Tag: github

Study cohort description We used data on a total of 172,270 individuals of Japanese and East Asian ancestry. Of these, data on 165,098 individuals were obtained from BBJ, which has enrolled ≥200,000 participants to date. BBJ is a multi-institutional hospital-based genome cohort that collected participants affected with at least one…

DOI: 10.18129/B9.bioc.SNPlocs.Hsapiens.dbSNP155.GRCh37     This is the development version of SNPlocs.Hsapiens.dbSNP155.GRCh37; to use it, please install the devel version of Bioconductor. Human SNP locations and alleles extracted from dbSNP Build 155 and placed on the GRCh37/hg19 assembly Bioconductor version: Development (3.16) The 929,496,192 SNPs in this package were extracted from…

Toggle navigation Menu Gene data Gene symbol reports Gene group reports Tools BioMart HCOP Multi-symbol checker Search Downloads BioMart Complete set archive Custom downloads REST service Statistics and download files GitHub (code) VGNC VGNC homepage About the VGNC Contact us Contact details Feedback form More About About the HGNC Guidelines…

Advance Market Analytics added research publication document on Worldwide Online Diagram Editor Market breaking major business segments and highlighting wider level geographies to get deep dive analysis on market data. The study is a perfect balance bridging both qualitative and quantitative information of Worldwide Online Diagram Editor market. The study…

Abstract The success of CRISPR-mediated gene perturbation studies is highly dependent on the quality of gRNAs, and several tools have been developed to enable optimal gRNA design. However, these tools are not all adaptable to the latest CRISPR modalities or nucleases, nor do they offer comprehensive annotation methods for advanced…

Job Description The position of Research Assistant (Bioinformatician) is immediately available in the Genome and Data Analytics Core (GeDaC) at the Cancer Science Institute of Singapore (CSI) — a part of National University of Singapore. The CSI GeDaC is building a platform to facilitate the automated processing and analysis of…

I’m doing OOP R and was wondering how to make it so the + can be used to add custom objects together. The most common example of this I’ve found is in ggplot2 w/ adding geoms together. I read through the ggplot2 source code and found this github.com/hadley/ggplot2/blob/master/R/plot-construction.r It looks…

I tried several R packages (mygene, org.Hs.eg.db, biomaRt, EnsDb.Hsapiens.v79) to convert Ensembl.gene to gene.symbol, and found that the EnsDb.Hsapiens.v79 package / gene database provides the best conversion quality (in terms of being able to convert most of Ensembl.gene to gene.symbol). Install the package if you have not installed by running…

The Genomic Standards Consortium (GSC) is an open-membership working body formed in September 2005. The aim of the GSC is making genomic data discoverable. The GSC enables genomic data integration, discovery and comparison through international community-driven standards. This project is maintained by GenomicsStandardsConsortium This page will auto update when new…

In deep learning and computer vision, models tackle a specific task. For example, we can find models for image classification, object detection, and image segmentation also. But there are very few models out there which perform end-to-end vision perception on both, object detection and semantic segmentation. But one of the…

A new SARS-CoV-2 recombinant lineage from South Africa has been highlighted by Tulio de Oliveira, Director of the Centre for Epidemic Response & Innovation in South Africa today. The Delta/Omicron recombinant was first identified on the 28 June 2022 and designated as XAY on the 25th August 2022 Early, I…

Hello, I am simulating 8 molecules of CO2 in an NVT ensemble using fix/rigid/small.The simulation works perfectly in the serial mode but displays the error message pasted below,when running on the parallel mode. ***** An error occurred in MPI_Wait******* reported by process [1912078337,1]******* on communicator MPI_COMM_WORLD******* MPI_ERR_TRUNCATE: message truncated******* MPI_ERRORS_ARE_FATAL…

1. Overview In this article, we’ll write an API specification that allows returning two different objects for the same response code. We’ll demonstrate how we can use that specification to generate Java code and the Swagger documentation. 2. Presentation of the Problem Let’s define two objects. A Car has an…

