Tag: GenomeInfoDb

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Error in SummarizedExperiment

I have installed DESeq2 version 1.36.0 samples <- colnames(txi$counts) group <- as.factor(c(“control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”, “control”,”control”,”control”,”control”,”control”,”diet”,”diet”,”diet”,”diet”,”diet”,”diet”)) coldata <- data.frame(samples, group, stringsAsFactors = F) coldata <- coldata[,c(“samples”,”group”)] coldata$samples <- factor(coldata$samples) coldata$group <- factor(coldata$group) rownames(coldata) <- sub(“fb”, “”, rownames(coldata)) all(rownames(coldata$samples) %in% colnames(txi)) all(rownames(coldata) == colnames(txi)) TRUE library(DESeq2) ddsTxi <- DESeqDataSetFromTximport(txi, colData = coldata, design =…

Continue Reading Error in SummarizedExperiment

deseq2 problem

deseq2 problem 0 Hi I am trying to draw a PCA plot with DESeq2 but somehow I cannot use DESeq2 functions. It is a really simple code i wil be pasting below. > transform <- DESeq2::rlog(eliminated_data, blind = TRUE) Error in (function (classes, fdef, mtable) : unable to find an…

Continue Reading deseq2 problem

GDCprepare of RNAseq counts produces error

GDCprepare of RNAseq counts produces error 1 @76ac7b25 Last seen 12 minutes ago Canada Hello everyone! I have been using the TCGAbiolinks package for the last couple years to access RNAseq data for the TCGA-LAML project. Just very recently, I had noticed that I could no longer use GDCquery to…

Continue Reading GDCprepare of RNAseq counts produces error

Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

Dear friends, We are trying to use Salmon for DTU analysis. We want to separate exogenous from endogenous transcripts by following this post www.biostars.org/p/443701/ and this paper f1000research.com/articles/7-952 We are focusing on a gene called ASCL1 (endo-ASCL1). We transduced cells with lentiviral vector containing ASCL1 ORF only (Lenti-ASCL1). There should…

Continue Reading Separate exogenous from endogenous transcripts using Salmon RNAseq DTU

GDCquery_Maf error

GDCquery_Maf error 0 @76e1237b Last seen 1 day ago Singapore Hi all, I really need some help. I am trying to run GDCquery_Maf which worked fine until yesterday. Now I get the following error: Error in GDCquery(paste0(“TCGA-“, tumor), data.category = “Simple Nucleotide Variation”, : Please set a valid workflow.type argument…

Continue Reading GDCquery_Maf error

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38 1 @b14a6f0d Last seen 16 hours ago United States Are subpopulation MAFs available for gnomADv.3.1.1 with any package, like they are in MafDb.gnomAD.r2.1.hs37d5? I’m trying to use Genomic Scores to obtain all variants in a genomic range with MAF in any subpopulation >= cutoff. I tried…

Continue Reading subpopulations available in MafH5.gnomAD.v3.1.1.GRCh38

Bioconductor Package Installation

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

Continue Reading Bioconductor Package Installation

Pathway analysis of RNAseq data using goseq package

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

Continue Reading Pathway analysis of RNAseq data using goseq package

DESeq2 and high prefiltering cutoff

DESeq2 and high prefiltering cutoff 1 @255004b1 Last seen 3 hours ago United States Hi, I am curious about prefiltering with DESeq2. I understand from this site and reading the DESeq2 vignette that prefiletering is really unnecessary as DESeq2 has a stringent filtering that it does. However, I’m seeing better…

Continue Reading DESeq2 and high prefiltering cutoff

Bioconductor – TAPseq

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Continue Reading Bioconductor – TAPseq

Bioconductor – branchpointer

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Continue Reading Bioconductor – branchpointer

Bioconductor – atena

DOI: 10.18129/B9.bioc.atena     Analysis of Transposable Elements Bioconductor version: Release (3.14) Quantify expression of transposable elements (TEs) from RNA-seq data through different methods, including ERVmap, TEtranscripts and Telescope. A common interface is provided to use each of these methods, which consists of building a parameter object, calling the quantification…

Continue Reading Bioconductor – atena

Bioconductor – OGRE (development version)

DOI: 10.18129/B9.bioc.OGRE     This is the development version of OGRE; to use it, please install the devel version of Bioconductor. Calculate, visualize and analyse overlap between genomic regions Bioconductor version: Development (3.15) OGRE calculates overlap between user defined genomic region datasets. Any regions can be supplied i.e. genes, SNPs,…

