Tag: GATK
Visualize variants and percentage of variants from one sample of Amplicon Seq data?
Visualize variants and percentage of variants from one sample of Amplicon Seq data? 0 Hello, We are analyzing viral evolution by analyzing mutations present in a specific genomic location and how it evolves over time. We are performing amplicon sequencing of a specific region that is 222-228 bp at intervals….
Cost-effective and accurate genomics analysis with Sentieon on AWS
This blog post was contributed by Don Freed, Senior Bioinformatics Scientist, and Brendan Gallagher, Head of Business Development at Sentieon; and Olivia Choudhury, PhD, Senior Partner Solutions Architect, Sujaya Srinivasan, Genomics Solutions Architect, and Aniket Deshpande, Senior Specialist, HPC HCLS at AWS. The year 2022 was an exciting one for genomics…
How to calculate tumor mutation burden (TMB)?
How to calculate tumor mutation burden (TMB)? 0 Hi I’ve tumor-normal WES data and I’ve analyzed data using GATK-Mutect2 pipeline to call somatic mutations. Now can anyone let me know hoe to calculate tumor mutation burden or mutation rate of my samples? I’m not able to find out the base…
Critical criteria for filtering variants by VariantFiltration
Critical criteria for filtering variants by VariantFiltration 0 Hi all. I run the GATK VariantFiltration with the following parameters (according to GATK recommendation) to find robust variants. Then I used them as input for annotating variants. Do you have any suggestions for better filtration? Is it recommended to run VariantFiltration…
Principal Bioinformatics Software Engineer, Java Development at Roche in Santa Clara, CA 202201-103435
The Position This position may be based out of Santa Clara, California, USA, with remote work locations possible in The United States. Impact Healthcare Roche Sequencing is not only changing science, but we are changing lives. Our software teams are laying the groundwork for the future by developing powerful bioinformatics…
Genetic determinants and absence of breast cancer in Xavante Indians in Sangradouro Reserve, Brazil
Ethics statement Authorization from Fundação Nacional do Índio (FUNAI) was acquired after approval from the Research Ethics Committee of the Faculty of Medicine in the Federal University of Mato Grosso (UFMT), and the National Commission of Research Ethics (authorization #1004/2001). Written consents, which were recorded and archived, were acquired from…
PHG Load haplotype and create consensus
Here, presented my PHG scripts, config, wgs_keyfile. 1. Create valid intervals docker run –name test_assemblies –rm -v /DATA/jysong/PHG/ver1.0_phg/:/phg/ -t maizegenetics/phg:1.0 /tassel-5-standalone/run_pipeline.pl -Xmx100G -debug -configParameters /phg/Masterconfig.txt -CreateValidIntervalsFilePlugin -intervalsFile /phg/inputDir/reference/glyma.Wm82.gnm4.ann1.T8TQ.gene_models_main.bed -referenceFasta /phg/inputDir/reference/glyma.Wm82.gnm4.4PTR.genome_main.fixed.fna.gz -mergeOverlaps true -generatedFile /phg/validBedFile.bed -endPlugin &> Log/1.Create_validinterval.txt & 2. Create initial DB docker run –name create_initial_db –rm -v /DATA/jysong/PHG/ver1.0_phg/:/phg/ -t…
Filtering methods for samtools or GATK
Filtering methods for samtools or GATK 1 Hello everyone! I just started my PhD and my level of expertise is fairly low about bioinformatics! Is there any advice regarding different covarege levels?( 10x vs 50x or more ). I would need simple instructions for filtering using either samtools or GATK….
Single-nuclei transcriptomics enable detection of somatic variants in patient brain tissue
Study overview We established a workflow to compare performance between the 10 × Genomics Chromium NextGEM Single-Cell 3’ and 5’ gene expression kits and evaluate detection of known germline and somatic variants in the resulting datasets (Fig. 1). For these analyses, we obtained frozen resected brain tissue from three pediatric patients treated for…
Hypersaline Lake Urmia: a potential hotspot for microbial genomic variation
Physico-chemical features of Lake Urmia Sampling was performed during the period of lowest rainfall and input volume in the year when the lake water reached the highest salt concentration (locations shown in Fig. 1, Supplementary Table S1). The measured ionic composition of the collected brine showed the typical composition of halite-dominated…
dbSNP and indels
dbSNP and indels 0 I am working on WGS on bos indicus using ARS-UCD1.2 reference genome. However, I have no idea where to download known sites (indels and dbSNPs in vcf format) for base quality recalibration in GATK. Is there any one who would suggest me the link? thank you…
Comparison of calling pipelines for whole genome sequencing: an empirical study demonstrating the importance of mapping and alignment
Sample preparation We ordered the GIAB samples from the Coriell Institute (NA24385, NIST ID HG002; NA24149, NIST-ID HG003 and NA24143, NIST-ID HG004). DNA concentration was measured by Qubit. The library was constructed according to Illumina TruSeq DNA PCR Free Library Prep protocol HT (Illumina Inc., San Diego, CA, USA) for…
Genome Bioinformatics Analyst at UPMC
