data (SMARTer, stranded total RNA with ribo depletion, 100M paired-end reads 150bp) of 12 human samples and the QC stats look like this High mapping rate against the genome (~90% with Hisat2/STAR) Low…

Hi Jenna,I ran into this same error.With fastp cleaned data, I can use bwa-mem2 to run a dataset to 1 or 2 genes of the reference hg38. I then tried running the 48 pairs in the collection against the single gene. That works. but when I scaled to the complete…

Introduction Single-cell RNA sequencing (RNA-seq) was first achieved by using a quantitative cDNA amplification method and applied to mouse oocytes (Kurimoto et al, 2006; Tang et al, 2009). It has since provided unprecedented opportunities for the study of cellular differentiations, states, and diseases in various biological fields, including developmental biology,…

Introduction nf-core/sarek is a workflow designed to detect variants on whole genome or targeted sequencing data. Initially designed for Human, and Mouse, it can work on any species with a reference genome. Sarek can also handle tumour / normal pairs and could include additional relapses. The pipeline is built using…

El Aidy, S., Hooiveld, G., Tremaroli, V., Bäckhed, F. & Kleerebezem, M. The gut microbiota and mucosal homeostasis: colonized at birth or at adulthood, does it matter? Gut Microbes 4, 118–124 (2013). Article  PubMed  PubMed Central  Google Scholar  Martin, A. M., Sun, E. W., Rogers, G. B. & Keating, D….

Study design We set up a prospective, double-blinded, randomised, placebo-controlled intervention study that was performed in our academic hospital, the Amsterdam University Medical Centres location AMC in the Netherlands. After passing screening, 24 subjects with MetSyn were randomised to receive a sterile FFT from a lean healthy donor or a…

Joye, S. B. The geology and biogeochemistry of hydrocarbon seeps. Annu. Rev. Earth Pl. Sci. 48, 205–231 (2020). Article  ADS  CAS  Google Scholar  Al-Shayeb, B. et al. Borgs are giant genetic elements with potential to expand metabolic capacity. Nature 610, 731–736 (2022). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar …

Introduction Allergic airway diseases affect many people worldwide, and incidences are still increasing gradually. Allergic rhinitis and allergic asthma, are typical chronic nasopharyngitis respiratory diseases in pediatric, causing an enormous burden of illness and high economic costs to the community.1 Allergic rhinitis and allergic asthma are immunoglobulin E (IgE)-mediated inflammatory…

Yang, Y. et al. Advances in the studies of plant diversity and ecological adaptation in the subnival ecosystem of the Qinghai-Tibet plateau. Chin. Sci. Bull. 64, 2856–2864 (2019). Article  Google Scholar  Zhang, Y., Li, B. & Zheng, D. Datasets of the boundary and area of the Tibetan plateau. Acta Geographica…

FASTP 1011 Introduction to Tertiary Studies Assessment Task 1: Portfolio (Part A) Due DateWeek 3 – Friday March 19th, 11:59pm Weighting10% Word Length350 words Time Allocation6 hours Task DetailsWrite a 350 word reflective piece about yourself as a learner in the university education setting.Ensure you draw course content and course…

Animals The gene targeting experiment was conducted on cynomolgus monkeys, which served as the experimental subjects. These monkeys were housed at Guangdong LANDAU Biotechnology Co. Ltd and TOPGENE Biotechnology Co. Ltd, where they received unrestricted access to water and were provided with a standard diet in accordance with standard care…

Gelvin, S. B. Integration of Agrobacterium T-DNA into the plant genome. Annu. Rev. Genet. 51, 195–217 (2017). Article  CAS  PubMed  Google Scholar  Gelvin, S. B. Plant DNA repair and Agrobacterium T-DNA integration. Int. J. Mol. Sci. doi.org/10.3390/ijms22168458 (2021). Jupe, F. et al. The complex architecture and epigenomic impact of plant…

