Tag: fastQC

Ubuntu Manpage: FastQC – high throughput sequence QC analysis tool

Provided by: fastqc_0.11.9+dfsg-5_all NAME FastQC – high throughput sequence QC analysis tool SYNOPSIS fastqc seqfile1 seqfile2 .. seqfileN fastqc [-o output dir] [–(no)extract] [-f fastq|bam|sam] [-c contaminant file] seqfile1 .. seqfileN DESCRIPTION FastQC reads a set of sequence files and produces from each one a quality control report consisting of…

Continue Reading Ubuntu Manpage: FastQC – high throughput sequence QC analysis tool

Special Episode 3: PhiX / UMIs / QC

Podcast: Explain Podcast Erschienen: 09.02.2024Dauer: 01:10:43 Getting the most out of Machines Chapters: 04:30 PhiX 14:30 low complexity 19:30 UMIs 32:10 FastQC 43:00 MultiQC 56:40 PycoQC PhiX concentrations for loading a validation run: knowledge.illumina.com/instrumentation/general/instrumentation-general-reference_material-list/000001536 Dnatech on why UMIs are used: dnatech.genomecenter.ucdavis.edu/faqs/what-are-umis-and-why-are-they-used-in-high-throughput-sequencing/ BMH learning on UMIs: www.youtube.com/watch?v=sRPMsnhIBK0 FastQC for QC of…

Continue Reading Special Episode 3: PhiX / UMIs / QC

Detection of DNA methylation signatures through the lens of genomic imprinting

Animals and samples The study included 10 pigs, 8 pigs were bred at the INRAE experimental farm (doi.org/doi.org/10.15454/1.5572415481185847E12) and 2 pigs come from breeding organizations in accordance with the French and European legislation on animal welfare. The animals belong to the same family, except for one LW animal. Animals were…

Continue Reading Detection of DNA methylation signatures through the lens of genomic imprinting

Comparison of capture-based mtDNA sequencing performance between MGI and illumina sequencing platforms in various sample types | BMC Genomics

Hu T, Chitnis N, Monos D, Dinh A. Next-generation sequencing technologies: an overview. Hum Immunol. 2021;82(11):801–11. Article  CAS  Google Scholar  Jeon SA, Park JL, Park SJ, Kim JH, Goh SH, Han JY, Kim SY. Comparison between MGI and Illumina sequencing platforms for whole genome sequencing. Genes Genomics. 2021;43(7):713–24. Article  CAS …

Continue Reading Comparison of capture-based mtDNA sequencing performance between MGI and illumina sequencing platforms in various sample types | BMC Genomics

fastq.gz.fastsanger.gz to fastq.gz in Galaxy and FastQC – usegalaxy.org support

Hi,Is it possible to convert fastq.gz.fastsanger.gz to fastq.gz in Galaxy?The data is in fastq.gz.fastsanger.gz format and was generated by the NextSeq 2000. I downloaded the data from Galaxy and want to convert fastq.gz.fastsanger.gz to fastq.gz using Galaxy. I uploaded the dataset, clicked the pencil icon, and went into the Edit…

Continue Reading fastq.gz.fastsanger.gz to fastq.gz in Galaxy and FastQC – usegalaxy.org support

A super-pangenome of the North American wild grape species | Genome Biology

Alston JM, Sambucci O. Grapes in the world economy. In: Cantu D, Walker MA, editors. The grape genome. Springer International Publishing; 2019. p. 1–24. Google Scholar  Rahemi A, Dodson Peterson JC, Lund KT. Grape rootstocks and related species. Cham: Springer International Publishing; 2022. Walker MA, Heinitz C, Riaz S, Uretsky…

Continue Reading A super-pangenome of the North American wild grape species | Genome Biology

Effects of plant-based proteins and handling stress on intestinal mucus microbiota in rainbow trout

FAO. The State of World Fisheries and Aquaculture 2022: Towards Blue Transformation (FAO, 2022). Google Scholar  Hua, K. et al. The future of aquatic protein: Implications for protein sources in aquaculture diets. One Earth 3, 316–329 (2019). Article  Google Scholar  Hardy, R. W. Utilization of plant proteins in fish diets:…

Continue Reading Effects of plant-based proteins and handling stress on intestinal mucus microbiota in rainbow trout

FastQC report

FastQC report 2 Hello everyone, I have a report like this. What does it mean? I am worrying because there is no information about minimum and maximum range of quality. Does it mean that the quality of it is really high? Best, Marta Fastqc • 129 views The blue curve…

Continue Reading FastQC report

Why does the Pair-End RNA library exhibit a significant disparity between the mapping results of R2 compared to R1?

Why does the Pair-End RNA library exhibit a significant disparity between the mapping results of R2 compared to R1? 0 We conducted total mRNA RNA-seq using Illumina technology and encountered significant disparity in the mapping between R2 and R1. We are considering potential issues with trimming; we utilized FastQC and…

Continue Reading Why does the Pair-End RNA library exhibit a significant disparity between the mapping results of R2 compared to R1?

Potent latency reversal by Tat RNA-containing nanoparticle enables multi-omic analysis of the HIV-1 reservoir

Participants and blood collection A total of n = 23 HIV-1 seropositive individuals on stably suppressive ART were included in this study (Supplementary Table 1). Participants were recruited at Ghent University Hospital. 2/23 individuals are female, 21/23 are male; the limited representation of female individuals in our study is a direct reflection of…

Continue Reading Potent latency reversal by Tat RNA-containing nanoparticle enables multi-omic analysis of the HIV-1 reservoir

TWAS revealed significant causal loci for milk production and its composition in Murrah buffaloes

Cao, C. et al. Power analysis of transcriptome-wide association study: Implications for practical protocol choice. PLoS Genet. 17(2), e1009405 (2021). Article  CAS  PubMed  PubMed Central  Google Scholar  De Camargo, G. M. F. et al. Prospecting major genes in dairy buffaloes. BMC Genomics 16, 1–14 (2015). Article  Google Scholar  El-Halawany, N….