Description The Genome Bioinformatics Analyst works independently to curate disease, gene and variant knowledge including variant interpretation, reporting and consultation with laboratory staff, physicians and genetic counselors. The analyst participates in clinical test development, validation and maintenance of data analysis pipelines, monitoring of quality metrics and the analysis of large…
Scatter Gather principle by chromosome on Gatk
Scatter Gather principle by chromosome on Gatk 0 Hi all, On a quest to optimize gatk pipeline, I met scatter gather principle, so I did following, pids= for chr in chr1 chr2 chr3 chr4 chr5 chr6 chr7 chr8 chr9 chr10 chr11 chr12 chr13 chr14 chr15 chr16 chr17 chr18 chr19 chr20…
Technical Program Manager, Bioinformatics at Twist Bioscience
Sr. Technical Program Manager, Bioinformatics Twist’s Program Management Office (PMO) is seeking an innovator, leader, and problem solver to enable the tremendous growth of Twist’s Next Generation DNA synthesis business. As a Technical Program Manager, you will be based within the PMO but will partner closely with bioinformatics and R&D…
Detecting de novo SNV with vcftools
Detecting de novo SNV with vcftools 1 Hi, all. I have a raw whole genome sequence data of a kind of fish trio: father, mother and offspring. I would like to know how many SNV loci there are in the child but not in the parent (i.e. de novo SNV…
As of July 2015, the VCFtools project has been moved to github! Please visit the new website here: vcftools.github.io/man_0112a.html
NAME SYNOPSIS DESCRIPTION EXAMPLES BASIC OPTIONS SITE FILTERING OPTIONS INDIVIDUAL FILTERING OPTIONS GENOTYPE FILTERING OPTIONS OUTPUT OPTIONS COMPARISON OPTIONS AUTHOR NAME VCFtools v0.1.12a − Utilities for the variant call format (VCF) and binary variant call format (BCF) SYNOPSIS vcftools [ –vcf FILE | –gzvcf FILE | –bcf FILE]…
GATK vs DeepVariant : bioinformatics
Hi everyone, I am currently working on a medium-sized WES cohort study and wanted to know what the bioinformatics community would regard a cutting-edge workflow. As the big labs usually utilize GATK I also started with that. The results for SNPs are ok, but manual inspection (IGV) still uncovers a…
Job – Principal Biostistician/Bioinformatics job at Kenya Medical Research
Vacancy title: Principal Biostistician/Bioinformatics [ Type: FULL TIME , Industry: Research , Category: Research ] Jobs at: Kenya Medical Research – KEMRI Deadline of this Job: 06 October 2022 Duty Station: Within Kenya , Kisumu , East Africa SummaryDate Posted: Tuesday, September 20, 2022 , Base Salary: Not Disclosed…
Bioinformatics Scientist in Pittsburgh, PA
Description Purpose:The scientist works independently using a robust math toolbox to discover solutions for a diverse portfolio of interesting and challenging problems. The scientist develops, implements, and monitors advanced analytic, medical informatics, and predictive modeling tools for health care programs at the UPMC. The scientist normally works Monday through Friday…
Joint variant calling on DeepVariant GVCFs using GATK GenotypeGVCFs
Joint variant calling on DeepVariant GVCFs using GATK GenotypeGVCFs 0 Hi everyone I have a bunch of GVCF files generated by DeepVariant, but I want to use GATK’s GenotypeGVCFs for joint variant calling on them (I don’t want to use GLnexus). But GATK requires a genotype likelihood field produced by…
Principal Software Engineer – Bioinformatics Job in Mississauga, Ontario – Hoffmann-La Roche Ltd
Impact HealthcareRoche Sequencing is not only changing science, but we are changing lives. Our software teams are laying the groundwork for the future by developing powerful bioinformatics algorithms, data analysis tools, and software/systems infrastructures so researchers and clinicians can make better health decisions faster. The path to curing cancer lies…
iPSCs derived from infertile men carrying complex genetic abnormalities can generate primordial germ-like cells
Patients and controls The patient 1 was 38 years old and consulted for infertility after he and his partner had been trying to conceive for 2 years. The patient was the first child of unrelated parents, and he had four brothers and five sisters whose fertility status could not be determined…
using gatk haplotypecaller for variants extraction
using gatk haplotypecaller for variants extraction 0 Hi, I have rna-sequenced data from covid patients. I am using hisat2 for aligning the reads to reference. So, the resulted bam files after indexing are now ready. I would like to use gatk happlotypecaller for extracting variants from my bam files. First,…
Bioinformatics Analyst in Minneapolis, MN for University of Minnesota, Twin Cities
Details Posted: 13-Aug-22 Location: Minneapolis, Minnesota Salary: 43944.32 – 123022.07 Categories: Research Support – Laboratory/Non-Laboratory Staff/Administrative Additional Information: 2 openings available. The Research Informatics Solutions (RIS) group within the University of Minnesota Supercomputing Institute (MSI) is hiring two full-time Bioinformatics Analysts to support research at the University of Minnesota. Analysts…
Genomic architecture of adaptive radiation and hybridization in Alpine whitefish
Sampling the radiation To understand the phylogenetic relationships between Alpine whitefish, we carried out whole-genome resequencing on 96 previously collected whitefish (with associated phenotypic measurements including standard length and gill-raker counts; collected in accordance with permits issued by the cantons of Zurich (ZH128/15), Bern (BE68/15), and Lucerne (LU04/14); these fish…
