Categories
Tag: GFP
All Roads Lead to Genome Editing
Shondra Pruett-Miller, a biochemist at St. Jude Children’s Research Hospital, found her calling during her first year of graduate school at the University of Texas, Southwestern. In 2003, during the departmental faculty research talks, she watched with excitement as Matthew Porteus, now a biochemist at Stanford University, presented his research…
pPLK GFP Puro Luc shRNA Plasmid
Catalog number PVTB80045-3a Price 356 EUR Size 2 ug Kit Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most…
IKK gamma (IKBKG) Human shRNA Plasmid Kit (Locus ID 8517)
Product Data Locus ID 8517 Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components IKBKG – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene…
Low dose ribosomal DNA P-loop mutation affects development and enforces autophagy in Arabidopsis
Arabidopsis contains hundreds of ribosomal DNA copies organized within the nucleolar organizing regions (NORs) in chromosomes 2 and 4. There are four major types of variants of rDNA, VAR1–4, based on the polymorphisms of 3’ external transcribed sequences. The variants are known to be differentially expressed during plant development. We…
Apoptosis-resistant megakaryocytes produce large and hyperreactive platelets in response to radiation injury | Military Medical Research
Animals C57BL/6-Tg (Pf4-icre) Q3Rsko/J (Pf4-Cre) mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). B6;129-Tmem173tm1(flox)Smoc (Stingfl) mice were purchased from Shanghai Model Organisms Center, Inc. (Shanghai, China). C57BL/6J-Ifnar1em1(flox)Cya (Ifnar1fl) mice were purchased from Cyagen Biosciences (Guangzhou, China). Stingcko and Ifnar1cko mice were generated by crossing Pf4-Cre mice with…
Human CD26 (DPP4) activation kit by CRISPRa Clinisciences
Kit Components GA101256G1, CD26 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCATTTTTAGCTAAG GA101256G2, CD26 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGTGGGGGAGGGGAAA GA101256G3, CD26 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACCTCACGTGGACAGGCGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 Disclaimer These products are manufactured and supplied…
Preclinical assessment of an anti-HTLV-1 heterologous DNA/MVA vaccine protocol expressing a multiepitope HBZ protein | Virology Journal
Design of the recombinant virus MVA-HBZ The multiepitope protein design was based on HBZ sequence deposited in the GenBank database [17, 23, 24], and in silico analyses performed using the epitope prediction tools: NetMHCpan 4.0 (Threshold: weak binders—2.0; strong binders—0.5), NetCTL 1.2 (Threshold of 0.75) and IEDB—MHC-I Binding Predictions. Epitopes…
Functional-metabolic coupling in distinct renal cell types coordinates organ-wide physiology and delays premature ageing
Preferential carbohydrate import and early metabolism in PCs (but not SCs) supports renal physiology independent of ATP production Drosophila renal (Malpighian, MpT) tubules consist of two major cell types, the larger PCs and smaller SCs which perform distinct roles in ion, solute and water transport (Fig. 1a, b)16. These functional differences…
Evidence of an intracellular creatine-sensing mechanism that modulates creatine biosynthesis via AGAT expression in human HAP1 cells
Cell lines and reagents HAP1 cells used to generate the reporter cells were grown from a frozen stock of HAP1 (C859) passage 6 purchased from Horizon Discovery LTD (Cambridge, UK). Iscove’s media (Ref: 098–150, Wisent) supplemented with 10% Fetal Bovine serum (Multicell) was used to grow HAP1 cells. All cells…
Electric eels alter genes of other creatures using their shocking discharges
NAGOYA, Japan — Scientists from Japan have made an electrifying new discovery. Nagoya University researchers have found that electric eels can use their discharges to genetically modify other organisms in their environment. Simply put, eels can transfer their DNA to other species using their shocking bursts. This finding sheds new light…
drivers/power/wm97xx_battery.c – kernel/tegra.git – Git at Google
/* * linux/drivers/power/wm97xx_battery.c * * Battery measurement code for WM97xx * * based on tosa_battery.c * * Copyright (C) 2008 Marek Vasut <marek.vasut@gmail.com> * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU General Public License version 2 as…
Ubiquitination-mediated Golgi-to-endosome sorting determines the toxin-antidote duality of fission yeast wtf meiotic drivers
The toxin and antidote products of cw9 are active in vegetative cells We used the S. pombe wtf gene cw9, which is an active KMD from the natural isolate CBS55579, as a model to study the molecular mechanism underlying the distinction between the toxin and the antidote. We will refer…
Allow to use on non-OF platforms
[PATCH v1 0/2] backlight: mp3309c: Allow to use on non-OF platforms * [PATCH v1 0/2] backlight: mp3309c: Allow to use on non-OF platforms @ 2023-12-14 19:51 Andy Shevchenko 2023-12-14 19:51 ` [PATCH v1 1/2] backlight: mp3309c: Make use of device properties Andy Shevchenko 2023-12-14 19:51 ` [PATCH v1 2/2] backlight:…
Stk3 Mouse shRNA Plasmid (Locus ID 56274) Clinisciences
Product Data Locus ID 56274 Synonyms 0610042I06Rik; mess1; MST; Mst2; Mst3; Ste20 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components Stk3 – Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 56274). 5µg purified plasmid DNA per construct29-mer…
Solved 6. A few years ago I set up a cross between BDSC
Transcribed image text: 6. A few years ago I set up a cross between BDSC \#79543 females and \#51324 males. Here are the relevant parts of their genotypes: #79543 = P{TKO.GS02468}attP40/CyO [P\{TKO.GS02468\}attP40 is an inserted element on chromosome 2 that expresses an sgRNA for Cas9-mediated mutagenesis of the white gene] #51324=w; PBac {y[+ mDint2] GFP[E.3xP3]=vas-Cas9}VK00027 […
Human TIA1 activation kit by CRISPRa Clinisciences
Product Data Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) Symbol TIA1 Locus ID 7072 Kit Components GA104875G1, TIA1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa GA104875G2, TIA1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa GA104875G3, TIA1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa 1 CRISPRa-Enhancer vector, SKU GE100056 1…