Continue Reading TWAS revealed significant causal loci for milk production and its composition in Murrah buffaloes

Technical Support Overview | DNA Sequencing Software

Here are a few useful technical support documents for current versions of Sequencher running on both Macintosh and Windows computers. Sequencher Installation Instructions For help installing Sequencher on either Windows or Macintosh: DNA-Seq Tools Installation Instructions For help installing DNA-Seq Tools, including FastQC, for use with Sequencher on either Windows…

Continue Reading Technical Support Overview | DNA Sequencing Software

Identification of Differentially Expressed Genes in Human Colorectal Cancer Using RNASeq Data Validated on the Molecular Level with Real-Time PCR

Allam RM, Al-Abd AM, Khedr A, Sharaf OA, Nofal SM, Khalifa AE, Mosli HA, Abdel-Naim AB (2018) Fingolimod interrupts the cross talk between estrogen metabolism and sphingolipid metabolism within prostate cancer cells. Toxicol Lett 291:77–85 Article  CAS  PubMed  Google Scholar  Andrews S et al (2010) FastQC: a quality control tool…

Continue Reading Identification of Differentially Expressed Genes in Human Colorectal Cancer Using RNASeq Data Validated on the Molecular Level with Real-Time PCR

An FGFR2 mutation as the potential cause of a new phenotype including early-onset osteoporosis and bone fractures: a case report | BMC Medical Genomics

Anamnesis vitae A 13 year old male born was as result of the VII pregnancy, from unrelated parents. Other pregnancies resulted in: I-II silent miscarriage in the second trimester; III – female, born in 2003 (III-3 Fig. 1) that has the following phenotypic features: genu valgum, hip dysplasia, combined thoracolumbar scoliosis,…

Continue Reading An FGFR2 mutation as the potential cause of a new phenotype including early-onset osteoporosis and bone fractures: a case report | BMC Medical Genomics

Pair ended short reads assemble to multiple references with a plasmid also inside

Pair ended short reads assemble to multiple references with a plasmid also inside 0 Hello, I am new to bioinformatics and am having trouble doing an assembly and alignment. First I will describe my sample data, I have Illumina MiSeq data of pair ended reads on a yeast organism. This…

Continue Reading Pair ended short reads assemble to multiple references with a plasmid also inside

Insight into chloroplast genome structural variation of the Mongolian endemic species Adonis mongolica (Ranunculaceae) in the Adonideae tribe

Wang, W. T. Revision of Adonis (Ranunculaceae). Bull. Bot. Res. 14, 1–31 (1994). Google Scholar  Gao, T. et al. Evaluating the feasibility of using candidate DNA Barcodes in discriminating species of the large Asteraceae family. BMC Evol. Biol. 10, 324 (2016). Article  Google Scholar  Conti, F. et al. Adonis fucensis…

Continue Reading Insight into chloroplast genome structural variation of the Mongolian endemic species Adonis mongolica (Ranunculaceae) in the Adonideae tribe

Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation

Sample collection A total of nine species of marine fish were collected across three different sampling days (September 7th, 9th, and 12th 2022) under IACUC Animal Use Protocol S12219 (Supplementary Data 1). Six species were collected using a speargun donated by a local fisher. Fish were transported back to shore, euthanized,…

Continue Reading Generating high-quality plant and fish reference genomes from field-collected specimens by optimizing preservation

Ambiguous genes due to aligners and their impact on RNA-seq data analysis

Datasets To avoid the so-called ‘dataset bias’20,that some datasets are generated with specific structures and thus the results are ‘over-optimistic’ (in the case of working with our novel method), we performed the analysis in the light of several real datasets (see Table 4). We used four different datasets from the NCBI…

Continue Reading Ambiguous genes due to aligners and their impact on RNA-seq data analysis

sam – Discrepancy in Read Counts Between FastQ and BAM Files in Adapter-Trimmed Pipeline

In a FastQ to BAM pipeline where only adapter trimming is performed, I’ve noticed a potential discrepancy in read counts between the initial FastQ files and their resulting BAM file. Specifically, I’m seeking clarification on whether the following statement holds true: “Total number of reads in R1 and R2 FastQ…

Continue Reading sam – Discrepancy in Read Counts Between FastQ and BAM Files in Adapter-Trimmed Pipeline

The role of APOBEC3B in lung tumor evolution and targeted cancer therapy resistance

Cell line and growth assays Cell lines were grown in Roswell Park Memorial Institute-1640 medium (RPMI-1640) with 1% penicillin–streptomycin (10,000 U ml−1) and 10% FBS or in Iscove’s modified Dulbecco’s medium (IMDM) with 1% penicillin–streptomycin (10,000 U ml−1), l-glutamine (200 mM) and 10% FBS in a humidified incubator with 5% CO2 maintained at 37 °C. Drugs…

Continue Reading The role of APOBEC3B in lung tumor evolution and targeted cancer therapy resistance

FastQC without yellow box

FastQC without yellow box 1 I am not sure if the quality of my data (DNA) is good. fastqc • 69 views The box is the quartiles, the red line the median. Please google how to read a box plot. Your data is good in terms of base quality. Login…

Continue Reading FastQC without yellow box

Borrelia puertoricensis in opossums (Didelphis marsupialis) from Colombia | Parasites & Vectors

Oppler Z, Keeffe K, McCoy K, Brisson D. Evolutionary genetics of Borrelia. Curr Issues Mol Biol. 2021;42:97–112. doi.org/10.21775/cimb.042.097.2. Article  PubMed  Google Scholar  Margos G, Fingerle V, Cutler S, Gofton A, Stevenson B, Estrada-Peña A. Controversies in bacterial taxonomy: the example of the genus Borrelia. Ticks Tick Borne Dis. 2020;11:101335. doi.org/10.1016/j.ttbdis.2019.101335….

Continue Reading Borrelia puertoricensis in opossums (Didelphis marsupialis) from Colombia | Parasites & Vectors

Process Truncated fastq file

Process Truncated fastq file 1 Dear all, I have 150bp paired-end mRNA data, for one sample in the reverse reads (R2) file the QC (FastQC) run for upto 95 % and then failed with an error message: Failed to process file Sample1-mRNA_R2.fastq.gz uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Ran out of data in the middle…

Continue Reading Process Truncated fastq file

BIRCH Tutorial – Genome Assembly

BIRCH Tutorial – Genome Assembly References FastQC – www.bioinformatics.babraham.ac.uk/projects/fastqc/ trim_galore User’s Guidetrim_galore manual SeqKit 0. Obtain sequencing read files DATASET: Fakankun I et al. Ph.D. thesis, University of Manitoba (in progress) Rhodosporidium diobovatum.This dataset is a random sample of about 5% of the reads from fungal genomic DNA. raw read…