Standalone GATK HaplotypeCaller : bioinformatics
Hello! I’m hoping someone can direct me to resources around acquiring or building standalone gatk tools, specifically HaplotypeCaller. All of my research has led to the monolithic gatk wrapper (either local, spark, or in docker). The big tool is brilliant and I’ve been using it thus far, but it’s pretty…
08 compare visualization results of different annotation software
stay In the first two sections , We compared the differences vcf Use of annotation software , And convert the demerit recorded after the annotation into maf File format , because snpeff The comment result cannot be converted to maf, So we will compare later ANNOVAR、VEP、GATK Funcatator The results of…
Allelic expression imbalance of PIK3CA mutations is frequent in breast cancer and prognostically significant
Subjects Normal breast and tumor samples were obtained with the written informed consent from donors and appropriate approval from local ethical committees, with the detailed information described in the respective original publications: normal tissue9, METABRIC14, TCGA35. Differential allelic expression analysis DNA and total RNA from 64 samples of normal breast…
Seven Bridges, Brazilian Researchers Applying Graph Analysis to Build Diverse Reference Genome
CHICAGO – The latest of Seven Bridges Genomics’ efforts to diversify reference genomes is its largest and perhaps most complex to date, an attempt to address the Brazilian population. The Charlestown, Massachusetts-based bioinformatics company recently joined with the University of São Paulo (USP), the Associação Genomas Brasil (Brazil Genome Association),…
Extract R1 and R2 from sam file generated by bowtie2
Extract R1 and R2 from sam file generated by bowtie2 1 Hi every one How to extract R1 and R2 from sam file generated by bowtie2 ? sam bowtie2 samtools bam • 137 views • link updated 14 hours ago by iraun ★ 4.4k • written 15 hours ago by…
Detailed differences between sambamba and samtools
3 month , My first post in the new student group , The false-positive mutation appears because duplicates mark Not enough ?, Tells the story of supplementary read It won’t be GATK MarkDuplicates Marked as duplicates The problem of . after , In response to this question , I began…
Parse a file of strings in python separated by newline into a json array
I don’t see where you’re actually reading from the file in the first place. You have to actually read your path_text.txt before you can format it correctly right? with open(‘path_text.txt’,’r’,encoding=’utf-8′) as myfile: content = myfiel.read().splitlines() Which will give you [‘/gp/oi/eu/gatk/inputs/NA12878_24RG_med.hg38.bam’, ‘/gp/oi/eu/gatk/inputs/NA12878_24RG_small.hg38.bam’] in content. Now if you want to write this…
Hard filtering on GATK HaplotypeCaller giving multiple warnings
I’m using this pipeline for deriving variants from RNA sequencing data: github.com/modupeore/VAP which uses specific versions of various tools, including HaplotypeCaller from GATK (v3.8-0-ge9d806836). The final step is a set of hard filters on the called variants (applied using VariantFilter), but looking at the log files, there are a lot…
Bioinformatics Analyst II – Remote in Danville, PA for Geisinger
Details Posted: 22-Apr-22 Location: Danville, Pennsylvania Type: Full Time Salary: Open Categories: Operations Job Summary Primary accountability is to leverage the organization’s data assets exome sequencing data (>180,000 individuals) from MyCode Community Health Initiative to improve quality, efficiency and generate knowledge specifically in the field of bioinformatics within health research….
Bioinformatics Scientist for Whole Genome and Whole Exome Sequencing
** Bioinformatics Scientist for Whole Genome and Whole Exome Sequencing ** The NeuroGenomics and Informatics (NGI) Center lead by Dr. Carlos Cruchaga at Washington University School of Medicine is recruiting a Bioinformatics Scientist to work on Whole Genome and Whole Exome Sequencing. We are seeking an experienced, self-motivated, self-driven scientist…
Pangenome-based genome inference allows efficient and accurate genotyping across a wide spectrum of variant classes
Sequencing data We used publicly available sequencing data from the GIAB consortium45, 1000 Genomes Project high-coverage data46 and Human Genome Structural Variation Consortium (HGSVC)4. All datasets include only samples consented for public dissemination of the full genomes. Statistics and reproducibility For generating the assemblies, we used all 14 samples for…
Bioinformatics Pipeline Development Engineer II at Personalis, Inc
Personalis, Inc. is a leader in advanced cancer genomics for enabling the next generation of precision cancer therapies and diagnostics. The Personalis NeXT Platform® is designed to adapt to the complex and evolving understanding of cancer, providing its biopharmaceutical customers and clinicians with information on all of the approximately 20,000 human genes,…
how to extract unique variants from GVCF
how to extract unique variants from GVCF 1 [note: cross-posted on GATK forum – still awaiting a response] I have a GVCF (generated using GATK’s HaplotypeCaller w/ -ERC GVCF parameter) of 36 related samples and would like to determine the (potentially de novo) variants that are unique to each sample….