Hi, I am trying to run the Viroprofiler, the new program to analyze viral metagenome data. Since the Viroprofiler encompasses multiple programs to run them all at once, I am facing error message after error message while running the command. While I was running my command as suggested, $nextflow run…

Poly-A trimming for WGBS 0 We did WGBS for our fish samples and I am currently trimming our raw reads using the fastp (Version 0.20.0) and TrimGalore! (Version 0.6.10) software. however, when I did quality checking of the trimmed sequences using FastQC (version 0.12.1) I noticed that my reads both…

Gregory, A. C. et al. Marine DNA viral macro-and microdiversity from pole to pole. Cell 177, 1109–1123.e1114 (2019). Article  CAS  PubMed  PubMed Central  Google Scholar  Roux, S. et al. Ecogenomics and potential biogeochemical impacts of globally abundant ocean viruses. Nature 537, 689–693 (2016). Article  CAS  PubMed  Google Scholar  Camarillo-Guerrero, L….

Kolstø AB. Dynamic bacterial genome organization. Mol Microbiol. 1997;24:241–8. doi.org/10.1046/j.1365-2958.1997.3501715.x. Article  PubMed  Google Scholar  Snel B, Bork P, Huynen MA. Genomes in flux: the evolution of archaeal and proteobacterial gene content. Genome Res. 2002;12:17–25. doi.org/10.1101/gr.176501. Article  CAS  PubMed  Google Scholar  Puigbò P, Lobkovsky AE, Kristensen DM, Wolf YI, Koonin EV….

Zack MM, Kobau R (2017) National and state estimates of the numbers of adults and children with active epilepsy – United States, 2015. MMWR Morb Mortal Wkly Rep 66:821–825. doi.org/10.15585/mmwr.mm6631a1 Article  PubMed  PubMed Central  Google Scholar  Pottoo F et al (2020) Impact of adherence to antiepileptic medications on quality of…

The financial wellbeing solution bringing earned wage access to your finger tips About FastP.A.Y.E FastP.A.Y.E is a finance app developed by WorkTech Group. The APK has been available since December 2022. FastP.A.Y.E has been downloaded 100+ times. It’s currently not in the top ranks. The app has no ratings yet….

Lloyd, J. P. B. & Lister, R. Epigenome plasticity in plants. Nat. Rev. Genet. 23, 55–68 (2022). Article  CAS  PubMed  Google Scholar  Lu, Z., Hofmeister, B. T., Vollmers, C., DuBois, R. M. & Schmitz, R. J. Combining ATAC-seq with nuclei sorting for discovery of cis-regulatory regions in plant genomes. Nucleic…

Cell culture All cell lines used and derived by different approaches in this study are listed in Supplementary Table 1. Detailed information about the experimental design, materials and reagents is presented in the Reporting Summary. Primary human adult dermal fibroblasts (HDFa) from three different female donors were obtained from Gibco…

Introduction The worldwide spread of Klebsiella pneumoniae is a major global public health threat.1,2 K. pneumoniae is an opportunistic pathogen that colonizes the human gut and respiratory tract and possibly causes infection in immunocompromised hosts. Gut colonized K. pneumoniae is one of the important pathogens causing nosocomial infections, although the…

Soltis, P. S. & Soltis, D. E. Polyploidy and Genome Evolution (Springer, 2012). Chen, J. Z. & Birchler, J. A. Polyploid and Hybrid Genomics (Wiley-Blackwell, 2013). Ye, C. Y. et al. The genomes of the allohexaploid Echinochloa crus-galli and its progenitors provide insights into polyploidization-driven adaptation. Mol. Plant 13, 1298–1310…

Database similarity searching is an essential technique in bioinformatics as it allows us to characterize newly determined sequences by comparing them to existing databases. Figure: FASTA Web Interface. Image Source: EMBL. FASTA is one of the first widely-used database similarity search tools. FASTA (or FastA), an abbreviation for ‘Fast-All’, is…