Continue Reading BIRCH Tutorial – Genome Assembly

Salpa genome and developmental transcriptome analyses reveal molecular flexibility enabling reproductive success in a rapidly changing environment

Loeb, V. et al. Effects of sea-ice extent and krill or salp dominance on the Antarctic food web. Nature 387, 897–900 (1997). Article  ADS  CAS  Google Scholar  Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature…

Continue Reading Salpa genome and developmental transcriptome analyses reveal molecular flexibility enabling reproductive success in a rapidly changing environment

Longitudinal detection of circulating tumor DNA

Analysis of Roche KAPA Target Enrichment kit experimental data obtained on an Illumina sequencing system is most frequently performed using a variety of publicly available, open-source analysis tools. The typical variant calling analysis workflow consists of sequencing read quality assessment, read filtering, mapping against the reference genome, duplicate removal, coverage…

Continue Reading Longitudinal detection of circulating tumor DNA

ESRP1 controls biogenesis and function of a large abundant multiexon circRNA | Nucleic Acids Research

Abstract While the majority of circRNAs are formed from infrequent back-splicing of exons from protein coding genes, some can be produced at quite high level and in a regulated manner. We describe the regulation, biogenesis and function of circDOCK1(2–27), a large, abundant circular RNA that is highly regulated during epithelial-mesenchymal…

Continue Reading ESRP1 controls biogenesis and function of a large abundant multiexon circRNA | Nucleic Acids Research

Discrepancy in total number of bases in trimmed read1 and read2 files after BBDuk

Discrepancy in total number of bases in trimmed read1 and read2 files after BBDuk 0 Hi all, After performing adapter trimming with bbduk.sh, I found that the total number of bases in the read1 file is different compared with the read2 file from FastQC quality check. Below was the code…

Continue Reading Discrepancy in total number of bases in trimmed read1 and read2 files after BBDuk

H101 for cervical cancer | DDDT

Introduction Patients with persistent, recurrent, or metastatic (P/R/M) cervical carcinoma respond poorly to treatment despite the best available therapeutic regimens, with a 5-year survival of 17%.1 Most of them are heavily pretreated with chemotherapy and/or radiotherapy, and many patients experience complications related to treatment or advanced disease, which exclude them…

Continue Reading H101 for cervical cancer | DDDT

Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs

Rv3907c is the CCA-adding enzyme in Mycobacterium It remains unclear whether the rv3907c gene product, originally annotated as poly(A) polymerase, is in fact the CCA-adding enzyme in Mtb. Rv3907c is composed of three domains, an N-terminal class II polymerase β superfamily domain, a central RNA-binding domain and a C-terminal HD…

Continue Reading Depletion of tRNA CCA-adding enzyme in Mycobacterium tuberculosis leads to polyadenylation of transcripts and precursor tRNAs

ION Proton exome sequencing results (FASTQC report) – typical/OK quality?

Microbiome research has led to the discovery of important connections to human and environmental health. Sequencing has become a core investigational tool in microbiome research, a subject that we covered during a recent webinar. Our expert speakers shared a number of advancements including improved experimental workflows, research involving transmission dynamics,…

Continue Reading ION Proton exome sequencing results (FASTQC report) – typical/OK quality?

The genomic epidemiology of shigellosis in South Africa

Institue for Health Metrics and Evaluation. Global Burden of Disease. vizhub.healthdata.org/gbd-results/ 2019. Troeger, C. E. et al. Quantifying risks and interventions that have affected the burden of diarrhoea among children younger than 5 years: an analysis of the Global Burden of Disease Study 2017. Lancet Infect. Dis. 20, 37–59 (2020)….

Continue Reading The genomic epidemiology of shigellosis in South Africa

Immune-privileged tissues formed from immunologically cloaked mouse embryonic stem cells survive long term in allogeneic hosts

Mice C57BL/6N (strain 005304), C3H/HeJ (strain 000659), FVB/NJ (strain 001800), BALB/cJ (strain 000651) and NSG mice (stock 005557) were purchased from the Jackson Laboratory. CD-1 (stock 022) mice were purchased from Charles River. Mice (6–20-week-old) of each strain/background were used for teratoma assays. Mice were housed in a pathogen-free facility…

Continue Reading Immune-privileged tissues formed from immunologically cloaked mouse embryonic stem cells survive long term in allogeneic hosts

Whole mitochondrial genome sequencing provides new insights into the phylogeography of loggerhead turtles (Caretta caretta) in the Mediterranean Sea

Andrews S (2010) FastQC: a quality control tool for high throughput sequence data. www.bioinformatics.babraham.ac.uk/projects/fastqc Avise JC (1986) Mitochondrial DNA and the evolutionary genetics of higher animals. Philos Trans R Soc Lond B 312:325–342. doi.org/10.1098/rstb.1986.0011 Article  CAS  Google Scholar  Baker CS, Steel D, Calambokidis J, Falcone E, González-Peral U, Barlow J,…

Continue Reading Whole mitochondrial genome sequencing provides new insights into the phylogeography of loggerhead turtles (Caretta caretta) in the Mediterranean Sea

Phenotypic drug-susceptibility profiles and genetic analysis based on whole-genome sequencing of Mycobacterium avium complex isolates in Thailand

Abstract Mycobacterium avium complex (MAC) infections are a significant clinical challenge. Determining drug-susceptibility profiles and the genetic basis of drug resistance is crucial for guiding effective treatment strategies. This study aimed to determine the drug-susceptibility profiles of MAC clinical isolates and to investigate the genetic basis conferring drug resistance using…

Continue Reading Phenotypic drug-susceptibility profiles and genetic analysis based on whole-genome sequencing of Mycobacterium avium complex isolates in Thailand

Intrinsic deletion at 10q23.31, including the PTEN gene locus, is aggravated upon CRISPR-Cas9-mediated genome engineering in HAP1 cells mimicking cancer profiles

Introduction The CRISPR-Cas system is a widely used genome engineering technology because of its simple programmability, versatile scalability, and targeting efficiency (Wang & Doudna, 2023). Although researchers are rapidly developing CRISPR-Cas9 tools, the biggest challenge remains to overcome undesired on- and off-targeting outcomes. Previous studies have reported unintended genomic alterations,…

Continue Reading Intrinsic deletion at 10q23.31, including the PTEN gene locus, is aggravated upon CRISPR-Cas9-mediated genome engineering in HAP1 cells mimicking cancer profiles

Should I remove Kmers identified in FastQC?