Variant quality and filters on GATK HaplotypeCaller generated VCFs
Variant quality and filters on GATK HaplotypeCaller generated VCFs 0 Hi, I am analysing human WGS data to diagnose rare inherited diseases. I followed the GATK Best Practices Guidelines for “Germline short variants discovery” for single-sample data to generate a VCF using HaplotypeCaller. The guidelines then point to the use…
rna seq – RNAseq SNP discovery: deciding upon filters and dealing with allele expression bias
I am working with non-model plant RNA samples which we have been deep sequenced and analysed using STAR aligner under default parameters. Aim We would like to conduct SNP discovery of these samples. Objective Our ultimate goal with this genotypic data is to search for variants (both SNPs and indels)…
Color hiring Software Engineer, Bioinformatics in Remote
About Color Color’s mission is to help people lead the healthiest lives that science and medicine can offer. We launched in April 2015 with a simple, affordable genetic test to help people understand their risk for hereditary cancer. In 2017, we added coverage for hereditary heart conditions. Between them, cancer…
vcf – Why does GATK produce both 0/1 and 1/0 genotypes in the same file? Are the two not equivalent?
I have always thought that 1/0 and 0/1 in VCF genotype fields are equivalent. And yet, GATK uses both. For example, these are two variants called in the same sample and the same run of GATK 4.1.4.0: chr7 117120317 . ATTCATTGTTTTGAAAGAAAGATGGAAGAATGAACTGAAG A 748.97 . AC=1;AF=0.5;AN=2;DP=64;ExcessHet=3.0103;FS=0;MLEAC=1;MLEAF=0.5;MQ=60;QD=11.89;SOR=7.223 GT:AD:DP:GQ:PL:SB 1/0:0,36:63:99:2294,1042,933:0,0,0,36 chr7 117120306 ….
BTG2 gene predicts poor outcome in PT-DLBCL
Introduction Primary testicular diffuse large B-cell lymphoma (PT-DLBCL) is a rare and aggressive form of mature B-cell lymphoma.1–3 PT-DLBCL was the most common type of testicular tumor in men aged over 60 and characterized by painless uni- or bilateral testicular masses with infrequent constitutional symptoms.4–6 PT-DLBCL shows significant extranodal tropism,…
HRJOB7442 Bioinformatics Scientist 2 (Various Locations) in Nether Alderley, Macclesfield (SK10) | Almac Group (Uk) Ltd
Bioinformatics Scientist 2 Hours: 37.5 hours per week Salary: Competitive Ref No: HRJOB7442 Business Unit: Diagnostic Services Location: Craigavon or Manchester Open To: Internal and External Applicants The Company Almac Diagnostic Services is a leading stratified medicine business, specialising in biomarker-driven clinical trials. We are incredibly proud to be involved…
java – GATK: HaplotypceCaller IntelPairHmm only detecting 1 thread
I can’t seem to get GATK to recognise the number of available threads. I am running GATK (4.2.4.1) in a conda environment which is part of a nextflow (v20.10.0) pipeline I’m writing. For whatever reason, I cannot get GATK to see there is more than one thread. I’ve tried different…
GATK HaplotypeCaller with interval list
I am trying to use the -L option of GATK HaplotypeCaller to call SNPs and short InDels with in an interval list. My interval list file (top8snp.interval_list) content is as follows: 12 33029845 33030845 + rs24767598 13 40586682 40587682 + rs24748362 18 24373857 24374857 + rs8856159 21 50381146 50382146 +…
bcftools merged vcf file assigns all variants to one sample
bcftools merged vcf file assigns all variants to one sample 0 I’ve made one vcf file for each of three samples. I then combined them using bcftools, like so: # Make a list of vcf files to merge cat “${OUT}/results/variants/vcf_list” /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/data/test/manual/results/variants/3a7a-10.vcf.gz /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/data/test/manual/results/variants/MF3.vcf.gz /mnt/gpfs/live/rd01__/ritd-ag-project-rd018o-mdflo13/data/test/manual/results/variants/R507H-FB_S355_L001.vcf.gz Then merge the list: bcftools merge -l…
Senior Bioinformatics Software Developer – Bethesda
Medical Science & Computing, (MSC), a Dovel company, is seeking skilled Senior Bioinformatics Software Developers to join our team supporting our client, NCBI at the National Institutes of Health, (NIH) in Bethesda, MD. The National Center for Biotechnology Information (NCBI) is part of the National Library of Medicine (NLM) at…
variant – Error running gatk HaplotypeCaller with allele specific annotations
I’ve got HaplotypeCaller working nicely in standard mode, like so: # Run haplotypcaller gatk –java-options “-Xmx4g” HaplotypeCaller –intervals “$INTERVALS” -R “$REF” -I “$OUT”/results/alignment/${SN}_sorted_marked_recalibrated.bam -O “$OUT”/results/variants/${SN}_g.vcf.gz -ERC GVCF But when I try in allele-specific mode, I get the following error. All I’ve done is add the -G annotations at the end,…
Variant calls of published already assembled genomes