TensorFlow for R TensorFlow™ is an open source software library for numerical computation using data flow graphs. Nodes in the graph represent mathematical operations, while the graph edges represent the multidimensional data arrays (tensors) communicated between them. The flexible architecture allows you to deploy computation to one or more CPUs…

什么是openapi 3.0 OpenAPI 3.0.0 是 OpenAPI The first official version of the specification,因为它是由 SmartBear Software 捐赠给 OpenAPI Initiative,并在2015年从 Swagger 规范重命名为 OpenAPI 规范. 介绍: OpenAPI 规范（OAS）,is to define a standard、programming language-independentRESTful API的规范.OpenAPI Specifications enable both humans and computers to“Do not contact with any program source code and documentation、Does not monitor network…

Installing ensembl-vep 1 Hello all , I tried installing ensembl-Vep on mu ubuntu using following commands git clone github.com/Ensembl/ensembl-vep cd ensembl-vep perl INSTALL.pl I got the error as :- ERROR: DBI module not found. VEP requires the DBI perl module to function I tried installing DBI etc but the error…

from google.colab import drive drive.mount(“/content/drive”) git clone github.com/RizwanMunawar/yolov7-pose-estimation.git cd yolov7-pose-estimation ### For Linux Users python3 -m venv psestenv source psestenv/bin/activate ### For Window Users python3 -m venv psestenv cd psestenv cd Scripts activate cd .. cd .. pip install –upgrade pip pip install -r requirements.txt python pose-estimate.py #if you want…

I’m trying to use a 2 pass STAR mapping strategy (also explained here informatics.fas.harvard.edu/rsem-example-on-odyssey.html), but I’m getting an error. I’ve read through this page [https://github.com/alexdobin/STAR/issues/181] and I have a similar issue, but the discussed solutions don’t seem to help. Perhaps this is more a snakemake issue rather than a STAR…

iPSCs – Pharmacology Group Discussion – HackMD       Published Linked with GitHub # iPSCs – Pharmacology Group Discussion ## Neurology ### Reviews * [パーキンソン病に対する多能性幹細胞を用いた細胞移植治療の現状](https://doi.org/10.5692/clinicalneurol.cn-001235) * pdf * www.jstage.jst.go.jp/article/clinicalneurol/59/3/59_cn-001235/_article/-char/ja/ * doi * doi.org/10.5692/clinicalneurol.cn-001235 ### Trials * [Safety of the tau-directed monoclonal antibody BIIB092 in progressive supranuclear palsy: a randomised,…

Patrick Murphy Bulk RNA-Seq – HackMD        owned this note   Published Linked with GitHub — title: ‘Patrick Murphy Bulk RNA-Seq’ disqus: hackmd — Patrick Murphy bulk RNA-Seq Analysis === ## Table of Contents [TOC] ## 1. Introduction This is a bulk RNA-Seq project, which includes human data….

GitHub – lammps/lammps-plugins: Collection of LAMMPS plugins This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You…

Scientific SoftwareDevelopment InfrastructureRossen ApostolovKTH/[email protected] A use case:GROMACS GROMACS Project started 1995 in Groningen, most of the core developersare now in Sweden Highly tuned code for molecular dynamics, minimization, normalmode analysis; post-processing tools ( 100) Open source & Free software: L-GPL 3000-5000 users world wide, through [email protected] 300kactive CPUs, Apr. 2012…

Overview Black Canyon Consulting (BCC) in partnership with Medical Science and Computing (MSC) is searching for a C++ Software Developer in Bioinformatics and Big Data to support the National Center for Biotechnology Information (NCBI).  This opportunity is full time and onsite at the NCBI in Bethesda, MD and/or remote work. NCBI,…