Crosby, A. W. The Columbian Exchange: Biological and Cultural Consequences of 1492 (Praeger, 1972). Google Scholar  Ficek, R. E. Cattle, capital, colonization: Tracking creatures of the Anthropocene in and out of human projects. Curr. Anthropol. 60, S260–S271 (2019). Google Scholar  Delsol, N. Disassembling cattle and enskilling subjectivities: Butchering techniques and…

I’m trying to check for mutations from whole exome sequencing of two samples from the same patient, and was recommended to use the nextflow sarek pipeline. I assembled the fastq files I needed, made the csv file describing the patient sample information (patient, sample, lane, fastq_1, fastq_2), and entered the…

Wähner M, Brüssow K. Biological potential of fecundity of sows. Biotechnol Anim Husb. 2009;25(5–6–1):523–33. Article  Google Scholar  Argente MJ. Chap. 4 Major Components in Limiting Litter Size. In: 2018; 2018. Malopolska MM, Tuz R, Schwarz T, Ekanayake LD, D’Ambrosio J, Ahmadi B, Nowicki J, Tomaszewska E, Grzesiak M, Bartlewski PM….

Umi dedup with fastp 0 Can anyone help. I am trying to use fastp to dedup using the UMI. There is an explanation here Tutorial:Use fastp to preprocess FASTQ data with unique molecular identifer (UMI) integrated but it only gives an example if the UMI is at the head of…

Bourque, G. et al. Ten things you should know about transposable elements. Genome Biol. 19, 199 (2018). Article  CAS  PubMed  PubMed Central  Google Scholar  Chuong, E. B., Elde, N. C. & Feschotte, C. Regulatory activities of transposable elements: from conflicts to benefits. Nat. Rev. Genet. 18, 71–86 (2017). Article  CAS …

Animals and cells Adult amphioxus B. japonicum collected from the sandy bottom of the sea near Qingdao, China, were cultured in aerated seawater at room temperature and fed with single-celled algae once a day. Zebrafish (D. rerio) aged 3 months and adult Japanese scallops (M. yessoensis) were purchased from Nanshan…

Sorrells RB (1974) Synovioanalysis (“liquid biopsy”). J Ark Med Soc 71(1):59 CAS  PubMed  Google Scholar  Siena S, Sartore-Bianchi A, Garcia-Carbonero R, Karthaus M, Smith D, Tabernero J, Van Cutsem E, Guan X, Boedigheimer M, Ang A, Twomey B, Bach BA, Jung AS, Bardelli A (2018) Dynamic molecular analysis and clinical…

Mapping to mtDNA and then align the unmapped 1 Hello all, I have aligned my samples against the mitochondrion genome of the species I work with. My idea was that after this I would keep the unmapped ones (which would be the nuclear reads), and then align these against the…

I am having trouble getting my workflow to run on a new SLURM cluster. I’m not super familiar with slurm so I am a bit stumped with this. I am executing a workflow like so on the head node: snakemake -d .test/ –use-conda -j1 –slurm Snakemake successfully schedules the job…

Chang, E. S. et al. Genomic insights into the evolutionary origin of Myxozoa within Cnidaria. Proc. Natl Acad. Sci. USA 112, 14912–14917 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  Boero, F. et al. Inconsistent Evolution and Paedomorphosis among the Hydroids and Medusae of the Athecatae/Anthomedusae and the Thecatae/Leptomedusae (Cnidaria,…

Parent directory/ – – fastp_0.20.0+dfsg-1build1.debian.tar.xz 3.8 KiB 2020-Mar-22 16:49 fastp_0.20.0+dfsg-1build1.dsc 2.0 KiB 2020-Mar-22 16:49 fastp_0.20.0+dfsg-1build1_amd64.deb 187.3 KiB 2020-Mar-22 17:11 fastp_0.20.0+dfsg.orig.tar.xz 63.1 KiB 2019-Jul-22 17:13 fastp_0.20.1+dfsg-1.debian.tar.xz 3.8 KiB 2020-Apr-27 19:01 fastp_0.20.1+dfsg-1.dsc 1.9 KiB 2020-Apr-27 19:01 fastp_0.20.1+dfsg-1_amd64.deb 188.4 KiB 2020-Apr-27 20:21 fastp_0.20.1+dfsg.orig.tar.xz 63.3 KiB 2020-Apr-27…

