Tag: gRNA

CRISPR/Cas editing tools

Sponsored Content by GenScriptNov 16 2022Reviewed by Maria Osipova In a new application for CRISPR/Cas editing tools, researchers at Harvard Medical School, Boston, Massachusetts, have created a CRISPR/Cas9 ribonucleoprotein-based peptide display approach. This technique is hoped to simplify the peptide library analysis workflow by using a new technique called peptide immobilization…

Continue Reading CRISPR/Cas editing tools

Extra-hematopoietic immunomodulatory role of the guanine-exchange factor DOCK2

Cell isolation, reprogramming and culture Approval was obtained for human cell and tissue sample collection and genetic reprogramming from the Institutional Review Board (protocols 19–252, 18–243, 21–060, 19–284 and 415-E/1776/4-2014, Ethics Committee of the province of Salzburg). Adult samples were collected in accordance with the Declaration of Helsinki after written…

Continue Reading Extra-hematopoietic immunomodulatory role of the guanine-exchange factor DOCK2

Evasion of cGAS and TRIM5 defines pandemic HIV

Cells and reagents HEK293T and U87 cells were maintained in DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Labtech) and 100 U ml−1 penicillin plus 100 μg ml−1 streptomycin (Pen/Strep; Gibco). THP-1-IFIT1 cells that had been modified to express Gaussia luciferase under the control of the IFIT1 promoter were described previously62. THP-1…

Continue Reading Evasion of cGAS and TRIM5 defines pandemic HIV

Precise DNA cleavage using new CRISPR-Cas approach

A team led by investigators at Massachusetts General Hospital (MGH) has overcome a major constraint for cutting and editing DNA by CRISPR-Cas enzymes and other technologies. The recent innovation, which is published in Nature Biotechnology, will simplify and expedite molecular cloning approaches and expand their utility. CRISPR-Cas editing has transformed…

Continue Reading Precise DNA cleavage using new CRISPR-Cas approach

CRISPR-SpRYgests Enable Precise Cleavage of DNA Bases In Vitro

NEW YORK — A CRISPR-Cas variant engineered to no longer need a protospacer adjacent motif (PAM) can be harnessed to make cuts at any DNA base in vitro, a new study reports. Its ability to make precise breaks anywhere could be applied to a number of DNA engineering applications. Researchers…

Continue Reading CRISPR-SpRYgests Enable Precise Cleavage of DNA Bases In Vitro

The Global CRISPR Market Evaluated to Surge at $4521.76 Million

CRISPR Market A recent study by Triton Market Research titled ‘Global CRISPR Market’ includes the Global Analysis and Forecasts by Industry Verticals (Therapeutics and Drug Discovery, Biological Research, Agricultural Biotech, Industrial Biotech), Application (Genome Editing/Genetic Engineering, Cell Line Engineering, CRISPR Plasmid, Human Stem Cells, gRNA Database/Gene Library), Product (Designing Tools,…

Continue Reading The Global CRISPR Market Evaluated to Surge at $4521.76 Million

The crisprVerse: a comprehensive Bioconductor ecosystem for the design of CRISPR guide RNAs across nucleases and technologies

Abstract The success of CRISPR-mediated gene perturbation studies is highly dependent on the quality of gRNAs, and several tools have been developed to enable optimal gRNA design. However, these tools are not all adaptable to the latest CRISPR modalities or nucleases, nor do they offer comprehensive annotation methods for advanced…

Continue Reading The crisprVerse: a comprehensive Bioconductor ecosystem for the design of CRISPR guide RNAs across nucleases and technologies

Transcription-independent regulation of STING activation and innate immune responses by IRF8 in monocytes

Reagents, antibodies, viruses and cells LMW-Poly(I:C), LPS, 2′3′-cGAMP and DMXAA (InvivoGen); hydroxyurea, camptothecin and mitomycin C (MCE); GM-CSF, Flt3L (peproTech); lipofectamine 2000 (Invitrogen); polybrene (Millipore); RNAiso Plus (Takara); HT-DNA (Sigma); SYBR (BIO-RAD); dual-specific luciferase assay kit (Promega); ELISA kit for murine Ifn-β (PBL); ELISA kits for murine IP-10 (Biolegend) were…

Continue Reading Transcription-independent regulation of STING activation and innate immune responses by IRF8 in monocytes