Variant calls of published already assembled genomes 0 I have a set of short read sequencing for the 172 KB Epstein-barr virus genome. We successfully called our variants using GATK to a reference genome. A publication linked below from a different population compared variants (also from short read sequencing) to…
Do VQSR for HaplotypeCaller calls – Sarek
Expected Behavior Filter the calls from HaplotypeCaller with Variant Quality Score Recalibration according to GATK best practise (Tools VariantRecalibrator, ApplyRecalibration, see gatkforums.broadinstitute.org/gatk/discussion/39/variant-quality-score-recalibration-vqsr or a more recent version) Current Behavior Variant quality score recalibration currently not included. Asked Jan 26 ’18 at 08:25 malinlarsson 1 Answer: Keep in mind, that you’d…
sequence alignment – MarkDuplicatesSpark failing with cryptic error message. MarkDuplicates succeeds
[*] I have been trying to follow the GATK Best Practice Workflow for ‘Data pre-processing for variant discovery’ (gatk.broadinstitute.org/hc/en-us/articles/360035535912). This has all been run on Windows Subsystem for Linux 2 on the Bash shell. I started off with FASTQ files from IGSR (www.internationalgenome.org/data-portal) and performed alignment with Bowtie2 (instead of…
PathSeqFilterSpark
PathSeqFilterSpark 0 I have been trying to filter out low-quality bases on my task to conduct a variant annotation, meanwhile, I have completed all previous steps required. However, when I try to filter out low-quality bases after BQSR (GATK), the PathSeqFilterSpark did not yield a output file. There was no…
GATK GenotypeGVCFs changes HET to REF_ALT
Dear all, I’ve been using GATK HaplotypeCaller / GenotypGVFs (v4.2.3.0) for a while but, recently found something strange. There is a position (7063) with 8 reads (3T + 5A) that, even though HaplotyCaller calls as a HET (see image, lower track): NC_046966.1 7063 . T A,<NON_REF> 177.64 . BaseQRankSum=0.887;DP=8;ExcessHet=3.0103;MLEAC=1,0;MLEAF=0.500,0.00;MQRankSum=2.369;RAW_MQandDP=16885,8;ReadPosRankSum=1.345 GT:AD:DP:GQ:PL:SB…
Systems biology analysis of human genomes points to key pathways conferring spina bifida risk
Significance Genetic investigations of most structural birth defects, including spina bifida (SB), congenital heart disease, and craniofacial anomalies, have been underpowered for genome-wide association studies because of their rarity, genetic heterogeneity, incomplete penetrance, and environmental influences. Our systems biology strategy to investigate SB predisposition controls for population stratification and avoids…
Benchmarking the NVIDIA Clara Parabricks germline pipeline on AWS
This blog post was contributed by Ankit Sethia, PhD, and Timothy Harkins, PhD, at NVIDIA Parabricks, and Olivia Choudhury, PhD, Sujaya Srinivasan, and Aniket Deshpande at AWS. This blog provides an overview of NVIDIA’s Clara Parabricks along with a guide on how to use Parabricks within the AWS Marketplace. It…
Dragen-gatk for trio
Dragen-gatk for trio 0 Hi everyone, the Dragen gatk pipeline works great for single sample. however I would like to know if any have used this pipeline for a trio? if so how did you do it? it is recommended to do a hard filtering based on QUAL but how…
Padding out a GVCF file with 1000G exomes to get gatk VariantRecalibrator working with a small sample
I’ve got sequencing data for a small 500 bp amplicon from a few samples. GATK best principles suggest running VariantRecalibrator on the GVCF files I generate. I’m trying to get this working, but I get an error about “Found annotations with zero variances”. Reading the gatk manual and other posts…
Sr Scientist – IVD Development – Houston
NuProbe USA Inc . is looking for a Staff/Senior Scientist to lead the IVD project development program at NuProbe to support both research and in vitro diagnostic (IVD) assays for use in medical research, clinical trials, regulatory submissions, and clinical diagnostic use. NuProbe USA is a rapidly growing company and…
Large-scale genome-wide study reveals climate adaptive variability in a cosmopolitan pest
Genomic data The foundational resource for this study was a dataset of 40,107,925 nuclear SNPs sequenced from a worldwide sample of 532 DBM individuals collected in 114 different sites based on our previous project15. DNA was extracted from each of the 532 individuals using DNeasy Blood and Tissue Kit (Qiagen,…
Genome Bioinformatics Analyst – Pittsburgh
**Description** UPMC Presbyterian is hiring a Genome Bioinformatics Analyst to join the Molecular and Genomic Pathology Laboratory (MGP) team! This role will work a daylight schedule Monday through Friday. No weekends or holidays are required! The Molecular and Genomic Pathology Laboratory (MGP) is a dynamic state-of-the-art clinical laboratory that prides…
how to add reference alleles to VCF?