Aim, design and setting of the study We aim to address our research question – how does microbial diversity affect PD pathology with ageing at the molecular level and can early intervention in the microbiome modulate the disease course? Herein, we have studied longitudinally the gut microbiome dynamics with ageing and report that with ageing,…

How reproducible is transcript quantification through salmon? 0 Hello! I am conducting differential expression analysis on a subset of plant transcripts. I have decided to go with Salmon+tximport+DESeq2. I am using the pseudoalignment mode of salmon on fastp-trimmed fastq files. Salmon index is run with ‘-k=31’ and quant is run…

Conway Morris, S. The predictability of evolution: glimpses into a post-Darwinian world. Naturwissenschaften 96, 1313–1337 (2009). Article  ADS  CAS  PubMed  Google Scholar  Stern, D. L. The genetic causes of convergent evolution. Nat. Rev. Genet. 14, 751–764 (2013). Article  CAS  PubMed  Google Scholar  Christiansen, K. Convergence and parallelism in cave entomobryinae….

Varshney, R. K. et al. Draft genome sequence of chickpea (Cicer arietinum) provides a resource for trait improvement. Nat. Biotechnol. 31, 240–246 (2013). Article  CAS  PubMed  Google Scholar  Li, Y. et al. Investigating drought tolerance in chickpea using genome-wide association mapping and genomic selection based on whole-genome resequencing data. Front….

Introduction Non-tuberculous mycobacteria (NTM) is a collective name given to a group of more than 190 species of Mycobacterium other than Mycobacterium tuberculosis and Mycobacterium leprae.1 NTM are labeled as environmental mycobacteria as they are widely distributed in the environment, such as in soil, marshland, streams, rivers, estuaries, dust, domestic…

Sample collection and WGS DNA samples were obtained from the CNSR-III [17], a nationwide prospective registry for patients presented to hospitals with acute ischaemic cerebrovascular events between August 2015 and March 2018 in China. Written informed consent was obtained from all patients or legally authorized representatives before entering the study….

Hi everyone, Me and my colleagues have been thinking about normalization for quite some time, and we have a hard time finding a consensus both within us, and within the literature, for this reason, this is going to be a long and detailed post. Talking with other researchers we feel…

Adapter trimming using fastp 0 Hi everyone. I use Trimmomatic for adapter trimming, but plan to use fastp in the future. Adapter trimming with Trimmomatic allows us to specify seed mismatches, palindrome clips threshold, simple clip threshold, minAdapterLength, as in the following example: ILLUMINACLIP:./Trimmomatic-0.39/adapters/NexteraPE-PE.fa:2:30:10:2 How can I specify the same…

Anonymous. Tackling drug resistant infections globally: final report and recommendations. Review on Antimicrobial Resistance. amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf (2016). Antimicrobial Resistance C. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399, 629–655 (2022). Article  Google Scholar  Klein, E. Y. et al. Global increase and geographic convergence in antibiotic consumption…

Forum:Difference in fastqc output after trimming with fastp vs afterqc 0 Hello, Upon trimming ddrad fastq files with fastp, the per base sequence content is still a ‘red cross’ but after using afterqc, the same is now yellow with an exclamatory mark, indicating it has improved. But upon using stacks,…

Trimming FASTQs 0 Hello, I would like to trim my FASTQ files, but I don’t have the sequences for the barcodes and adaptors. Is there a reliable method to predict these sequences and efficiently trim them? I came across the fastp tool, which offers automatic detection of adaptor sequences. After…