A transcriptomic taxonomy of mouse brain-wide spinal projecting neurons
Animals All experimental procedures were performed in compliance with animal protocols approved by the Institutional Animal Care and Use Committee at Boston Children’s Hospital (Protocol no. 20-05-4165 R). Mice were provided with food and water ad libitum, housed on a 12-hour light/dark schedule (7 a.m.–7 p.m. light period) with no more than five mice…
Comprehensive Review of Small Interfering RNAs (siRNAs)
Introduction Cancer, also called malignancy, is a group of diseases caused by the rapid multiplication and spread of malignant cells.1,2 According to statistics from the National Cancer Center, more than 100 types of cancer have been identified.3 The ability of malignant tumor cells to metastasize via the blood-lymphatic system and…
Atg7 senses ATP levels and regulates AKT1-PDCD4 phosphorylation-ubiquitination axis to promote survival during metabolic stress
Atg7 interacts with PDCD4 and negatively regulates PDCD4 protein levels Previous studies have demonstrated the role of Atg7 in maintaining metabolic homeostasis by initiating autophagy and arresting the cell cycle17,18,22. Herein, the function of Atg7 was more comprehensively investigated and it was determined whether Atg7 reduces protein synthesis to save…
Human RAD52 stimulates the RAD51-mediated homology search
Introduction Homologous recombination (HR) is an evolutionarily conserved process that plays a pivotal role in genome stability, diversity, and plasticity. HR is indeed a key repair pathway able to faithfully repair DNA damages including double-strand breaks (DSBs) and DNA gaps by copying the error-free information from the template DNA normally…
Thyroid hormone-regulated chromatin landscape and transcriptional sensitivity of the pituitary gland
Mouse genetic models The ThrbHAB allele expresses TRβ proteins (TRβ1 and TRβ2) fused to a peptide with a hemagglutinin (HAx2) tag and a site for biotinylation by prokaryotic BirA ligase, modified from a published tag30. The tag was inserted at the endogenous Thrb gene by homologous recombination in W9.5 (129/Sv)…
RNA Aptamer-Mediated Gene Activation Systems for Inducible Transgene Expression in Animal Cells
journal contribution posted on 2023-12-11, 05:47 authored by Feiyang Zheng, Yoshinori Kawabe, Masamichi Kamihira RNA expression analyses can be used to obtain various information from inside cells, such as physical conditions, the chemical environment, and endogenous signals. For detecting RNA, the system regulating intracellular gene expression has the potential for…
Uncovering the Strange Genetic Impact of Electric Eels
Researchers at Nagoya University discovered that electric eels, capable of generating up to 860 volts, can induce genetic modifications in nearby organisms through a process similar to electroporation. Credit: SciTechDaily.com Electric eels can naturally alter the genetics of nearby organisms, a discovery by Nagoya University researchers that highlights the role…
A naturally occurring polyacetylene isolated from carrots promotes health and delays signatures of aging
Cell culture conditions Unless otherwise stated, cells were cultured with DMEM (Sigma Aldrich; #D6429) and 4.5 g/l glucose, phenol red, 10% FBS, and 1% penicillin/streptomycin with pH 7.4 and were incubated at 37 °C, 5% CO2, and 95% relative humidity. Wild-type HepG2 (#300198), HEK293 (#300192), and MCF-7 (#300273) were derived from CLS…
Phenotypic profiling of solute carriers characterizes serine transport in cancer
Cell culture All cell lines used in this study were cultured at 37 °C in 5% CO2 in a humidified incubator. Human cell lines were authenticated by STR profiling using Promega GenePrint 10 and tested for Mycoplasma using Mycoalert (Lonza). Other than HCT116 p21−/− (a gift of B. Vogelstein60) all cell…
Native ribonucleases process sgRNA transcripts to create catalytic Cas9/sgRNA complexes in planta
Native ribonucleases process sgRNA transcripts to create catalytic Cas9/sgRNA complexes in planta – Texas A&M University (TAMU) Scholar Search form Overview Identity Other View All Overview abstract The current CRISPR/Cas9 gene editing dogma for single guide RNAs (sgRNA) delivery is based on the premise that…
High-throughput ligand profile characterization in novel cell lines expressing seven heterologous insect olfactory receptors for the detection of volatile plant biomarkers
Generation of the stable OR cell lines In vivo measured ligand profile data derived from the DoOR database (neuro.uni-konstanz.de/DoOR/default.html)19,20 were used to select 12 ORs, which can be appropriate to detect the pathogen-related VOCs relevant for our study. To assemble a novel cell-based olfactory panel, 11 stable cell lines were…
Antibiotic resistance genes are spread more widely between bacteria than previously thought
Plasmid transfer from the Escherichia coli MG1655 donor strain to bacterial community extracted from a hospital wastewater treatment plant. (A) Transconjugants formed in the absence of NaClO. The green fluorescence indicates successful acquisition of the gfp-expressing plasmid. (B) Transconjugants formed in the presence of 40 mg/L NaClO. (C) Transconjugants formed…
Electric Eels’ Shocking Ability To Alter The Genetics Of Nearby Animals
A new study has found that electric eels can alter the genetics of nearby animals through electrical discharges © Copyright by GrrlScientist | hosted by Forbes | LinkTr.ee The face of an electric eel. The massive electric organ in this species is made up of platelets of … [+] modified…
Electricity From Electric Eels May Transfer Genetic Material To Nearby Animals
EOD exposure from electric eel to zebrafish larvae. (A) This illustration depicts the experimental tank used to expose the recipient organism to the electric eel’s electric organ discharge (EOD). Within the tank, three carbon rod electrodes are placed: two inputs (colored black and red) and a ground electrode (colored green)….