Details Posted: 13-Aug-22 Location: Seattle, Washington Type: Full-time Salary: Open Overview Fred Hutchinson Cancer Center is an independent, nonprofit, unified adult cancer care and research center that is clinically integrated with UW Medicine, a world leader in clinical care, research and learning. The first National Cancer Institute-designated cancer center in…

Responsibilities Requisition # HRC0992682 The newly formed Precision Biomarkers Laboratories (PBL) at Cedars-Sinai is seeking a highly skilled bioinformatics professional with an expertise in statistical methods and data applications. This role will be responsible for developing robust statistical measures to evaluate, analyze, and integrate proteomics data for continuous quality control…

Introduction Severe pneumonia is one of the most common causes of infectious diseases among patients in the intensive care unit (ICU), and this can lead to various complications and high mortality.1–3 Timely and accurate pathogen diagnoses are crucial for appropriate antimicrobial therapy and improved clinical outcomes. However, the low detection…

Sampling the radiation To understand the phylogenetic relationships between Alpine whitefish, we carried out whole-genome resequencing on 96 previously collected whitefish (with associated phenotypic measurements including standard length and gill-raker counts; collected in accordance with permits issued by the cantons of Zurich (ZH128/15), Bern (BE68/15), and Lucerne (LU04/14); these fish…

A Guide on How to Efficiently Create Quality Summarized Content for Search Engine Optimization (SEO) photo by Mohammad Rahmani Feather unsplash In my previous articles, I explored the many applications for Natural Language Processing (NLP) implementation in the realm of digital marketing and e-commerce. This article is oriented towards technical…

Dear LAMMPS Users and Developers! One of the projects of the LAMMPS Code Clinic 2022 is updating sources for external LAMMPS styles or packages and converting them to plugins for easy integration into pre-compiled binary packages. So if you maintain or know of any such packages or source files, please…

The performance of machine translation systems, which previously relied on phrase-based systems, has suddenly improved with the advent of neural network-based models. An open-source framework called Sockeye was released in 2018. This framework provides quick and dependable PyTorch implementation for neural machine translation (NMT) and other related tasks. It supports…

image: Fanflow4Insects consists of three pipelines. view more  Credit: Hidemasa Bono, Hiroshima University (CC-BY 4.0) Genome sequencing, where scientists use laboratory methods to determine a specific organism’s genetic makeup, is becoming a common practice in insect research. A greater understanding of insect biology helps scientists better manage insects, both those that…

Dear all, I am using LAMMPS to simulate some thermodynamic properties of b-SiGe. I found the potential file in the official github repository for LAMMPS . The first part of my code is this ############################################################### #1 general units metal dimension 3 atom_style atomic neighbor 0.3 bin #2 structure boundary p…

Question: On the welcome screen of DataSpell I chose to open a project with Get from Version Control to get a project from GitHub, although in the left pane I didn’t choose GitHub, so it created an empty .git repository. After that, I git cloned elsewhere the git repository or…

GitHub – rstudio/package-manager-demo: Demo repository for RStudio Package Manager This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your…

[Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls – Peter Korsgaard From: Peter Korsgaard <peter@korsgaard.com> To: buildroot@buildroot.org Subject: [Buildroot] [git commit branch/2022.02.x] package/libmodsecurity: needs dynamic library with libcurl and mbedtls Date: Tue, 19 Jul 2022 18:35:54 +0200 [thread overview] Message-ID: <20220719162323.01D1283DF5@busybox.osuosl.org> (raw) commit: git.buildroot.net/buildroot/commit/?id=2d021a7e7163d13b604d508602288e7190ab63dc branch: git.buildroot.net/buildroot/commit/?id=refs/heads/2022.02.x…

Hello! I’m hoping someone can direct me to resources around acquiring or building standalone gatk tools, specifically HaplotypeCaller. All of my research has led to the monolithic gatk wrapper (either local, spark, or in docker). The big tool is brilliant and I’ve been using it thus far, but it’s pretty…