Should I remove Kmers identified in FastQC? 2 Hi, apologies for this basic questions, I new in NGS quality control. I have been check my NGS data (Illumina – HiSeq 2500 2*100pb) using FastQC after trimming Nextera Adaptater with bbduck (BBTool package) using trimming overlap (ktrim=r k=25 mink=11 hdist=1 tpe…

Continue Reading Should I remove Kmers identified in FastQC?

Simultaneous analysis of seven 16S rRNA hypervariable gene regions increases efficiency in marine bacterial diversity detection

doi: 10.1111/1462-2920.16530. Online ahead of print. Affiliations Expand Affiliations 1 Ecology Group, Rheinland-Pfälzische Technische Universität Kaiserslautern-Landau, Kaiserslautern, Germany. 2 Marine Ecosystems Functioning, AZTI, Marine Research, Basque Research and Technology Alliance, Pasia, Gipuzkoa, Spain. 3 Molecular Ecology Group, Rheinland-Pfälzische Technische Universität Kaiserslautern-Landau, Kaiserslautern, Germany. 4 SeqIT, Laboratory for Molecular Diagnostics and…

Continue Reading Simultaneous analysis of seven 16S rRNA hypervariable gene regions increases efficiency in marine bacterial diversity detection

GDF11 slows excitatory neuronal senescence and brain ageing by repressing p21

Experimental model and subject details Mice Male ICR mice (Laboratory Animal Center of Zhejiang Academy of Medical Sciences) at age of 3 months (M), 9 M and 36 M, male C57BL/B6 wild‐type (WT) mice (Shanghai Slac Laboratory) at age of 3 M and 10 M, male GDF11-flox mice (GDF11f/f, mice carrying the “floxed” GDF11…

Continue Reading GDF11 slows excitatory neuronal senescence and brain ageing by repressing p21

Multiple micronutrient deficiencies in early life cause multi-kingdom alterations in the gut microbiome and intrinsic antibiotic resistance genes in mice

Han, X., Ding, S., Lu, J. & Li, Y. Global, regional, and national burdens of common micronutrient deficiencies from 1990 to 2019: a secondary trend analysis based on the Global Burden of Disease 2019 study. eClinicalMedicine 44, 101299 (2022). Article  PubMed  PubMed Central  Google Scholar  Bailey, R. L., West, K….

Continue Reading Multiple micronutrient deficiencies in early life cause multi-kingdom alterations in the gut microbiome and intrinsic antibiotic resistance genes in mice

Bacterial genome size and gene functional diversity negatively correlate with taxonomic diversity along a pH gradient

Fierer, N. & Jackson, R. B. The diversity and biogeography of soil bacterial communities. Proc. Natl. Acad. Sci. USA. 103, 626–631 (2006). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  Gao, C. & Guo, L. Progress on microbial species diversity, community assembly and functional traits. Biodivers. Sci. 30, 22429 (2022)….

Continue Reading Bacterial genome size and gene functional diversity negatively correlate with taxonomic diversity along a pH gradient

How to download FASTQ files from the European Nucleotide Archive (ENA) to use them with FastQC etc..

How to download FASTQ files from the European Nucleotide Archive (ENA) to use them with FastQC etc.. 2 Hello, I would like to download FASTQ files from the European Nucleotide Archive (ENA) to use them with FastQC, kallisto,etc. In particular, this: www.ebi.ac.uk/ena/browser/view/PRJEB31975 Since it’s a huge amount of data, how…

Continue Reading How to download FASTQ files from the European Nucleotide Archive (ENA) to use them with FastQC etc..

Htseq Count

Hello, I have ran htseq-count numerous times and continue to get the same error. That NONE of my genes are counted as seen here. ZXDC 0 ZYG11B 0 ZYX 0 ZZEF1 0 ZZZ3 0 __no_feature 70257177 __ambiguous 0 __too_low_aQual 1509790 __not_aligned 3970775 __alignment_not_unique 4277765 However, I have a very high…

Continue Reading Htseq Count

Whole genome sequencing in high-grade cervical intraepitheli… : Medicine

1. Introduction Cervical cancer (CC) is the third most common cancer in women worldwide and has a high mortality rate among women. In 2008, CC was responsible for 275,000 deaths, thereby being the fourth leading cause of cancer death in females worldwide.[1,2] In China, CC is the second most…

Continue Reading Whole genome sequencing in high-grade cervical intraepitheli… : Medicine

Samtools index not working in Snakemake

I am setting up a Snakemake pipeline for sequencing reads alignment and variants calling. But the samtools index rule is not activated, and the subsequent haplotype caller rule fail. I think it is because the samtools index rule is not perceived as necessary to execute the output of rule all…

Continue Reading Samtools index not working in Snakemake

In silico prospecting of the mtDNA of Macrobrachium amazonicum from transcriptome data | BMC Genomics

Bentes B, Martinelli J, Souza L, Cavalcante D, Almeida M, Isaac V. Spatial distribution of the amazon river prawn Macrobrachium Amazonicum (Heller, 1862) (Decapoda, Caridea, Palaemonidae) in two perennial creeks of an estuary on the northern coast of Brazil (Guajará Bay, Belém, Pará). Brazilian J Biol. 2011;71:925–35. Article  Google Scholar …

Continue Reading In silico prospecting of the mtDNA of Macrobrachium amazonicum from transcriptome data | BMC Genomics

Troubleshooting cutadapt failed jobs – troubleshooting

Hoping to revive this. Same problem here. Ran Trim Galore on approx 50fastq files. 44 of them worked fine (produced output files). 3 of the paired files did not.SoSample1 R1Sample1 R2 Sample2 R1Sample2 R2 etc… did not work. The error for these say: Could not detect version of Python used…

Continue Reading Troubleshooting cutadapt failed jobs – troubleshooting

ILIAD: a suite of automated Snakemake workflows for processing genomic data for downstream applications | BMC Bioinformatics

Pipeline architecture and configuration file Genomic data processing poses a challenge for genetic research studies because it involves multiple program dependency installations, vast numbers of samples with raw data from various next-generation sequencing (NGS) platforms, and inconsistent genetic variant ID and/or positions among datasets. The Iliad suite of genomic data…

Continue Reading ILIAD: a suite of automated Snakemake workflows for processing genomic data for downstream applications | BMC Bioinformatics