Zaps From Electric Eels Might Transfer DNA To Other Animals
Pain might be the first thing you associate with a shock from an electric eel, but it turns out there could be more to it than that. A new study has found that electric eels can discharge enough electricity that nearby fish larvae can end up with genetic modifications. This…
Electric eels can release enough electricity to modify small fish larvae genetically
Electric organ discharge (EOD), which can reach voltages of up to 860 V, is a well-known phenomenon associated with electric eels (Electrophorus sp.). Because genetic engineering has long used electrical solid pulses to transfer genes, scientists postulated that electric eels might be a gene transfer method in their watery habitat….
Electric eel’s zap can transfer genes to nearby animals, study finds
A recent study has found that the electricity produced by an electric eel’s discharge is strong enough to cause the transfer of genetic material from the environment into the cells of nearby animals. The finding suggests that electric eels – and other electricity-generating organisms – could affect genetic modification in…
Addgene: CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications. For your Materials & Methods section: CAGGS-AsCpf1-2A-GFP-U6-AAVS1-MAFB-sgRNA was a gift from Rudolf Jaenisch (Addgene plasmid # 194725…
The role of APOBEC3B in lung tumor evolution and targeted cancer therapy resistance
Cell line and growth assays Cell lines were grown in Roswell Park Memorial Institute-1640 medium (RPMI-1640) with 1% penicillin–streptomycin (10,000 U ml−1) and 10% FBS or in Iscove’s modified Dulbecco’s medium (IMDM) with 1% penicillin–streptomycin (10,000 U ml−1), l-glutamine (200 mM) and 10% FBS in a humidified incubator with 5% CO2 maintained at 37 °C. Drugs…
The BAF chromatin remodeler synergizes with RNA polymerase II and transcription factors to evict nucleosomes
Kornberg, R. D. & Lorch, Y. Primary role of the nucleosome. Mol. Cell 79, 371–375 (2020). Article CAS PubMed Google Scholar Zhu, F. et al. The interaction landscape between transcription factors and the nucleosome. Nature 562, 76–81 (2018). Article CAS PubMed PubMed Central Google Scholar Lee, C. K., Shibata, Y.,…
Influence of FGF4 and BMP4 on FGFR2 dynamics during the segregation of epiblast and primitive endoderm cells in the pre-implantation mouse embryo
Fig 4. Treatment of FGFR2-eGFP embryos with FGF4 or ERK inhibitor. A) Representative images of live imaged FGFR2-eGFP embryos at different embryonic days and consequently different exposure to treatment. Scale bar is equal to 47μm. B) Representative images of embryos immunostained for NANOG (grey) and GATA6 (red) at different embryonic…
Efficient elimination of MELAS-associated m.3243G mutant mitochondrial DNA by an engineered mitoARCUS nuclease
mitoARCUS localizes to the mitochondrial matrix To evaluate the ability of mitoARCUS to specifically cleave m.3243G mutant mtDNA, cell lines containing varying levels of the mutation were generated. All of these cell lines were isolated from the same parental m.3243A>G cybrid cell line. Levels of the m.3243G mutation of each…
Prime editing-mediated correction of the CFTR W1282X mutation in iPSCs and derived airway epithelial cells
Abstract A major unmet need in the cystic fibrosis (CF) therapeutic landscape is the lack of effective treatments for nonsense CFTR mutations, which affect approximately 10% of CF patients. Correction of nonsense CFTR mutations via genomic editing represents a promising therapeutic approach. In this study, we tested whether prime editing,…
A two-kinesin mechanism controls neurogenesis in the developing brain
Reduced Kif13b expression increases the ratio of neurons to progenitors in the developing rat brain To compare the roles of Kif13B vs. Kif1A in rat brain cortical development, we injected embryonic day 16 (E16) rat embryos in utero with an empty GFP control plasmid, or shRNAs designed for knockdown of…
Genome editing approaches with CRISPR/Cas9: the association of NOX4 expression in breast cancer patients and effectiveness evaluation of different strategies of CRISPR/Cas9 to knockout Nox4 in cancer cells | BMC Cancer
A. Bioinformatics analyzes Search strategy and study selection From April to June 2021, we read relevant and related publications in Medline, EMBASE, Web of Science, and Wanfang. The search term “NOX4” have been used. The articles that fit specified criteria were all added at once: (1) Participants were split into…
Addgene: pAAV-HDC-DIO-GFP-shRNA.scramble Sequences