How to get the total number of unique genes affected by Pathogenic SNPs in dbSNP? 0 In dbVar I have been able to get the total number of unique genes affected by deletions, insertions and duplication which report classified this CNV as pathogenic. Now, I would like to do the…

Licence: other No description or website provided. Projects that are alternatives of or similar to monocle3 dropEst Pipeline for initial analysis of droplet-based single-cell RNA-seq data Stars: ✭ 71 (-58.24%) Mutual labels:  single-cell-rna-seq StackedDAE Stacked Denoising AutoEncoder based on TensorFlow Stars: ✭ 23 (-86.47%) Mutual labels:  single-cell-rna-seq kmer-homology-paper Manuscript for functional prediction…

lncRNA analysis tutorial 2 hello, I would like to ask if there is some good tutorial concerning analysis of lncRNA along RNAseq analysis? like practical example. thank you for your help. lncRNA RNA-seq • 458 views Generally speaking, doing differential expression (DE) or transcript discovery on lncRNA is no different…

AlphaFold: The making of a scientific breakthrough The inside story of the DeepMind team of scientists and engineers who created AlphaFold, an AI system that is recognised as a solution to “protein folding”, a grand scientific challenge for more than 50…

In the package manager I was getting some precompilation errors when trying to update Julia. So I have removed all the offending packages, which included Pluto and tried to add Pluto again with the following result: (@v1.7) pkg> precompile (@v1.7) pkg> add Pluto Resolving package versions… Updating `~/.julia/environments/v1.7/Project.toml` [c3e4b0f8] +…

DOI: 10.18129/B9.bioc.HPiP     Host-Pathogen Interaction Prediction Bioconductor version: Release (3.15) HPiP (Host-Pathogen Interaction Prediction) uses an ensemble learning algorithm for prediction of host-pathogen protein-protein interactions (HP-PPIs) using structural and physicochemical descriptors computed from amino acid-composition of host and pathogen proteins.The proposed package can effectively address data shortages and data…

Software official website ： Hisat2： Manual | HISAT2 StringTie：StringTie article ：Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown | Nature Protocols It is recommended to watch the nanny level tutorial ： 1. RNA-seq : Hisat2+Stringtie+DESeq2 – Hengnuo Xinzhi 2. RNA-seq use hisat2、stringtie、DESeq2 analysis – Simple books Basic usage…

Hello,The official Jupyterhub documentation mentions <hub_url> and<hub_ip> in the proxy settings section: jupyterhub/troubleshooting.md at 95de2618a3e021d5f78434969fd70ff10859d372 · jupyterhub/jupyterhub · GitHub. What these <hub_url> and <hub_ip> exactly are? <hub_ip> is the IP of hub service, hub pod or something else? if I use e.g. domain “my-domain com”, then <hub_url> is “my-domain com/hub”?…

I’m writing a small package of functions for myself only (not CRAN; on GitHub, but not public), and developing locally on the computer. Mostly this is me being a newbie at R and learning to write first package. I’m using devtools and after load_all() and check(), I have been getting…

PRSice (pronounced ‘precise’) is a software package for calculating, applying, evaluating and plotting the results of polygenic risk scores (PRS). PRSice can run at high-resolution to provide the best-fit PRS as well as provide results calculated at broad P-value thresholds, illustrating results corresponding to either, can thin SNPs according to…

Tensors are an effective method for handling and representing multidimensional data arrays. However, they have a limitation in terms of storage and computation. Tensor decompositions are crucial in machine learning because they factorize the weights of neural networks. This research introduces tntorch, an open-source python package for tensor learning that…

GitHub – ProbstLab/viromics This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You signed out in another…

Provided by: libbio-perl-perl_1.7.2-2_all NAME Bio::Map::OrderedPosition – Abstracts the notion of a member of an ordered list of markers. Each marker is a certain distance from the one in the ordered list before it. SYNOPSIS use Bio::Map::OrderedPosition; # the first marker in the sequence my $position = Bio::Map::OrderedPosition->new(-order => 1, -positions…