FastQC quality dropping after trimming

FastQC quality dropping after trimming 1 Hello everyone, I have a question about my Fast QC report. Before the trimming, this is the FastQC report After trimming with ILLUMINACLIP:$TRIMM_ADAPTERS/NexteraPE-PE.fa:2:30:10 \ SLIDINGWINDOW:10:30 \ LEADING:30 \ TRAILING:30 \ HEADCROP:15 \ MINLEN:100 I have this FastQC report why is the quality dropping in…

Continue Reading FastQC quality dropping after trimming

Comment: RNA seq QC

Looks like this . I am sure that is an example of a strong adapter contamination. ![fastqc ][1] The R1 report of overrepresented sequences shows(before the trimming): ![adapter][2] [1]: /media/images/e289023a-9836-4537-adbd-d8ae5e03 [2]: /media/images/3b7f0506-3baa-4e0f-95ff-56bcd6e9 They are all from adapter contamination. But I cannot understand how it is possible that I am losing…

Continue Reading Comment: RNA seq QC

Handle repository with different VCS folders.

Reported by Simon Tournier <zimon.toutoune@gmail.com> * guix/hash.scm (vcs-file?): Add optional argument for passing VCS kind of the file/repository. (file-hash*): Adjust accordingly. * guix/scripts/hash.scm (guix-hash)[file-hash]: Detect VCS kind of the file/repository and passes it. Change-Id: I8e286c3426ddefd664dc3a471d5a09e309824faa — guix/hash.scm | 18 ++++++++++++—— guix/scripts/hash.scm | 18 +++++++++++++—– 2 files changed, 25 insertions(+), 11…

Continue Reading Handle repository with different VCS folders.

RNA seq QC

Hello everyone, I have this strange FastQC report. This is the R1 report before the trimming, the R2 is quite similar. This is a sample from RNA-seq experiment. Before the trimming, I have 3875104 reads, after the trimming with trimmomatic(SLIDINGWINDOW:10:30 LEADING:30 TRAILING:30 HEADCROP:15) I have 742368 reads. Can you help…

Continue Reading RNA seq QC

Are truseq adapter sequences picked up by FASTQC?

Are truseq adapter sequences picked up by FASTQC? 1 Hello, I am testing a new software that is supposed to automatically detect adapters and remove them. I am using the adapters shown here: support-docs.illumina.com/SHARE/AdapterSequences/Content/SHARE/AdapterSeq/TruSeq/UDIndexes.htm I run the demultiplexing+ adapter trimming and the software does not see to recognize this adapter….

Continue Reading Are truseq adapter sequences picked up by FASTQC?

Bulk RNAseq Salmon index building which transcriptome to use

Bulk RNAseq Salmon index building which transcriptome to use 0 Hi all, I am new to the platform. I was wondering what the common/best practice is regarding building a Salmon index for bulk RNAseq analysis of human cells. The tutorial for Salmon/Alevin is using the complete transcriptome from GENCODE (gencode.vM23.transcripts.fa.gz,…

Continue Reading Bulk RNAseq Salmon index building which transcriptome to use

Correction of a homoplasmic mitochondrial tRNA mutation in patient-derived iPSCs via a mitochondrial base editor

Human induced pluripotent stem cells (iPSCs) Reprogramming and Culture This study was ethically approved by the Medical Ethics Committee of Nanjing Maternal and Child Health Care Hospital (2021KY-131), and informed consents were obtained from the patient’s legal guardian as well as the healthy donors, in accordance with the Declaration of…

Continue Reading Correction of a homoplasmic mitochondrial tRNA mutation in patient-derived iPSCs via a mitochondrial base editor

Diagnostic and commensal Staphylococcus pseudintermedius genomes reveal niche adaptation through parallel selection of defense mechanisms

Bond, R. & Loeffler, A. What’s happened to Staphylococcus intermedius? Taxonomic revision and emergence of multi-drug resistance. J. Small Anim. Pr. 53, 147–154 (2012). Article  CAS  Google Scholar  Carroll, K. C., Burnham, C. D. & Westblade, L. F. From canines to humans: clinical importance of Staphylococcus pseudintermedius. PLoS Pathog. 17,…

Continue Reading Diagnostic and commensal Staphylococcus pseudintermedius genomes reveal niche adaptation through parallel selection of defense mechanisms

Got an error when using chilin

Got an error when using chilin 0 I installed chilin and all the dependencies following the guidance, but when I run bash foxa1 and my own data, I got an error as below: Traceback (most recent call last): File “/chipseq/3.fastqc/chilin/software/mdseqpos/bin/MDSeqPos.py”, line 421, in <module> main() File “/chipseq/3.fastqc/chilin/software/mdseqpos/bin/MDSeqPos.py”, line 385, in…

Continue Reading Got an error when using chilin

Is trimming necessary for RNAseq?

Is trimming necessary for RNAseq? 0 I am performing quality control on some reads that have good FastQC metrics apart from duplication levels and per base sequence content. Is it necessary to trim these reads before alignment and downstream DE analysis, variant calling etc? I have read conflicting advice about…

Continue Reading Is trimming necessary for RNAseq?

What is FastQC | 5 Answers from Research papers

FastQC is a software tool used for quality control in sequencing data analysis. It is commonly used in standard pipelines at sequencing centers. The tool provides computations to assess the quality of sequencing data, such as per base sequence content and per tile sequence quality. It generates HTML reports with…

Continue Reading What is FastQC | 5 Answers from Research papers

Inferring bacterial transmission dynamics using deep sequencing genomic surveillance data

Study design Experiments were performed in accordance with the New Zealand Animal Welfare Act (1999) and institutional guidelines provided by the University of Auckland Animal Ethics Committee, which reviewed and approved these experiments under application R1003. We did not use any specific randomisation process to allocate animals to a particular…

Continue Reading Inferring bacterial transmission dynamics using deep sequencing genomic surveillance data

MGA-seq: robust identification of extrachromosomal DNA and genetic variants using multiple genetic abnormality sequencing | Genome Biology

Zack TI, Schumacher SE, Carter SL, Cherniack AD, Saksena G, Tabak B, Lawrence MS, Zhang C-Z, Wala J, Mermel CH. Pan-cancer patterns of somatic copy number alteration. Nat Genet. 2013;45:1134–40. Article  CAS  PubMed  PubMed Central  Google Scholar  Dixon JR, Xu J, Dileep V, Zhan Y, Song F, Le VT, Yardımcı…