> Addgene NGS Result CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCCA TATGACCACCCCCCATGAAGTCTGTTGTGTAAGTACAGGTAATGCTTTAGACACTGTTTTTCTCAGATTG TGTTCAAGCTCTTGGGTGCAGGCATCCGCAGTCCAGAGCCTCTGAGGAACAAAGGGACCTCGATATAAAG AACAAAAAGCTCTCGGTATTCGGGAAAACTCCGAAGGATTTTTGTTGTTTTGTGGCAGTGTTGGGGTTCA GGACAAACACACCACCCCAGAATATGATTTCAGGAGAAACTGCCATCCCCGCCCCCACTAGTACGCTTCC TTTGTGTTATCTCGAGAAGCCCTGGACGTAGGAGGAGTTCTCAAAAGCTGTTCTTTCGTAAGAGATGGTC AGGAAGAAACGTTGATTAGGAAAAGTACTCGACTCAGGAAGAGGAGGGGTACAGATAACTGCTGTCACCA GAAAGATTTCCATCTGACAAAGTGGCAATTCTTCCCCCTTACGAATGTGTGTCCCGCACTCTGCTGCACC CAGGCTCCGCTCTGTTCTCCAGCTCTGCTTGCTGTAGAAGCGTCCATCCACTAAAGGGACTTCCAGATTT ATTGGCACTGAACAGGTTTTTCCTCCGTTAGCTTAAACAGTAGTCGAGGCAAAGAACCCAGAACAAGTGC TATGTAGTAATGGATAAAAAGAATCCTTCATATCCTGTTGTTGATCTGTCCTGAGCTCAGCCTGGCTAGC TATGGGCTTCTCTGAGCCGGCTCTGCCCTCACCTCATAGAGAAGCCAGGGCAGGAGCAACTCCACCCTCT GTGCTACTTATTGTGAATGCCCTTGGCCTATTTCTGGCCTCTGAGCTAGGAGCTTTATTCAAGGCTGGGG CTCTATGGTCTGAATGCAGGGGCAGGGATGATAGAGGGCTCTTTTACCTTGTCTATCCAGAGCTGCTTGT AGGCTTGGGAGGCTAGGTGCCCCAACTGGTCTAAAAACACCATGTTCTCTGATTCTGTTGATCAAAGTTC AAATCAGAAAGGACGGGGACAAGAGAGGCTGAAATTAAGCCTGAAGGAAGGGACTTTATGGGGGCGGGGC TAAAGGAGGGGAATAGGGAACTCCTTAAATAAGAGATGCACTGGCTGCCAGAGAGTGCACAGCACAGACA AAGGCGACCAAGAAGCCCTGTTGACAGCTGCCTTCCAGCCTCCTCTGTCTGTCTGCCAGGAGGAGCAATC CAAGGTCGACTCCGGAATAACTTCGTATAGGATACTTTATACGAAGTTATGCAGAATGGTAGCTGGATTG TAGCTGCTATTAGCAATATGAAACCTCTTAATAACTTCGTATAGCATACATTATACGAAGTTATGGCGCG CCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTT ATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGTCGAACGCGTCGCCGCGTGTTTAAACG CATTAGTCTTCCAATTGAAAAAAGTGATTTAATTTATACCATTTTAATTCAGCTTTGTAAAAATGTATCA AAGAGATAGCAAGGTATTCAGTTTTAGTAAACAAGATAATTGCTCCTAAAGTAGCCCCTTGAATTCCGAG GCAGTAGGCAGGCTCCCGCTGAATTGGAATCCTACATCTGTGGCTTCACTAGGATTCCAATTCACGGGAG CTCGCTCACTGTCAACAGCAATATACCTTCTCGAGCCTTCTGTTGGGTTAACCTGAAGAAGTAATCCCAG CAAGTGTTTCCAAGATGTGCAGGCAACGATTCTGTAAAGTACTGAAGCCTCATTCAACATAGTATATGTG CTGCCGAAGCGAGCACTTAACAAGGCTTGCGGCCGCTACTTGTACAGCTCGTCCATGCCGAGAGTGATCC CGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGA CTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAG TGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCT TCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTT GCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACC TCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCA TGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGC TTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCA GCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGGTGGCGACCGGTAG CGCTAGCATAACTTCGTATAAAGTATCCTATACGAAGTTATTTGCCTTAACCCAGAAATTATCACTGTTA TTCTTTAGAATGGTGCAAAGAATAACTTCGTATAATGTATGCTATACGAAGTTATGAATTCGATATCAAG CTTATCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTC CTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCAT TTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGT GGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCC TTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTG…
NFIB Human shRNA Plasmid Kit (Locus ID 4781) Clinisciences
Product Data Locus ID 4781 Synonyms CTF; HMGIC/NFIB; MACID; NF-I/B; NF1-B; NFI-B; NFI-RED; NFIB2; NFIB3 Vector pGFP-V-RS E. coli Selection Kanamycin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components NFIB – Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 4781). 5µg purified plasmid DNA per…
Genome wide analysis revealed conserved domains involved in the effector discrimination of bacterial type VI secretion system
Construction of the VgrG database Encoded as a stand-alone gene or fused at the N-terminus of the toxin, the MIX domains can assist the delivery of their cognate T6SS effector19,20. As the central component of the spike complex, VgrG is a good marker to explore the potential conserved domains involved…
Immune-privileged tissues formed from immunologically cloaked mouse embryonic stem cells survive long term in allogeneic hosts
Mice C57BL/6N (strain 005304), C3H/HeJ (strain 000659), FVB/NJ (strain 001800), BALB/cJ (strain 000651) and NSG mice (stock 005557) were purchased from the Jackson Laboratory. CD-1 (stock 022) mice were purchased from Charles River. Mice (6–20-week-old) of each strain/background were used for teratoma assays. Mice were housed in a pathogen-free facility…
High-throughput screening of genetic and cellular drivers of syncytium formation induced by the spike protein of SARS-CoV-2
Plasmid construction All the constructs used in this study were generated with standard cloning strategies, including PCR, overlapping PCR, oligo annealing, digestion and ligation. Primers were purchased from Genewiz. The plasmid sequence was verified by Sanger sequencing. The pCAG-spike(D614G)-GFP11-mCherry plasmid was modified from Addgene plasmid 158761. Briefly, GFP11 and mCherry…
Decline of DNA damage response along with myogenic differentiation
Introduction Proper functioning of all living organisms depends on the faithful maintenance and transmission of genomic information stored in the molecule of DNA. However, DNA integrity is continuously challenged by a variety of endogenous and exogenous agents causing DNA lesions which have a critical impact on cellular activities and homeostasis….