<YOUR NAME><Current Designation> | +91 <mobile number><Linkedin profile link> | <github link> | <kaggle profile link>SUMMARY<A Senior Data Analyst with almost X years of experience executing data-drivensolutions to increase efficiency………………accuracy……………….…to complexbusiness problems…………………………>EXPERIENCE<Company Name>, <location>– <Designation>November 2017 – PRESENT<Here mention what you have accomplished in your job backed by data>●<EXAMPLE: Involved…

Why do cancer treatments work in some patients, but not in others? How can we use genomics data to discover new drug targets? We seek an energetic and team-oriented Data Scientist with expertise in software development (especially web-based data visualisation) to join a multi-disciplinary effort to discover new biomarkers and…

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

I raised the issue to the upstream developer, and he is working on it: github.com/grke/burp/issues/904 He is very responsive and gentle. On Tue, 24 May 2022 20:53:39 +0200 Sebastian Ramacher <sramac…@debian.org> wrote: > Source: burp > Version: 2.4.0-3 > Severity: serious > Tags: sid bookworm > > burp’s autopkgtest fail…

Clapier, C. R., Iwasa, J., Cairns, B. R. & Peterson, C. L. Mechanisms of action and regulation of ATP-dependent chromatin-remodelling complexes. Nat. Rev. Mol. Cell Biol. 18, 407–422 (2017). CAS  PubMed  PubMed Central  Article  Google Scholar  Mashtalir, N. et al. Modular organization and assembly of SWI/SNF family chromatin remodeling complexes….

ggfx is a (currently experimantal) package that allows the use of various filters and shaders on ggplot2 layers. Installation You can install ggfx from CRAN in the usual manner (install.packages(‘ggfx’)) or you can grab the development version directly from github using the devtools package: # install.packages(‘devtools’) devtools::install_github(‘thomasp85/ggfx’) Example The basic…

Are you learning the R programming language? Want to learn how to do more tasks with R? Check out our Do More With R video tutorials below — most with accompanying text articles and code, almost all under 10 minutes. In the table below you can easily search all tutorials…

Subjects Normal breast and tumor samples were obtained with the written informed consent from donors and appropriate approval from local ethical committees, with the detailed information described in the respective original publications: normal tissue9, METABRIC14, TCGA35. Differential allelic expression analysis DNA and total RNA from 64 samples of normal breast…

dint May 9, 2022, 1:33pm #1 i’m just wondering if you can specify cadd, gnomad, clinvar and dbNSFP options when annotating with hail on dxjupyterlab_spark_cluster o the UKB RAP? From the hail website, the following command can be used on your matrix file to annotate with these features: db =…

You are receiving this mail as a port that you maintain is failing to build on the FreeBSD package build server. Please investigate the failure and submit a PR to fix build. Maintainer: y…@freebsd.org Log URL: beefy17.nyi.freebsd.org/data/main-i386-default/p429f3de9bdcd_s2573e6ced9/logs/cp2k-9.1.0.log Build URL: beefy17.nyi.freebsd.org/build.html?mastername=main-i386-default&build=p429f3de9bdcd_s2573e6ced9 Log: =>> Building science/cp2k build started at Sat Jun 4…

DOI: 10.18129/B9.bioc.sSNAPPY     This is the development version of sSNAPPY; for the stable release version, see sSNAPPY. Single Sample directioNAl Pathway Perturbation analYsis Bioconductor version: Development (3.16) A single sample pathway pertrubation testing methods for RNA-seq data. The method propagate changes in gene expression down gene-set topologies to compute…

I just learned how to run julia notebooks in binder. Now I want to use the PlotlyJS package in julia. Usually, when I need a package in julia on binder, I install it locally in a conda environment first and then copy Project.toml and Manifest.toml to my repository to start…