how to add reference alleles to VCF? 1 I’m converting gVCFs to VCF, but the reference alleles are missing. An example below: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT 180525_FD02929177 1 97547947 . T . . . DP=31 GT:DP:RGQ 0/0:31:81 1 97915614 . C . . . DP=40…
gatk VariantRecalibrator positional argument error
I’m trying to use recalibrate my vcf using gatk VariantRecalibrator, but keep getting an error “Illegal argument value: Positional arguments were provided”. But I don’t know what this means, or how to correct it! Here’s my call: gatk VariantRecalibrator -R “/Volumes/Seagate Expansion Drive/refs/hg38/gatk download/Homo_sapiens_assembly38.fasta” -V “$OUT”/results/variants/”$SN”.norm.vcf.gz -AS –resource hapmap,known=false,training=true,truth=true,prior=15.0: “/Volumes/Seagate…
Why invariant blocks in GATK consistently have very low quality scores (but not variant sites)
I am using the latest GATK 4.1.2.0 to do variant calling on insect samples with a reference genome of a closely related species. The heterozygosity is approximately 0.02. I followed the standard pipeline of “HaplotypeCaller –> GenomicDBImport –> GenotypeGVCFs” to get my unfiltered VCFs, however, although my variant sites have…
No quality in non-variant sites GATK
No quality in non-variant sites GATK 1 Heys, I am doing the SNP calling with Haplotypecaller BP_Resolution, CombineGVCFs with convert-to-base-pair-resolution and GenotypeGVCFs with include-non-variant-sites with GATK and when I get my vcf file, the non-variant sites does not have any quality at all: #CHROM POS ID REF ALT QUAL FILTER…
What is the single nucleotide polymorphism database ( dbsnp )?
The Single Nucleotide Polymorphism Database (dbSNP) is a free public archive for genetic variation within and across different species developed and hosted by the National Center for Biotechnology Information (NCBI) in collaboration with the National Human Genome Research Institute (NHGRI). Furthermore, are there any databases for single nucleotide polymorphisms?As there…
Parallel genomic responses to historical climate change and high elevation in East Asian songbirds
Extreme environments present profound physiological stress. The adaptation of closely related species to these environments is likely to invoke congruent genetic responses resulting in similar physiological and/or morphological adaptations, a process termed “parallel evolution” (1). Existing evidence shows that parallel evolution is more common at the phenotypic level than at…
VCF samtools
VCF samtools 0 Hello, I am having trouble when doing variant calling with samtools. I am getting only the header an no variants. If I would instead use Freebayes, I do get a lot of variables, and with Gatk, I get just a few. What can the problem be? Do…
Somatic Variant Calling
Somatic Variant Calling 2 Hi, I need to call somatic variants from a BAM file of cancer panel. Can anyone please suggest any suitable tool for calling the variants and generate a VCF file. Thank You BAM NGS Variants Cancer • 53 views “Suitable” is very context-dependent, are you working…
Making consensus sequence for each haplotype
Making consensus sequence for each haplotype 0 I’m dealing with paired end amplicon sequencing data. I’ve produced a GVCF file with haplotype calls using: gatk HaplotypeCaller -R $REF -I “$BAM” -O “$OUT”/results/variants/${SN}_HaplotypeCallerPGT.vcf -ERC GVCF The vcf file it produces contains the PGT flag, and variants are called in the format…
state and usuge of compressed file standards better than BAM and FASTQ
Forum:2021: state and usuge of compressed file standards better than BAM and FASTQ 3 Extra compressed formats for raw/aligned reads and variant tables have been around for some time but I think saw slow adoption. Our current disk space usage is making us have another look at switching to file…
how to do basic statistics for bam files
how to do basic statistics for bam files 1 Hi Bistar teams, I have unpaired Exom-seq data. I did the quality control and alignment. Now my files are in bam format and I would like to do some basic statistics like fragment size, coverages, mismatches, Gaps , duplicates etc ….
Gatk pipeline wdl on multiples sample input
Gatk pipeline wdl on multiples sample input 0 Hello all, i would like to use gatk pipelines with cromwell on our hpc, however for germline single sample pipeline i wanted to know if there is a way to run it directly on multiple samples? I can’t see myself writing more…
Best way to merge multiple VCF files
Best way to merge multiple VCF files 3 Hi, I am trying to merge a bunch of vcf files into one vcf of known SNPs. The files are separated by chromosome. I am trying to figure out how to merge all the files but in a way that the chromosome…
Using IndexFeatureFile to index vcf
Using IndexFeatureFile to index vcf 0 I have a number of vcfs that I need to index (create .idx files), which I attempted to do with GATK, e.g. java -Xmx5g -jar $gatk_path/GenomeAnalysisTK.jar -T IndexFeatureFile -F N03_INDELS.vcf Which returns an invalid argument error even though the vcf file is, as far…
Add or reveal read groups on .sam file aligned by BWA
Add or reveal read groups on .sam file aligned by BWA 0 Hi, I’m trying to use GATK HaplotypeCaller but everytime I run its says A USER ERROR has occurred: Argument emit-ref-confidence has a bad value: Can only be used in single sample mode currently. Use the –sample-name argument to…
how to visually compare BAM file differences
how to visually compare BAM file differences 0 I am a Bioinformatics novice learning workflow of calling somatic mutation . I found actions related to BAM file are these : sort, markdup ,reorder ,indel realignment,BQSR , I want to known the differences of them after I execute one step ….