GYPB Human shRNA Plasmid Kit (Locus ID 2994) Clinisciences
Product Data Locus ID 2994 Synonyms CD235b; GPB; GYP; GYPA; MNS; PAS-3; SS Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components GYPB – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 2994). 5µg purified plasmid DNA per…
Chromatin priming elements direct tissue-specific gene activity before hematopoietic specification
Introduction The development of multicellular organisms requires the activation of different gene batteries which specify the identity of each individual cell type. Such shifts in cellular identity are driven by shifts in the gene regulatory network (GRN) consisting of transcription factors (TFs) binding to the enhancers and promoters of their…
AK2 Human shRNA Plasmid Kit (Locus ID 204) Clinisciences
Product Data Locus ID 204 Synonyms ADK2 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components AK2 – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 204). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pGFP-C-shLenti…
Pioneering transgene-free CRISPR genome editing in grapevines
Grapevine embryogenic callus system (cv. Thompson Seedless) and stable transformation with the GFP gene. Credit: Horticulture Research Grapevine (Vitis vinifera L.) holds significant economic and cultural value, driving the need for rapid genetic improvement to meet climatic and market demands. While traditional breeding is slow and genetically modified (GM) varieties…
Elevated stress response marks deeply quiescent reserve cells of gastric chief cells
Generation of inducible H2b-GFP knock-in mice Generation of inducible H2b-GFP knock-in mice was performed by using CRISPR/Cas943. In brief, a mixture containing a sgRosa26-1 crRNA43 (8.7 ng/μl, Fasmac, Japan), a tracrRNA (14.3 ng/μl, Fasmac, Japan), a single strand oligo donor nucleotide (ssODN) composed of 5′ arm, adenovirus splicing acceptor, SV40 pA, TRE3G…
The chimaeras of nature and their promise to grow human organs | Explained
In a recent landmark study, scientists have reported successfully producing a live infant chimeric monkey of the species Macaca fascicularis. Representative individual shown above, April 23, 2022. | Photo Credit: Sharp Photography (CC BY-SA 4.0) At present, more than 3 lakh people are waiting for an organ transplant in India…
Single-cell RNAseq analysis of spinal locomotor circuitry in larval zebrafish
. 2023 Nov 17:12:RP89338. doi: 10.7554/eLife.89338. Affiliations Expand Affiliation 1 Vollum Institute, Oregon Health & Science University, Portland, United States. Item in Clipboard Jimmy J Kelly et al. Elife. 2023. Show details Display options Display options Format AbstractPubMedPMID . 2023 Nov 17:12:RP89338. doi: 10.7554/eLife.89338. Affiliation 1 Vollum Institute, Oregon Health &…
Iron derived from NCOA4-mediated ferritinophagy causes cellular senescence via the cGAS-STING pathway
Materials and reagents Tert-butyl hydroperoxide (TBH) were purchased from Sigma-Aldrich (St. Louis, USA). Ferric ammonium citrate (FAC) and D-galactose (D-gal) was obtained from Selleck (Shanghai, China) and Aladdin (Shanghai, China), respectively. Deferoxamine (DFO), Mito-TEMPO (Mito-T), 3-Methyladenine (3-MA), Chloroquine (CQ), Bafilomycin A1 (Baf-A1), and H-151 were purchased from MedChemExpress (NJ, USA)….
ncRNA | Free Full-Text | Ethanol
Received: 14 July 2023 / Revised: 23 October 2023 / Accepted: 3 November 2023 / Published: 17 November 2023 Round 1 Reviewer 1 Report Comments and Suggestions for Authors Rizavi and colleagues present a study describing the effects of alcohol and PARP inhibitor on the lncRNA ribosomal binding. The study…
RhoA suppresses pseudorabies virus replication in vitro | Virology Journal
Materials The Cell Counting Kit-8 (CCK-8) was ordered from Yeasen BioTechnologies co, Ltd. (Shanghai, China). Anti-GAPDH was purchased from Proteintech Group, Inc. (Chicago, USA). Anti RhoA was purchased from Novus Biologicals (Colorado, USA). Antiserum against PRV glycoprotein gB was generated by immunization of mice with purified recombinant gB. Goat anti-Mouse…
IJMS | Free Full-Text | CRISPR/Cas9-Mediated Genome Editing in Cancer Therapy
1. Introduction Recently, the morbidity and mortality rates of cancer have been increasing rapidly, posing a significant threat to human health. Cancer, a refractory and multifaceted disease, fundamentally originates from a cumulative series of mutations in the cellular genome and epigenome. These mutations activate oncogenes and deactivate tumor suppressors, leading…
Advillin (AVIL) Human shRNA Plasmid Kit (Locus ID 10677)
Product Data Locus ID 10677 Synonyms ADVIL; DOC6; NPHS21; p92 Vector pGFP-C-shLenti E. coli Selection Chloramphenicol (34 ug/ml) Mammalian Cell Selection Puromycin Format Lentiviral plasmids Kit Components AVIL – Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 10677). 5µg purified plasmid DNA per construct29-mer scrambled shRNA…
A Cre-dependent massively parallel reporter assay allows for cell-type specific assessment of the functional effects of non-coding elements in vivo
Animal models All procedures involving animals were approved by the Institutional Animal Care and Use Committee (IACUC) at Washington University in St. Louis, MO. Veterinary care and housing was provided by the veterinarians and veterinary technicians of Washington University School of Medicine under Dougherty lab’s approved IACUC protocol. All protocols…