Transcript Lane: I’d like to share with you a high level view of why API specifications matter. How OpenAPI, AsyncAPI, JSON Schema and others are helping us standardize and deliver API lifecycle in a way that the machines understand. Also, allows us humans to better communicate, collaborate, and move forward…

jmair May 30, 2022, 11:38am #1 I created some resources for a few colleagues new to Julia, to enable them to use our SLURM cluster effectively, using existing packages like Distributed.jl and ClusterManagers.jl. These scripts and resources do nothing novel or imaginative, and are more of an example of how…

GitHub – Lucho-A/Rosalind: Set of solved bioinformatics problems algorithms from Rosalind site This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload…

A hello world service. Overview This server was generated by the openapi-generator project. By using the OpenAPI-Spec from a remote server, you can easily generate a server stub. To see how to make this your own, look here: README API version: 1.0 Build date: 2022-05-28T21:42:12.319613+10:00[Australia/Sydney] export GO_POST_PROCESS_FILE=”/usr/local/bin/gofmt -w” openapi-generator generate…

GitHub – ctlab/KEGG-network-pipeline This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You signed out in another…

3 month , My first post in the new student group , The false-positive mutation appears because duplicates mark Not enough ？, Tells the story of supplementary read It won’t be GATK MarkDuplicates Marked as duplicates The problem of . after , In response to this question , I began…

Porting GROMACS Across Heterogeneous Architectures In this second episode about GROMACS, one of the world’s most widely used open source molecular dynamics (MD) applications, we explore the quest to simplify portable, performant programming with Erik Lindahl, Biophysics Professor at Stockholm University & KTH Royal Institute of Technology, and Roland Schulz,…

Python for Bioinformatics: Biopython Published 05/2022 MP4 | Video: h264, 1280×720 | Audio: AAC, 44.1 KHz, 2 Ch Genre: eLearning | Language: English + srt | Duration: 11 lectures (1h 43m) | Size: 744.7 MB​ Learn Biopython in Google Colab.​ What you’ll learn You will learn to handle Biological Data…

DOI: 10.18129/B9.bioc.ComplexHeatmap     This package is for version 3.14 of Bioconductor; for the stable, up-to-date release version, see ComplexHeatmap. Make Complex Heatmaps Bioconductor version: 3.14 Complex heatmaps are efficient to visualize associations between different sources of data sets and reveal potential patterns. Here the ComplexHeatmap package provides a highly…

GitHub – AndyMSSMLab/PHEWAS_in_CNV: Scripts used for performing PheWAS analysis in CNVs This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to…

We deployed Jupyterhub in Kubernetes using the helm chart , the chart version is 0.9.0 github.com/jupyterhub/zero-to-jupyterhub-k8s/tree/main/jupyterhub zero-to-jupyterhub.readthedocs.io/en/latest/jupyterhub/installation.html Users creating virtual environments using the terminal and created kernals as well, But when they accessing the jupyter notebook using the newly created kernal and run the command !conda info It is not…

Hi Uri, Thank you for the patch! Yet something to improve: [auto build test ERROR on staging/staging-testing] url: github.com/intel-lab-lkp/linux/commits/Uri-Arev/staging-fbtft-fix-checkpatch-pl-struct-should-normally-be-const/20220520-012948 base: git.kernel.org/pub/scm/linux/kernel/git/gregkh/staging.git 4d0cc9e0e53e9946d7b8dc58279c62dfa7a2191b config: arm64-randconfig-r011-20220519 (download.01.org/0day-ci/archive/20220520/202205200821.nJQ0IfFt-lkp@xxxxxxxxx/config) compiler: clang version 15.0.0 (github.com/llvm/llvm-project e00cbbec06c08dc616a0d52a20f678b8fbd4e304) reproduce (this is a W=1 build): wget raw.githubusercontent.com/intel/lkp-tests/master/sbin/make.cross -O ~/bin/make.cross chmod +x ~/bin/make.cross # install arm64 cross compiling tool…