best practice to design and reuse a process/worfklow
Let’s say I want to genotype a set of BAMs using GATK. A basic DSL2 nextflow workflow would look like: workflow { take: reference beds bams main: hc = haplotypecaller(reference,bams.combine(beds)) bed2vcf = combinegvcf(hc.groupTuple()) vcf = gathervcfs(bed2vcf.collect()) } process haplotypecaller { input: val(reference) tuple val(bam),val(bed) output: tuple bed,path(“sample.g.vcf.gz”) script: “”” gatk…
What is GenotypeGVCFs?
Hello! This article gatk.broadinstitute.org/hc/en-us/articles/360035535932-Germline-short-variant-discovery-SNPs-Indels- says i should use HaplotypeCaller in GVCF mode and GenotypeGVCFs then, and this article gatk.broadinstitute.org/hc/en-us/articles/360035531192-RNAseq-short-variant-discovery-SNPs-Indels- advises to use HaplotypeCaller without GenotypeGVCFs. I tried the former (with one sample), and the result is similar to the result of HaplotypeCaller in non-GVCF mode, however it differs in some…
Consensus sequence for phased variant calls
Consensus sequence for phased variant calls 0 I’ve got paired end sequencing data from a ~500 bp amplicon. I’ve aligned the data and called variants using gatk to phase the variants, as follows. The phasing information is now under the PGT tag. gatk HaplotypeCaller -R $REF -I “$BAM” -O “$DIR”/variants/${SN}_HaplotypeCallerPGT.vcf…
Bioinformatics Engineer Job Opening in St. Louis, MO at Benson Hill
About Benson HillBenson Hill empowers innovators to develop more healthy, tasty and sustainable food by unlocking the natural genetic diversity of plants. Benson Hill’s CropOS™ platform combines machine learning and big data with advanced breeding techniques and plant biology to drastically accelerate and simplify the product development process. The CropOS…
Confusion regarding manual inclusion of read group information from fastq files
I have recently received a collection of paired-end fastq files (WES) from our collaborators. I am following the GATK best practices workflow. I have completed the alignment, sorting&indexing step and generated a list of bam files. However, upon further inspection, I found out that the bam files do not have…
The mtDNA mutation spectrum in the PolG mutator mouse reveals germline and somatic selection | BMC Genomic Data
1. Taylor RW, Turnbull DM. Mitochondrial DNA mutations in human disease [Internet]. Vol. 6, Nature Reviews Genetics. Europe PMC Funders; 2005 [cited 2020 Aug 21]. p. 389–402. Available from: /pmc/articles/PMC1762815/?report=abstract. 2. Kabunga P, Lau AK, Phan K, Puranik R, Liang C, Davis RL, Sue CM, Sy RW Systematic review of…
LeftAlignIndels error
LeftAlignIndels error 0 Hello! I input sorted and indexing bam file to LeftAlignIndels: ~/Soft/gatk-4.1.9.0/gatk LeftAlignIndels -I bam_fin/Exome_dups.bam -R /mnt/lapd/Index_hum/dna2/GRCh_2021.fa -O bam_fin/Exome.bam And have this error: ‘java.lang.IllegalArgumentException: Alignments added out of order in SAMFileWriterImpl.addAlignment for file:///mnt/lapd/Vika_data/RNF_raw/exome/bam_fin/Exome.bam. Sort order is coordinate. Offending records are at [1:152985370] and [1:152985347] at htsjdk.samtools.SAMFileWriterImpl.assertPresorted(SAMFileWriterImpl.java:197) at htsjdk.samtools.SAMFileWriterImpl.addAlignment(SAMFileWriterImpl.java:184)…
Bioinformatics Scientist at Infectious Disease Institute
IDI seeks to hire a Bioinformatics Scientist (BS) for the centre. The BS will be a fulltime staff who is familiar with the application of computational and biotechnology capabilities to biomedical and public health problems like genetics, clinical and medical research, as well as other data intensive analyses. By coordinating…
GATK CNV Caller – issue with PostprocessGermlineCNVCalls
Hi there, I’m running gatk PostprocessGermlineCNVCalls for a cohort of hg19 aligned WES samples. I’m following the suggested pipeline here: gatk.broadinstitute.org/hc/en-us/articles/360035531152–How-to-Call-common-and-rare-germline-copy-number-variants#5 However, in the final step when I try to process CNV calls for an individual sample, I get the following error, asking me to run FilterIntervals, but I’ve already…
how to install picard and GATK
how to install picard and GATK 1 Hi all I want to install the current version of the picard and GATK software using Ubuntu terminal on windows PC for some genomics analysis. I have the current version java but could not able to install picard. Well I download the entire…
Polyploidy found, and not supported by vcftools for a diploid data set.