CRISPR-broad: combined design of multi-targeting gRNAs and broad, multiplex target finding
CRISPR-broad framework We developed a procedural pipeline for detecting gRNAs and implemented this in Python as a standalone application (Fig. 1a). For speeding up gRNA selection, we employed multithreading and used big data Python module Pandas. This allowed splitting millions of short sequences for mapping and processing large numbers of uncompressed…
The CRTC-1 transcriptional domain is required for COMPASS complex-mediated longevity in C. elegans
CRTC-1-binding proteins To identify CRTC-1 protein interactions, we tagged endogenous CRTC-1 via clustered regularly interspaced short palindromic repeats–associated protein 9 (CRISPR–Cas9) editing to generate a crtc-1::3xFLAG strain and performed immunoprecipitation (IP) followed by liquid chromatography coupled to mass spectrometry (LC–MS). We found 137 potential CRTC-1 interacting proteins (Fig. 1a and…
Studies Identify Novel Underpinnings of Genetic ALS
Evangelos Kiskinis, PhD, associate professor in the Ken and Ruth Davee Department of Neurology’s Division of Neuromuscular Disease and of Neuroscience, was senior author of studies published in Science Advances and Cell Reports. A pair of recent studies from the laboratory of Evangelos Kiskinis, PhD, associate professor in the Ken…
Enhancing Productivity of Chinese Hamster Ovary (CHO) Cells: Synergistic Strategies Combining Low-Temperature Culture and mTORC1 Signaling Engineering
1Golestan University of Medical Sciences, Iran 2Golestan University, Iran The final, formatted version of the article will be published soon. Notify me Receive an email when it is updated You just subscribed to receive the final version of the article Introduction:…
Transcriptional and epigenetic regulators of human CD8+ T cell function identified through orthogonal CRISPR screens
Developing an epigenetic screening platform in human T cells Staphylococcus aureus Cas9 (SaCas9) has been extensively used for genome editing in vivo as its compact size (3,159 bp) relative to the conventional Streptococcus pyogenes Cas9 (SpCas9) enables packaging into adeno-associated virus26,27,28. However, SaCas9 has not been widely used for targeted gene…
FAT10 is phosphorylated by IKK{beta} to inhibit the antiviral type-I interferon response
Introduction The innate immune system represents the host´s first-line defense against viral infections (Koyama et al, 2008). In this context, IFN-I are produced by all nucleated cells and represent the principal cytokines that counteract viral replication (Ivashkiv & Donlin, 2014). In fact, several receptors of the infected cell can recognize…
IJMS | Free Full-Text | CRISPR/Cas9 Landscape: Current State and Future Perspectives
1. Introduction Genome editing has taken a leading position among genome modification technologies in a short time and is now widely used in gene therapy. To date, there are three main systems for genome editing: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas nucleases. Genome editing has…
Engineered CHO cells as a novel AAV production platform for gene therapy delivery
The Herpes simplex virus (HSV)-based platform for production of recombinant adeno-associated viral vectors (rAAVs) yields higher titers and increased percentage of full capsids when compared to the triple transient transfection (TTT) method. However, this platform currently faces two major challenges. The first challenge is the reliance on commercial media, sometimes…
The DNA-binding induced (de)AMPylation activity of a Coxiella burnetii Fic enzyme targets Histone H3
Statistics and reproducibility Anti-AMP IP for LC-MS/MS analysis was performed in three independent biological replicates (n = 3). TSA assay data represents technical triplicates. Time-resolved (de)AMPylation analyzed by LC-MS was performed as biological triplicates. CD measurements were performed in technical triplicates. Anisotropy data is shown as technical triplicates. Anisotropy measurements were repeated…
Fibronectin (FN1) Human shRNA Plasmid Kit (Locus ID 2335)
Product Data Locus ID 2335 Synonyms CIG; ED-B; FINC; FN; FNZ; GFND; GFND2; LETS; MSF; SMDCF Vector pGFP-V-RS E. coli Selection Kanamycin Mammalian Cell Selection Puromycin Format Retroviral plasmids Kit Components FN1 – Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 2335). 5µg purified plasmid DNA…
Chromatin Architecture of Treg Cells May Offer Target for Immunosuppressive Therapies
Understanding how regulatory T cells (Tregs) develop and work is key to determining how they might be manipulated to encourage the destruction of cancer cells or prevent autoimmunity. Cell behavior is influenced by chromatin architecture—the 3D shape of chromosomes—and which genes are accessible to proteins that promote regulatory T cell…
The Atoh1-Cre Knock-In Allele Ectopically Labels a Subpopulation of Amacrine Cells and Bipolar Cells in Mouse Retina
Abstract The retina has diverse neuronal cell types derived from a common pool of retinal progenitors. Many molecular drivers, mostly transcription factors, have been identified to promote different cell fates. In Drosophila, atonal is required for specifying photoreceptors. In mice, there are two closely related atonal homologs, Atoh1 and Atoh7….