Continue Reading MGA-seq: robust identification of extrachromosomal DNA and genetic variants using multiple genetic abnormality sequencing | Genome Biology

1-3% if R2 reads are only contain G bases

Paired-end RNA seq (NextSeq2000): 1-3% if R2 reads are only contain G bases 2 Dear Biostars, I have been performing paired-end RNA seq on the nextseq2000. When running fastqc, I noticed an overrepresented poly-G sequence consisting of 59 G bases (my read length is also 59 bp). Overrepresentation was between…

Continue Reading 1-3% if R2 reads are only contain G bases

Comparative Analysis of Structural Variant Callers on Short-Read Whole-Genome Sequencing Data

Pang, A.W., MacDonald, J.R., Pinto, D., et al., Towards a comprehensive structural variation map of an individual human genome, Genome Biol., 2010, vol. 11, no. 5, p. R52. doi.org/10.1186/gb-2010-11-5-r52 Article  CAS  PubMed  PubMed Central  Google Scholar  The International HapMap Consortium, The international HapMap project, Nature, 2003, pp. 789—796. doi.org/10.1038/nature02168 Sudmant,…

Continue Reading Comparative Analysis of Structural Variant Callers on Short-Read Whole-Genome Sequencing Data

error in Fastq

error in Fastq 1 HI I am trying to do fastqc of one file but after running approximately 100 percent it is showing the below-listed error Please suggest what can be done. Thanks Approx 100% complete for SRR18330177_2.fastq It seems our guess for the total number of records wasn’t very…

Continue Reading error in Fastq

Solved A ‘normal’ sample as far as FastQC is concerned is

A ‘normal’ sample as far as FastQC is concerned is random and diverse. Libraries which are not random and/or diverse may produce ‘Fails’ on a FastQC report. A Fail on the ‘Per base sequence content’ report might be expected on which of the following good-quality libraries. Select all that apply….

Continue Reading Solved A ‘normal’ sample as far as FastQC is concerned is

DNA-binding protein PfAP2-P regulates parasite pathogenesis during malaria parasite blood stages

Parasite culture, maintenance, synchronization and transfection The DiCre-expressing P. falciparum clone II3 (ref. 10) was maintained in human A+ erythrocytes at 37 °C in Roswell Park Memorial Institute 1640 medium containing AlbumaxII (Invitrogen) supplemented with 2 mM l-glutamine. Parasites were either synchronized by sorbitol treatment or by purifying mature schizont stages using…

Continue Reading DNA-binding protein PfAP2-P regulates parasite pathogenesis during malaria parasite blood stages

Mycobacterium tuberculosis Sub Lineage 4.2.2/SIT149 as DR

Introduction Antimicrobial resistance is a hidden global pandemic that shattered over 4.9 million people in 2019 alone, and the burden is highest, mainly in low-resource settings.1 Drug-resistant tuberculosis (DR-TB) caused by Mycobacterium tuberculosis (Mtb) complex (MTBC), which is resistant to one or more anti-TB drugs, is a leading global public…

Continue Reading Mycobacterium tuberculosis Sub Lineage 4.2.2/SIT149 as DR

NGS Training | Top NGS Courses | Online Training | RNASeq | Genome Variant Detection

        NGS Training Next Generation Sequencing (NGS), a recently evolved technology, have served a lot in the research and development sector of our society. NGS methods are highly parallelized enabling to sequence thousands to millions of molecules simultaneously. This technology results into huge amount of data, which…

Continue Reading NGS Training | Top NGS Courses | Online Training | RNASeq | Genome Variant Detection

How-to: NGS Quality Control

Thanks to the introduction of high-throughput next generation sequencing (NGS) methods, generating nucleic acid sequencing data has never been easier. Now, DNA and RNA samples can be sequenced within hours, creating millions of DNA fragments (known as reads), which can then be aligned to a reference genome.  Quality control is…

Continue Reading How-to: NGS Quality Control

rnaSPAdes running out of memory: oom error

rnaSPAdes running out of memory: oom error 0 I am trying to assemble a metatranscriptome sample (~83M reads) using rnaSPAdes (v 3.13.0), and I am running out of memory on these runs. After running the following code: rnaspades.py -m 1500 -t 8 -o rnaSPAdes_output_37 –pe1-1 SM037_R1.fastq –pe1-2 SM037_R2.fastq I get…

Continue Reading rnaSPAdes running out of memory: oom error

molkart: Output

Introduction This document describes the output produced by the pipeline. Most of the plots are taken from the MultiQC report, which summarises results at the end of the pipeline. The directories listed below will be created in the results directory after the pipeline has finished. All paths are relative to…

Continue Reading molkart: Output

How to interpret the discrepancy of assignment rate in featurecounts using forward and reverse strand protocols

How to interpret the discrepancy of assignment rate in featurecounts using forward and reverse strand protocols 0 My RNAseq analysis pipeline is as follows: fastqc (read quality is good, some overrepresentation of adaptor sequence) -> trimmomatic (trimmed adaptor sequence, qc report after trimming suggests the overrepresented adaptors are gone) ->…

Continue Reading How to interpret the discrepancy of assignment rate in featurecounts using forward and reverse strand protocols

Solved Download fastac.ac.sh, fastac.loop.sh and

Transcribed image text: Download fastac.ac.sh, fastac.loop.sh and runinfo.csv, Answer the questions below: 1. Run the bash script fas tqc. qc. sh. How many NEW files are generated under directory reports/ after your script runs successfully? 2. Edit the file fastqc. loop. sh so the script successfully loops through the SRR…

Continue Reading Solved Download fastac.ac.sh, fastac.loop.sh and

Fast QC results (per sequence GC content)

Fast QC results (per sequence GC content) – RNA seq 0 Please help me to understand what is these two peaks(1st peak 37%, 2nd peak 50%).. This result is data downloaded from an RNA seq in another experiment. Is it because it was before trimming, or is it because of…

Continue Reading Fast QC results (per sequence GC content)

Distantly related Alteromonas bacteriophages share tail fibers exhibiting properties of transient chaperone caps

de Jonge, P. A., Nobrega, F. L., Brouns, S. J. J. & Dutilh, B. E. Molecular and evolutionary determinants of bacteriophage host range. Trends Microbiol. 27, 51–63 (2019). Article  PubMed  Google Scholar  Cambillau, C. Bacteriophage module reshuffling results in adaptive host range as exemplified by the baseplate model of listerial…