Hello, We want our device (STM32-F446RE running FreeRTOS + SIM7000G modem) to communicate to the AWS cloud. We are trying to follow the Cellular Interface Library Demo, in particular following the diagram We are using coreMQTT, MbedTLS 2.16 libraries, the amazon communication interface implementation for UART, and amazon UART API…

DNM filtering in 100,000 Genomes Project We analysed DNMs called in 13,949 parent–offspring trios from 12,609 families from the rare disease programme of the 100,000 Genomes Project. The rare disease cohort includes individuals with a wide array of diseases, including neurodevelopmental disorders, cardiovascular disorders, renal and urinary tract disorders, ophthalmological…

GitHub – akonecny/Bulk-RNAseq-Tumor_vs_Inflamed: TBD This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You signed out in…

GitHub – clara-parabricks/NVIDIA-Clara-Parabricks-Somatic-Variant-Calling-AWS-Blog: AWS Blog (Somatic Variant Calling ) This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your…

Most popular tags python javascript html java css reactjs c# php r sql arrays pandas c++ android jquery DataFrame python-3.x node.js c mysql list flutter JSON ios typescript sql-server swift string angular regex laravel excel django dictionary dart bash numpy postgresql loops oracle vba linux angularjs function for-loop spring spring-boot…

The goal of ggtranscript is the simplify the process of visualizing transcript structure and annotation. To achieve this, ggtranscript introduces 5 new geoms (geom_range(), geom_half_range(), geom_intron(), geom_junction() and geom_junction_label_repel()) as well as several helper functions. As a ‘ggplot2’ extension, ggtranscript inherits ‘ggplot2’s familiarity and flexibility, enabling users to intuitively adjust…

<!– .slide: data-background=”raw.githubusercontent.com/maxulysse/maxulysse.github.io/main/assets/img/svg/green_white_bg.svg&#8221; –> <a href=”nf-co.re”><img src=”raw.githubusercontent.com/nf-core/logos/master/nf-core-logos/nf-core-logo-darkbg.svg&#8221; width=”60%”></img></a> # What is nf-core\? [Maxime U Garcia](https://maxulysse.github.io/) ▸ [<i class=”fa fa-twitter” aria-hidden=”true”></i>@gau](https://twitter.com/gau/) | [<i class=”fa fa-github” aria-hidden=”true”></i>@maxulysse](https://github.com/maxulysse/) [Karolinska Institutet](https://ki.se/) | [Science for Life Laboratory](https://www.scilifelab.se/) Sweden — ## Overview – 🗄️ [Barntumörbanken](https://ki.se/forskning/barntumorbanken/) – 🧬 [NGI](https://ngisweden.scilifelab.se/) – 🍬 [Nextflow](https://www.nextflow.io/) – 🧙 [nf-core](https://nf-co.re/) — ##…

GitHub – vineethk57/Bank-Note-Authentication: Kaggle problem is converted into an end to end project. This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window….

Job:Programmer or Software Developer in Bioinformatics 0 Dr. Vikas Bansal’s research group (bansal-lab.github.io) in the School of Medicine at the University of California San Diego is looking for a programmer or software developer to advance the development of computational tools and methods for human genome analysis. Research in the group…

GitHub – newtonsgrandson/titanic-prediction: Kaggle Titanic Competition This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You signed…

BenchSci’s vision is to bring novel medicine to patients 50% faster by 2025. We’re achieving it by empowering scientists with the world’s most advanced biomedical artificial intelligence. Backed by F-Prime, Gradient Ventures (Google’s AI fund), and Inovia Capital, our platform accelerates science at 15 top-20 pharmaceutical companies and over 4,300…

So I downloaded pymc3 (uninstalled and reinstalled a few times) and every time I try to import pymc3 into a jupyter notebook I get some kind of error. I am guessing that I am having an issue with how I am installing Pymc3, I followed this tutorial: github.com/pymc-devs/pymc/wiki/Installation-Guide-(Windows). After my…