Targeted gene delivery to telencephalic inhibitory neurons by directional in utero electroporation
Título: Autor: Borrell, Víctor CSIC ORCID; Yoshimura, Yumiko; Callaway, Edward M. Fecha de publicación: 2005 Editor: Elsevier Citación: Journal of Neuroscience Methods 143(2): 151-158 (2005) Resumen: Telencephalic inhibitory neurons originate in the ganglionic eminences and migrate to the cerebral cortex following a tangential trajectory, before they differentiate and integrate within…
Illuminating the Plant Gene Map
Climate change tests the resilience of farmers and their crops. To better understand how plants respond to their dynamic environments, scientists magnify the complex biological conversations between genes expressed in plant cells. Mapping out gene expression is informative, but traditional approaches for spatial understanding of gene expression are limited. Tatsuya…
Simplified Single-Cell Isolation
Sponsored content brought to you by Many increasingly used applications, such as cell line engineering and sequencing (including ATAC-seq and RNA-seq) along with single-cell genomics, require single-cell isolation as a starting point. But the cost and complexity of cell sorters have traditionally relegated this technology to larger lab groups or…
Glycoengineered keratinocyte library reveals essential functions of specific glycans for all stages of HSV-1 infection
Generation of a glycogene knock out library in HaCaT keratinocytes HaCaT is a human keratinocyte cell line capable of forming a stratified squamous epithelium, and thus allows evaluating the infection of the skin tropic HSV-1 in both cell and organotypic tissue culture. In order to address the role of specific…
protein principles assignment 2.docx – Protein expression and purification hold pivotal roles in diverse scientific fields and industries including
Protein expression and purification hold pivotal roles in diverse scientific fields and industries, including biotechnology and pharmaceuticals. This report provides an in-depth account of my protein expression and purification strategy, with a specific focus on the production of Green Fluorescent Protein (GFP) using Human Embryonic Kidney (HEK293) cells. Additionally, it…
gRNA transfection into cells stably expressing Cas9
Yes, I do it regularly, both cr/tracr RNA and sgRNA. I use NIH3T3 cells expressing Cas9 (or 293T cells expressing Cas9) and transfect 1ug of sgRNA or ~ .4ugcrRNA/.6ugtracrRNA with 2.4ul Lipofectamine 3000 into a well of a 6 well plate. 293T cells don’t seem to take up the RNA…
Reduction of retinal ganglion cell death in mouse models of familial dysautonomia using AAV-mediated gene therapy and splicing modulators
Animals All mice were housed in the AALAC-accredited Animal Resource Center at Montana State University. All animal use protocols were approved by the Montana State University Institutional Animal Care and Use Committee (IACUC) (protocol No. 2020-15-IA; Bozeman, MT). The study fulfilled the ARRIVE guidelines, and all experiments complied with relevant…
Transgenic expression in zebrafish embryos with an intact chorion by electroporation and microinjection
Biotechnol Rep (Amst). 2023 Dec; 40: e00814. Nusrat Tazin aDepartment of Electrical and Computer Engineering, University of Utah, Salt Lake City, UT, USA Christopher Jordon Lambert bDepartment of Mechanical Engineering, University of Utah, Salt Lake City, Utah, USA Raheel Samuel bDepartment of Mechanical Engineering, University of Utah, Salt Lake City,…
Structure and electromechanical coupling of a voltage-gated Na+/H+ exchanger
Expression and purification of SLC9C1 The gene encoding the S. purpuratus SLC9C1 protein (NP_001091927.1), referred to as SLC9C1, was synthesized (Thermo Fisher Scientific) and subcloned into the pcDNA3.1(+) vector followed by a TEV (Tobacco Etch Virus nuclear-inclusion-a endopeptidase) recognition site, eGFP and a TwinStrep tag at the C terminus. An…
Identification of CCZ1 as an essential lysosomal trafficking regulator in Marburg and Ebola virus infections
Cells and viruses Haploid mSCs AN3–12 are a feeder independent clonal derivative of HMSc2 isolated from mice oocyte and maintained at IMBA52. The AN3–12 library and knocked out cells used for the haploid screening was obtained from IMBA (Austria)14,52. AN3–12 cells were validated by STR analysis. Haploid mES cells were…
Comparison of two lab-scale protocols for enhanced mRNA-based CAR-T cell generation and functionality
Experimental design Primary T cell isolation, expansion, and cell culture Primary T cells were isolated from human peripheral blood mononuclear cells (PBMCs) of healthy donors collected by the Institute for Transfusion Medicine of the University Clinic of Leipzig, Germany, approved by the Ethics Committee of the Faculty of Medicine of…
How chromatin compartmentalization affects DNA damage response
In a recent study published in the journal Nature, researchers identify the mechanisms through which double-stranded break (DSB)-induced compartment formation orchestrates the deoxyribonucleic acid (DNA) damage response (DDR). Study: Chromatin compartmentalization regulates the response to DNA damage. Image Credit: CI Photos / Shutterstock.com Background DNA DSBs are extremely hazardous lesions that could…
Passive diffusion accounts for the majority of intracellular nanovesicle transport
Introduction Trafficking of proteins, lipids, and other molecules between cellular compartments is carried out by vesicular carriers. Material destined for transfer is packaged into a small trafficking vesicle at the donor compartment; the vesicle must then travel to its destination, before fusing with the target compartment to deliver the material…
Solved Fig. 3. GIGVF2/AEHP complex formation is critical for
Transcribed image text: Fig. 3. GIGVF2/AEHP complex formation is critical for repression of 1/nbf mRNA translation and enabling viral replication. (A) ELSA measurement of ifN-1) production in WT, 4EHP.KO, and GIGVF2-KO HEK 93 cels transiently expressing TLR3 folowing 6 h of treatment with 1 pgimL poly(:C. Data are presented KO…