Continue Reading Distantly related Alteromonas bacteriophages share tail fibers exhibiting properties of transient chaperone caps

repository of small ORFs identified by ribosome profiling

Mouse liver cells Mouse liver cells References Quantitative profiling of initiating ribosomes in vivo Authors Gao, X., Wan, J., Liu, B., Ming, M., Shen, B., Qian, S.B. link to data SRA160745 treatment type pre-lysis cycloheximide treatment nuclease used: RNase I total number of reads (CHX/EM sample) reads mapped to rRNA…

Continue Reading repository of small ORFs identified by ribosome profiling

Index of /~psgendb/birchhomedir/GenBank/workspace/reads/454/reads.TrimmomaticSL8Q10m50

Name Last modified Size Description Parent Directory   –   454.Trimmomatic.fq 2021-06-10 20:02 1.7G   454stats.tsv 2021-06-05 12:04 257   GQ8KZ7F02_S.fastq 2021-06-05 12:03 558M   GQ8KZ7F02_S_fastqc.html 2021-06-05 12:06 280K   GQ8KZ7F02_S_fastqc.zip 2021-06-05 12:06 315K   GRAEVHH01_S.fastq 2021-06-05 12:03 576M   GRAEVHH01_S_fastqc.html 2021-06-05 12:06 329K   GRAEVHH01_S_fastqc.zip 2021-06-05 12:06 383K  …

Continue Reading Index of /~psgendb/birchhomedir/GenBank/workspace/reads/454/reads.TrimmomaticSL8Q10m50

Removing primers from Amplicon WGBS

Removing primers from Amplicon WGBS 0 Hello, I have a FASTQ file of raw paired reads of whole genome bisulfite sequencing data of cfDNA. When running fastqc on my file I see the following in overrepresented sequences: TTGGAGGCTCATCGTTCCTAGCTTGAGTATCTCGTATGCCGTCTTCTGCT 2692 0.24563590226027004 RNA PCR Primer, Index 26 (96% over 27bp) CGTTGGAGGCTCATCGTTCCTAGCTTGAGTATCTCGTATGCCGTCTTCTG 1996…

Continue Reading Removing primers from Amplicon WGBS

How do I use fastqc to quality control the third generation sequencing data and establish a reference quality control result?

How do I use fastqc to quality control the third generation sequencing data and establish a reference quality control result? 0 Our tutor asked us to use fastqc to quality control the data of the third generation sequencing, and hoped to create a common reference quality control result of the…

Continue Reading How do I use fastqc to quality control the third generation sequencing data and establish a reference quality control result?

Apoptotic stress causes mtDNA release during senescence and drives the SASP

Cell culture and treatments Human embryonic lung MRC5 fibroblasts (ATCC) and IMR90 fibroblasts (ATCC) were grown in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich, D5796) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U ml−1 penicillin, 100 μg ml−1 streptomycin and 2 mM l-glutamine and maintained at 37 °C under 5% CO2. MRC5 fibroblasts were cultured in…

Continue Reading Apoptotic stress causes mtDNA release during senescence and drives the SASP

How long should the AAA… sequence be at the end of read, so that fastqc and multiqc consider it as poly- tail

How long should the AAA… sequence be at the end of read, so that fastqc and multiqc consider it as poly- tail 0 Good evening, The multiqc report shows the presence of poly- tails in my samples after DNA (!) sequencing even after cleaning with fastp and cutadapt with appropriate…

Continue Reading How long should the AAA… sequence be at the end of read, so that fastqc and multiqc consider it as poly- tail

The mutational signature of hypertrophic cardiomyopathy

Introduction Hypertrophic cardiomyopathy (HCM), characterized by asymmetric hypertrophy of the ventricular wall, is a condition where the heart becomes thickened without a distinct inducement.1,2 Epidemiological investigation shows that the estimated prevalence rate of HCM in the general population is 1:500.3,4 The clinical manifestations vary greatly, with no symptoms and mild…

Continue Reading The mutational signature of hypertrophic cardiomyopathy

Solved 1. Download fastq files using the command below, and

Transcribed image text: 1. Download fastq files using the command below, and answer the questions: fastq-dump -X 1000 –split-files SRR12544599 1.1 Run fastQC on the two fastq files: SRR12544599_1.fastq and SRR12544599_2.fastq. Upload the report (just the .html files) that was generated by running fastqc. 1.2 Was there warnings reported in…

Continue Reading Solved 1. Download fastq files using the command below, and

1. Download fastq files using the command below, and

Transcribed image text: 1. Download fastq files using the command below, and answer the questions: fastq-dump -X 1000 –split-files SRR12544599 1.1 Run fastQC on the two fastq files: SRR12544599_1.fastq and SRR12544599_2.fastq. Upload the report (just the .html files) that was generated by running fastqc. 1.2 Was there warnings reported in…

Continue Reading 1. Download fastq files using the command below, and

Genetic diversity of hepatitis B virus quasispecies in different biological compartments reveals distinct genotypes

Tong, S. & Revill, P. Overview of hepatitis B viral replication and genetic variability. J. Hepatol. 64(1 Suppl), S4–S16 (2016). Article  CAS  PubMed  PubMed Central  Google Scholar  Kramvis, A. Genotypes and genetic variability of hepatitis B virus. Intervirol. 57(3–4), 141–150 (2014). Article  Google Scholar  Cao, L. et al. Coexistence of…

Continue Reading Genetic diversity of hepatitis B virus quasispecies in different biological compartments reveals distinct genotypes

Scan report for “s1.fastqc.com” – Online Nmap scanner

Fast Scan (nmap -F …)Nmap scan (nmap …)Ping Scan (nmap -sP …)Port scan (nmap -sV -p 21,22,25,80,110,143,443,445 …)Scan OS information and Traceroute (nmap -A …)OS Detection (nmap -O …)CVE-2021-41773 Path Traversal (nmap –script=http-vuln-cve-2021-41773 -p 80,443,631,7080,8080,8443,8088,5800,3872,8180,8000 …) $ Forward-confirmed Reverse DNS (nmap -sn -Pn –script fcrdns …) $ Firewall Detection (nmap…

Continue Reading Scan report for “s1.fastqc.com” – Online Nmap scanner

Targeted knockout of a conserved plant mitochondrial gene by genome editing

Plant material and growth conditions Nicotiana tabacum cultivar Petit Havana was used for all experiments. The TALEN design and the TALEN-expressing line Nt-JF1006-30 were described previously19. For plant growth under sterile conditions, surface-sterilized seeds were germinated on Murashige and Skoog (MS) medium52 consisting of premixed MS salts and modified vitamins…

Continue Reading Targeted knockout of a conserved plant mitochondrial gene by genome editing

Is it possible to run MultiQC on different batches of files?