Polyploidy found, and not supported by vcftools for a diploid data set. 0 Hi, I used gatk mutect2-select variant (retained only SNPs)-combinegvcfs to generate a vcf file for a diploid species. When I tried to process the vcf file using vcf tools, some of the commands did work, however, when…
Manager, Bioinformatics Verification and Validation
Personalis is a rapidly growing cancer genomics company transforming the development of next-generation therapies by providing more comprehensive molecular data about each patient’s cancer and immune response. Our ImmunoID NeXT Platform is enabling the development of next generation immuno-oncology therapeutics and diagnostics. Summary: You will join a team of bioinformaticians…
Phasing using Beagle with a map file
I’d like to phase the SNPs in a vcf file and output consensus files for each haplotype, as suggested in this post: www.biostars.org/p/298635/ I’ve managed to install beagle in a conda environment: conda create -n beagle -c conda-forge -c bioconda beagle conda activate beagle When I run beagle using this…
Post filtering analysis for exome data
Post filtering analysis for exome data 0 Hello I am following GATK pipeline to process exome data set. I am done with preprocessing step and filtered the dataset by hard filtering method. Now, I am looking for variants shared between the affected individuals. In the vcf file, I get the…
heterozygous SNV AB>0.15, heterozygous indel
heterozygous SNV AB>0.15, heterozygous indel<0.20 in UKB-WES 0 These gVCFs were joint genotyped using GLnexus (www.biorxiv.org/content/10.1101/572347v1) to create a single, unfiltered project-level VCF (pVCF). Genotype depth filters (SNV DP≥7, indel DP≥10) were applied prior to variant site filters requiring at least one variant genotype passing an allele balance filter (heterozygous…
Dictionary cannot have size zero
GATK RealignerTargetCreator: IllegalArgumentException: Dictionary cannot have size zero 0 I am new to variant calling and trying to create realignment targets using GATK but keep getting this error, despite having a dictionary file: java.lang.IllegalArgumentException: Dictionary cannot have size zero at org.broadinstitute.gatk.utils.MRUCachingSAMSequenceDictionary.<init>(MRUCachingSAMSequenceDictionary.java:62) at org.broadinstitute.gatk.utils.GenomeLocParser$1.initialValue(GenomeLocParser.java:78) at org.broadinstitute.gatk.utils.GenomeLocParser$1.initialValue(GenomeLocParser.java:75) at java.lang.ThreadLocal.setInitialValue(ThreadLocal.java:180) at java.lang.ThreadLocal.get(ThreadLocal.java:170) at…
GATK4 -known-sites input Recalibrate Base Quality Scores
GATK4 -known-sites input Recalibrate Base Quality Scores 0 I am working with a non-reference plant species that I want to call variants from after aligning to a closely related species reference genome. I am following the GATK4 best practices pipeline, but I would like to know how I should proceed…
Interploidy gene flow involving the sexual-asexual cycle facilitates the diversification of gynogenetic triploid Carassius fish
1. Muller, H. J. The relation of recombination to mutational advance. Mutat. Res. Mol. Mech. Mutagen. 1, 2–9 (1964). Google Scholar 2. Maynard Smith, J. The Evolution of Sex (Cambridge University Press, 1978). Google Scholar 3. Avise, J. C. Clonality (Oxford University Press, 2008). Google Scholar 4. Hamilton, W. D.,…
Personalis Senior Bioinformatics Pipeline Development Engineer
Senior Bioinformatics Pipeline Development Engineer (Remote option available) at Personalis, Inc (View all jobs) Menlo Park Personalis is a rapidly growing cancer genomics company transforming the development of next-generation therapies by providing more comprehensive molecular data about each patient’s cancer and immune response. Our ImmunoID NeXT Platform® is enabling the…
identification of ROH using plink
identification of ROH using plink 0 Hello All I generated vcf file using GATK (First Haplotypecaller –> CombinedGVCF –> GenotypeGVCF and then Hard filtering ). After this, I converted filtered vcf file into plink binary PED files (.bed, .fem, .bim, plink v1.9) using –make-bed command. However, when I used these…
Shared variants
Shared variants 1 Hello I have exome data sets from 6 individuals, in which 4 are affected and 2 are not affected. I have to identify the variants which are shared between the four affected individuals. I did the joint call genotyping for the 4 affected individuals and filtered the…
GATK HaplotypeCaller works without GVCF option, but errors with GVCF
I’ve extracted chromosome 4 from a whole genome bam file as follows: samtools view -h “$BAM” chr4 > “$EXT/temp/”$PREFIX”_chr4.sam” samtools view -bS “$EXT”/temp/$PREFIX”_chr4.sam” > “$EXT”/temp/$PREFIX”_chr4.bam” Then added read groups, as required by GATK picard AddOrReplaceReadGroups I=”$BAM” O=”$EXT”/temp/$PREFIX”_chr4_rg.bam” RGID=4 RGLB=lib1 RGPL=ILLUMINA RGPU=unit1 RGSM=20 Index the bam: samtools index “$BAM” Download the…