Solved Based on the primer indicated in the Snapgene image
Transcribed image text: Based on the primer indicated in the Snapgene image below, what is the first nucleotide that could be potentially incorporated into a primer extension product and terminate the sequencing reaction? ddATP ddTTP dATP dGTP ddCTP Based on the chromatogram image below, how would you interpret…
Based on the primer indicated in the Snapgene image
Transcribed image text: Based on the primer indicated in the Snapgene image below, what is the first nucleotide that could be potentially incorporated into a primer extension product and terminate the sequencing reaction? Primer \#215 tccctgtctgtagcgc attccctgtctgtagcgcaacaaatgaccttgatagagaaggaatt taagggacagacatcgcgttgtttactggaactatctcttcctttaa ddATP ddTTP dATP dGTP ddCTP Based on the SnapGene alignment below, what…
Chromatin compartmentalization regulates the response to DNA damage
Cell culture and treatments DIvA (AsiSI-ER-U2OS)19, AID-DIvA (AID-AsiSI-ER-U2OS)23 and 53BP1-GFP DIvA20 cells were developed in U2OS (ATCC HTB-96) cells and were previously described. Authentication of the U2OS cell line was performed by the provider ATCC, which uses morphology and short tandem repeat profiling to confirm the identity of human cell…
Researchers study how cells adapt to stressful and complex environments
Imagine the life of a yeast cell, floating around the kitchen in a spore that eventually lands on a bowl of grapes. Life is good: food for days, at least until someone notices the rotting fruit and throws them out. But then the sun shines through a window, the section…
Plastid-localized xanthorhodopsin increases diatom biomass and ecosystem productivity in iron-limited surface oceans
Protein sequence and prediction analysis The amino acid sequence of FcR was deduced from the F. cylindrus genome sequence33. Protein alignments with characterized microbial rhodopsins were performed using the MUSCLE algorithm implemented in Geneious (v.5.6)69. Predictions of subcellular location were performed with SignalP v.4.0 and TargetP (v.1.1)70. Putative transmembrane domains…
Characterizing the regulatory Fas (CD95) epitope critical for agonist antibody targeting and CAR-T bystander function in ovarian cancer
Mice strains Six- to eight-week-old (age), 20–25-g (weight), both male and female (sex) mice were used for tumor xenografts generation and in vivo efficacy studies as described in the text (see Table 3). Athymic Nude (Envigo) Foxn1nu/Foxn1+ or NOD.Cg Prkdcscid Il2rgtm1Wjl/SzJ also called NSG mice were used. All animal procedures were…
Subcellular distribution of the rAAV genome depends on genome structure
Optimization of transfection condition for viral genome staining The transfection was prepared by various concentrations of plasmids expressing DD-dSpyCas9-mCherry-APEX2 (pAPEX2) and sgITR (psgITR) with the transfection agent to stain the rAAV genome inside the cells for TEM. To investigate the target viral genome, a specific staining technique is necessary for…
Custom siRNA Cloning
Custom-made, ready-to-use iLenti™ and iLenti™-GFP siRNA constructs for transfection or infection to knockdown your gene of interest Services for a single construct or 4 constructs Guaranteed knockdown for any gene* Constructs available with a GFP reporter Full service at very low cost *Requirements: Only for siRNAs designed against human, mouse,…
Five bioart artists you should know about
Bioart bridges art, born out of creativity and abstract thoughts, and science, which is rooted in facts, laws and logic, as a means of self-expression. The term bioart was coined by Brazilian-American artist Eduardo Kac, who implanted a microchip in his ankle on live television, and registered himself in a…
Researchers explore immunomodulating targets for improving glioblastoma therapies
In a recent article published in EMBO Molecular Medicine, researchers investigated cellular, molecular, and spatiotemporal heterogeneity of glioblastoma (GBM), a malignant and highly aggressive primary brain tumor. Study: Single-cell profiling and zebrafish avatars reveal LGALS1 as immunomodulating target in glioblastoma. Image Credit: Triff/Shutterstock.com They performed single-cell ribonucleic acid sequencing (scRNA-seq) of…
ROLE OF CATECHOLAMINERGIC A2 NEURONS OF NUCLEUS OF THE SOLITARY TRACT (NTS) IN CARDIOVASCULAR AND RESPIRATORY ADAPTATIONS TO CHRONIC INTERMITTENT HYPOXIA (CIH) IN RATS
Purpose: To understand the effect of CIH on the mRNA expression levels of AT1a, AT1b and excitatory amino acid (EAAs) receptor subunits in the A2 neurons of NTS and to assess the effect of tyrosine hydroxylase (TH) knockdown in A2 neurons on the cardiovascular responses to CIH Methods: Adult male…
Rab41-mediated ESCRT machinery repairs membrane rupture by a bacterial toxin in xenophagy
Rab8A and Rab41 are required for xenophagy of GAS For comprehensive screening of Rab GTPases involved in xenophagy against GAS infection, we first knocked down the expression of Rab GTPases in HeLa cells. We examined bacterial survival in cells at 6 h post-infection (hpi) compared with that at 2 hpi because…
drivers/extcon/extcon-gpio.c – linux-imx – Git at Google
/* * extcon_gpio.c – Single-state GPIO extcon driver based on extcon class * * Copyright (C) 2008 Google, Inc. * Author: Mike Lockwood <lockwood@android.com> * * Modified by MyungJoo Ham <myungjoo.ham@samsung.com> to support extcon * (originally switch class is supported) * * This software is licensed under the terms of…
Rapid and efficient genetic manipulation of gyrencephalic carnivores using in utero electroporation
Author(s): Kawasaki Hiroshi | Iwai Lena | Tanno Kaori Journal: Molecular Brain ISSN 1756-6606 Volume: 5; Issue: 1; Start page: 24; Date: 2012; Original page Keywords: Ferrets | Cerebral cortex | in utero electroporation ABSTRACT Abstract Background Higher mammals such as primates and carnivores have highly developed unique brain structures…