How to use mbedTLS library in Keil or IAR IDEs? I want to do an RSA encryption/decryption using my AT91SAM7S256 ARM MCU.After googling I found mbed TLS library. The IP networking interface includes TLSSockets which behave similarly to normal TCP sockets but automatically use Mbed TLS to set up a…

GitHub – archinetai/surgeon-pytorch: A library to inspect itermediate layers of PyTorch models. This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload…

Mohammed Guys, does anyone know the answer? get which of the following are the prerequisite packages for scikit-learn? from screen. Installing scikit There are different ways to install scikit-learn: Install the latest official release. This is the best approach for most users. It will provide a stable version and pre-built…

12 July 2019 I wrote a blog post on a potential reference pan-genome model. I had more thoughts in my mind. I didn’t write about them because they are immature. Nonetheless, a few readers raised questions related to my immature thoughts, so I decide to add this “Part II” as…

GitHub – dyxstat/HiFine: HiFine: integrating Hi-c-based and shotgun-based methods to reFine binning of metagenomic contigs This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab…

Hello, i need to add a step into a script (find attached). The step is DNA sequencing with a Python library, for example: [login to view URL] [login to view URL] [login to view URL] You can find many on Github. Thanks Skills: Python, GitHub, Bioinformatics See more: need classified…

I’m using this pipeline for deriving variants from RNA sequencing data: github.com/modupeore/VAP which uses specific versions of various tools, including HaplotypeCaller from GATK (v3.8-0-ge9d806836). The final step is a set of hard filters on the called variants (applied using VariantFilter), but looking at the log files, there are a lot…

Sometimes a client wants two y scales. Giving them the “flawed” speech is often pointless. But I do like the ggplot2 insistence on doing things the right way. I am sure that ggplot is in fact educating the average user about proper visualization techniques. Starting with ggplot2 2.2.0 you can…

goa version 3.7.2 Design The field name anyobject with Attribute MapOf(String, Any) should describe a map of string to any unknown value. For HTTP requests, the field anyobject can be sent like the following (i.e. any json object): { “anyobject”: { “testkey”: 10, “test1”: “testval”, “myarr”: [ { “nestedk”: {…

Provided by: libbio-perl-perl_1.7.2-2_all NAME Bio::Tools::Seg – parse “seg” output SYNOPSIS use Bio::Tools::Seg; my $parser = Bio::Tools::Seg->(-file => ‘seg.fasta’); while ( my $f = $parser->next_result ) { if ($f->score < 1.5) { print $f->location->to_FTstring, ” is low complexity\n”; } } DESCRIPTION “seg” identifies low-complexity regions on a protein sequence. It is…

16S is a very conserved sequence, which is why it’s used for targeted phylogenetic analysis; it makes it easy to amplify and analyse. Unfortunately that conservation is an issue with minimap2, which is built around the idea that matching scattered subsequences within a sequence is good enough for identifying matches…

Abstract Deep learning has shown great promise in the prediction of the gRNA efficiency, which helps optimize the engineered gRNAs, and thus has greatly improved the usage of CRISPR-Cas systems in genome editing. However, the black box prediction of deep learning methods does not provide adequate explanation to the factors…

GitHub – ErasmusMC-Bioinformatics/TTT This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. You can’t perform that action at this time. You signed in with another tab or window. Reload to refresh your session. You signed out in another…

Job details Job type full-time Full job description Location: loc_roberts-roberts ctr pediatric research req id: 134035 shift: days employment status: regular – full time job summary the bioinformatics unit (bixu) within the center for data driven discovery (d3b) at the children’s hospital of philadelphia (chop) is seeking a level iii…

conda-forge community driven packaging for conda Recipes Details: About conda-forge. conda-forge is a GitHub organization containing repositories of conda recipes. Thanks to some awesome continuous integration providers (AppVeyor, Azure Pipelines, CircleCI and TravisCI), each repository, also known as a feedstock, automatically builds its own recipe in a clean and repeatable…