Is it possible to run MultiQC on different batches of files? 1 Dear all, Is it possible to run MultiQC for a few files in a folder and not all of them? For example: file1_fastqc.html file1_fastqc.zip file2_fastqc.html file2_fastqc.zip file3_fastqc.html file3_fastqc.zip file4_fastqc.html file4_fastqc.zip I want to run MultiQC only for 1…

Continue Reading Is it possible to run MultiQC on different batches of files?

Manage the wrappers in Snakemake

I am trying to make a Snakemake pipeline using a configuration file config.yaml. — samples: – Sample_1: reads/raw_reads_1 – Sample_2: reads/raw_reads_2 – Sample_3: reads/raw_reads_3 reference: – “path/to/reference.fasta” … Following the good practices given in the Snakemake wrapper repository, I have used wrappers commands as much as possible. snakemake-wrappers.readthedocs.io/en/stable/ However I…

Continue Reading Manage the wrappers in Snakemake

The Clinical Impact of mNGS for the Diagnosis of PJI

Introduction The total number of periprosthetic joint infection cases is increasing with the surging numbers of joint arthroplasties, internal fixation implantation and the use of immunosuppressive agents.1,2 Unfortunately, the identification of corresponding pathogens remains time-consuming and challenging because of inert bacteria, biofilm formation and prior antibiotic administration.3–8 Metagenomic next-generation sequencing…

Continue Reading The Clinical Impact of mNGS for the Diagnosis of PJI

PTEN-induced kinase 1 gene single-nucleotide variants as biomarkers in adjuvant chemotherapy for colorectal cancer: a retrospective study | BMC Gastroenterology

Tissue samples A total of 84 analytic samples from surgical or biopsy specimens were collected from 84 patients who underwent radical surgery for CRC at Saitama Medical University International Medical Center between January and December 2016. One case was excluded because the specimen was too small; therefore, we used a…

Continue Reading PTEN-induced kinase 1 gene single-nucleotide variants as biomarkers in adjuvant chemotherapy for colorectal cancer: a retrospective study | BMC Gastroenterology

Rna req analysis using FASTA file

Rna req analysis using FASTA file 0 I am trying to convert FASTA sequences for SARS CoV-2 from GISAID into read counts matrix for Rna seq analysis. I tried doing the same on galaxy after assigning dummy scores to my Fasta file to convert it to fastqc format and then…

Continue Reading Rna req analysis using FASTA file

EMBL-EBI Training course | Metagenomics bioinformatics at MGnify

Learn about the tools, processes, and analysis approaches used by MGnify in the field of genome-resolved metagenomics. This course will cover the use of publicly available resources to manage, share, analyse, and interpret metagenomics data, focussing primarily on the assembly-based approaches used in MGnify analysis. The delivered content will involve…

Continue Reading EMBL-EBI Training course | Metagenomics bioinformatics at MGnify

Unmapped Reads in Kallisto

Unmapped Reads in Kallisto 1 Hi, I’m using kallisto and bustools for single cell RNA-seq, in a similar way to what is done in the Pall Melsted et. al. paper here: www.biorxiv.org/content/10.1101/673285v1 I’m trying to get an idea of what information is in the reads that aren’t aligned to anything,…

Continue Reading Unmapped Reads in Kallisto

Methamphetamine-induced region-specific transcriptomic and epigenetic changes in the brain of male rats

Jayanthi, S., McCoy, M. T. & Cadet, J. L. Epigenetic Regulatory Dynamics in Models of Methamphetamine-Use Disorder. Genes 12, 1614 (2021). Article  CAS  Google Scholar  Meredith, C. W., Jaffe, C., Ang-Lee, K. & Saxon, A. J. Implications of chronic methamphetamine use: a literature review. Harv. Rev. Psychiatry 13, 141–154 (2005)….

Continue Reading Methamphetamine-induced region-specific transcriptomic and epigenetic changes in the brain of male rats

Solved We are working with the fastq files in this

Transcribed image text: We are working with the fastq files in this directory: Generate a fastqc report for each fastq file in that directory. Look at the “Per base sequence quality” file and compare them, then choose the correc answers below. The mean quality of the illumina reads is higher…

Continue Reading Solved We are working with the fastq files in this

How to install fastqc on Ubuntu 20.04 (Focal Fossa)?

Quick installation of fastqc Architecture: all Version: 0.11.9+dfsg-2: Step 1: Update system: sudo apt-get update Step 2: Install: fastqc Architecture: all Version: 0.11.9+dfsg-2 Ater updaing the OS run following command to install the packae: sudo apt-get install fastqc Architecture: all Version: 0.11.9+dfsg-2 Package Details Package: fastqc Architecture: all Version: 0.11.9+dfsg-2 Version: 0.11.9+dfsg-2 Maintainer: Ubuntu Developers Home page: www.bioinformatics.babraham.ac.uk/projects/fastqc/…

Continue Reading How to install fastqc on Ubuntu 20.04 (Focal Fossa)?

Comparative analysis of bioinformatics tools to characterize SARS-CoV-2 subgenomic RNAs

Introduction The coronavirus infectious diseases-2019 worldwide pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is currently ongoing after being emerged from Wuhan (China) in December 2019 (Ecdc, 2020; Zhu et al, 2020; Spiteri et al, 2020). Up to now, SARS-CoV-2 has infected more than 750 million people and…

Continue Reading Comparative analysis of bioinformatics tools to characterize SARS-CoV-2 subgenomic RNAs

KCNQ potassium channels modulate Wnt activity in gastro-oesophageal adenocarcinomas

Introduction The KCNQ (potassium voltage-gated channel subfamily Q) family of ion channels encode potassium transporters (1). KCNQ proteins typically repolarise the plasma membrane of a cell after depolarisation by allowing the export of potassium ions, and are therefore involved in wide-ranging biological functions including cardiac action potentials (2), neural excitability…

Continue Reading KCNQ potassium channels modulate Wnt activity in gastro-oesophageal adenocarcinomas