Continue Reading Bioconductor – OGRE (development version)

Bioconductor – r3Cseq

    This package is for version 3.3 of Bioconductor; for the stable, up-to-date release version, see r3Cseq. Analysis of Chromosome Conformation Capture and Next-generation Sequencing (3C-seq) Bioconductor version: 3.3 This package is an implementation of data analysis for the long-range interactions from 3C-seq assay. Author: Supat Thongjuea, MRC Molecular…

Continue Reading Bioconductor – r3Cseq

Bioconductor – RiboCrypt

DOI: 10.18129/B9.bioc.RiboCrypt     Interactive visualization in genomics Bioconductor version: Release (3.14) R Package for interactive visualization and browsing NGS data. It contains a browser for both transcript and genomic coordinate view. In addition a QC and general metaplots are included, among others differential translation plots and gene expression plots….

Continue Reading Bioconductor – RiboCrypt

Bioconductor – derfinder (development version)

DOI: 10.18129/B9.bioc.derfinder     This is the development version of derfinder; for the stable release version, see derfinder. Annotation-agnostic differential expression analysis of RNA-seq data at base-pair resolution via the DER Finder approach Bioconductor version: Development (3.15) This package provides functions for annotation-agnostic differential expression analysis of RNA-seq data. Two…

Continue Reading Bioconductor – derfinder (development version)

identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

GenomicFeatures::makeTxDbFromUCSC failing with an error: identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE 1 @mikhail-dozmorov-23744 Last seen 1 day ago United States Hi,The GenomicFeatures::makeTxDbFromUCSC function fails with: library(GenomicFeatures) > hg19.refseq.db <- makeTxDbFromUCSC(genome=”hg19″, table=”refGene”) Download the refGene table … Error in .fetch_UCSC_txtable(genome(session), tablename, transcript_ids = transcript_ids) : identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE OK The…

Continue Reading identical(current_classes, .UCSC_TXCOL2CLASS) is not TRUE

Bioconductor – monaLisa

DOI: 10.18129/B9.bioc.monaLisa     Binned Motif Enrichment Analysis and Visualization Bioconductor version: Release (3.14) Useful functions to work with sequence motifs in the analysis of genomics data. These include methods to annotate genomic regions or sequences with predicted motif hits and to identify motifs that drive observed changes in accessibility…

Continue Reading Bioconductor – monaLisa

Bioconductor – BSgenome.Hsapiens.NCBI.GRCh38

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.NCBI.GRCh38     This package is for version 3.11 of Bioconductor; for the stable, up-to-date release version, see BSgenome.Hsapiens.NCBI.GRCh38. Full genome sequences for Homo sapiens (GRCh38) Bioconductor version: 3.11 Full genome sequences for Homo sapiens (Human) as provided by NCBI (GRCh38, 2013-12-17) and stored in Biostrings objects. Author: The…

Continue Reading Bioconductor – BSgenome.Hsapiens.NCBI.GRCh38

Bioconductor – ProteoDisco

DOI: 10.18129/B9.bioc.ProteoDisco     Generation of customized protein variant databases from genomic variants, splice-junctions and manual sequences Bioconductor version: Release (3.14) ProteoDisco is an R package to facilitate proteogenomics studies. It houses functions to create customized (mutant) protein databases based on user-submitted genomic variants, splice-junctions, fusion genes and manual transcript…

Continue Reading Bioconductor – ProteoDisco

Design formula in DESeq2

Hello, I am using DESeq2 for analysis of RNAseq data. I would like to ask you about the design in the DESEq2 formula. I have tissue from animals treated with a chemical and my animal model is a colorectal cancer model. My variables are gender (male or female), treatment (treated…

Continue Reading Design formula in DESeq2

Bioconductor – Rariant

    This package is for version 3.0 of Bioconductor; for the stable, up-to-date release version, see Rariant. Identification and Assessment of Single Nucleotide Variants through Shifts in Non-Consensus Base Call Frequencies Bioconductor version: 3.0 The ‘Rariant’ package identifies single nucleotide variants from sequencing data based on the difference of…

Continue Reading Bioconductor – Rariant

Bioconductor – VanillaICE

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see VanillaICE. A Hidden Markov Model for high throughput genotyping arrays Bioconductor version: 3.4 Hidden Markov Models for characterizing chromosomal alterations in high throughput SNP arrays. Author: Robert Scharpf <rscharpf at jhu.edu>, Kevin Scharpf,…

Continue Reading Bioconductor – VanillaICE

Bioconductor – ChIPComp

    This package is for version 3.4 of Bioconductor; for the stable, up-to-date release version, see ChIPComp. Quantitative comparison of multiple ChIP-seq datasets Bioconductor version: 3.4 ChIPComp detects differentially bound sharp binding sites across multiple conditions considering matching control. Author: Hao Wu, Li Chen, Zhaohui S.Qin, Chi Wang Maintainer:…

Continue Reading Bioconductor – ChIPComp

Converting between UCSC id and gene symbol with bioconductor annotation resources

You need to use the Homo.sapiens package to make that mapping. > library(Homo.sapiens) Loading required package: AnnotationDbi Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: ‘BiocGenerics’ The following objects are masked from ‘package:parallel’: clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply,…

Continue Reading Converting between UCSC id and gene symbol with bioconductor annotation resources

Outliers on DESEq2 Results

I have an RNAseq dataset, where one of the genes I intend to analyze has hundreds of counts ranging from 10 to 12, with a few counts > 9000. I process this data in Deseq2 and get that the gene is differentially expressed across several samples of interest. What can…

Continue Reading Outliers on DESEq2 Results

How to rename the elements in columns(txdb)?

How to rename the elements in columns(txdb)? 0 Hello Biostars Community, I made a txdb object using: mm39.txdb <- makeTxDbFromEnsembl(organism = “Mus musculus”) and then made the CompressedGRangesList : txns <- GRangesList(cds(mm39.txdb, columns = c(“CDSSTART”,”CDSEND”))) I am trying to figure out how to rename CDSSTART to cdsStart and CDSEND to…

Continue Reading How to rename the elements in columns(txdb)?

GenomeInfoDb (in R) and UCSC just stopped co-operating in terms of mm10

GenomeInfoDb (in R) and UCSC just stopped co-operating in terms of mm10 1 Hello, Don’t know how many have noticed but any function in GenomeInfoDb library (as well as ensembldb library) in R haven’t been able to interact with UCSC servers what comes to mm10. Typical functions like Seqinfo(genome=”mm10″) return…

Continue Reading GenomeInfoDb (in R) and UCSC just stopped co-operating in terms of mm10

Bioconductor – HiTC

DOI: 10.18129/B9.bioc.HiTC     This package is for version 3.9 of Bioconductor; for the stable, up-to-date release version, see HiTC. High Throughput Chromosome Conformation Capture analysis Bioconductor version: 3.9 The HiTC package was developed to explore high-throughput ‘C’ data such as 5C or Hi-C. Dedicated R classes as well as…

Continue Reading Bioconductor – HiTC

Bioconductor – cageminer (development version)

DOI: 10.18129/B9.bioc.cageminer     This is the development version of cageminer; to use it, please install the devel version of Bioconductor. Candidate Gene Miner Bioconductor version: Development (3.14) This package aims to integrate GWAS-derived SNPs and coexpression networks to mine candidate genes associated with a particular phenotype. For that, users…

Continue Reading Bioconductor – cageminer (development version)

Bioconductor – GGtools

DOI: 10.18129/B9.bioc.GGtools     This package is for version 3.12 of Bioconductor. This package has been removed from Bioconductor. For the last stable, up-to-date release version, see GGtools. software and data for analyses in genetics of gene expression Bioconductor version: 3.12 software and data for analyses in genetics of gene…

Continue Reading Bioconductor – GGtools

Annotation Forge Error: makeOrgPackageFromNCBI

Annotation Forge Error: makeOrgPackageFromNCBI 0 Hi, I just run a code inherited from a recent nature paper: github.com/RoundLab/Ost_CandidaRNASeq However, I got a lot of errors with annotation forge. Would you please help me? Yesterday, I had another error. Today I have rerun it, and I got another error. 🙁 library(“biomaRt”)…

Continue Reading Annotation Forge Error: makeOrgPackageFromNCBI

weird MAplot or volcano plot of DESeq2 diff result

Hi, every one. I find a werid MAplot or volcano plot of DESeq reuslt. I am wondering whether you can give me some advice. This diff result is from two cell type bulk RNA-seq. I use two specific marker to get these two cell type using Flow cytometer. I alreadly…

Continue Reading weird MAplot or volcano plot of DESeq2 diff result