Efficient genome editing in wild strains of mice using the i-GONAD method

Mice A laboratory strain B6 was purchased from CLEA Japan Inc. (Tokyo, Japan), while nine wild strains (BFM/2, BLG2, CHD, HMI, KJR, MSM, NJL, PGN2, and SWN) were bred at NIG (Shizuoka, Japan) (Table 1). All mice were maintained at the animal facility in NIG, under specific-pathogen-free conditions and controlled…

Continue Reading Efficient genome editing in wild strains of mice using the i-GONAD method

Multidrug resistance microbial therapy | VMRR

Introduction Antimicrobials are the most important and useful therapeutic discovery in the history of medicine. It allows living beings to survive the microbial disease, enhances invasive surgical procedures, ensures animal health, and protects the food chain since 1928 after the discovery of penicillin. However, the indiscriminate use of antibiotics and…

Continue Reading Multidrug resistance microbial therapy | VMRR

CRISPR Cas9 market valuation to surge at healthy CAGR through 2026

The latest report of the CRISPR Cas9 market elaborates on factors driving and hindering growth of the industry. Moreover, the report provides exhaustive information about opportunities that can help boost the revenue flow in the forecast period. Furthermore, it compiles extensive data on the key regional markets and competitive landscape….

Continue Reading CRISPR Cas9 market valuation to surge at healthy CAGR through 2026

Towards a More Precise and Effective Use of CRISPR

Human imagination is the only limit when it comes to the potential of genetic engineering – especially after the breakthrough of CRISPR technology. A new Danish research project can help refine the method and is a step towards a more precise and effective use of ‘genetic scissors’. “Our study shows…

Continue Reading Towards a More Precise and Effective Use of CRISPR

extendedSequences length is not the required for DeepCpf1 (34bp)

Hi, I’m using CRISPRseek dev v. 1.35.2, installed from github (hukai916/CRISPRseek). I wanted to calculate the CFD, and the grna efficacy of a Cas12 sgRNA (my_sgrna.fa file) using Deep Cpf1. my_sgrna.fa, TTTT (PAM) + sgRNA (20bp): >sgrna1 TTTTTGTCTTTAGACTATAAGTGC Command: offTargetAnalysis(inputFilePath = “my_sgrna.fa”, format = “fasta”, header = FALSE, exportAllgRNAs =…

Continue Reading extendedSequences length is not the required for DeepCpf1 (34bp)

Cas12c provides antiviral immunity without the need to cut DNA

Graphical abstract. Credit: Molecular Cell (2022). DOI: 10.1016/j.molcel.2022.04.020 A trio of researchers at the University of California, Berkeley, has found that the protein Cas12c can provide antiviral immunity for bacteria without the need to cut DNA. In their paper published in the journal Molecular Cell, Carolyn Huang, Benjamin Adler and…

Continue Reading Cas12c provides antiviral immunity without the need to cut DNA

VectorBuilder | Revolutionizing Gene Delivery.

RSV promoter: Rous sarcoma virus promoter. It drives transcription of viral RNA in packaging cells. This RNA is then packaged into live virus. Δ5′ LTR: A deleted version of the HIV-1 5′ long terminal repeat. In wildtype lentivirus, 5′ LTR and 3′ LTR are essentially identical in sequence. They reside…

Continue Reading VectorBuilder | Revolutionizing Gene Delivery.

In vivo hypermutation and continuous evolution

Arnold, F. H. Design by directed evolution. Acc. Chem. Res. 31, 125–131 (1998). Google Scholar  Packer, M. S. & Liu, D. R. Methods for the directed evolution of proteins. Nat. Rev. Genet. 16, 379–394 (2015). Google Scholar  Drake, J. W., Charlesworth, B., Charlesworth, D. & Crow, J. F. Rates of…

Continue Reading In vivo hypermutation and continuous evolution

WGS Facilitates Gene Editing System Upgrade

Researchers at the Korean Institute of Life Sciences and Technology engineered an efficient, miniaturized CRISPR-Cas gene-editing system that may be more easily packed into vectors for clinical applications. Their system employs the Cas variant Cas12f1 with a guide RNA (gRNA) remodeled to mitigate off-target effects, a design that could potentially…

Continue Reading WGS Facilitates Gene Editing System Upgrade

Global CRISPR/Cas9 Market In- Depth Research, Industry Statistics 2022

Global “CRISPR/Cas9 Market” Reports 2022 provide key industry studies for CRISPR/Cas9 manufacturers with specific statistics, significance, definition, SWOT analysis, expert opinion and the latest developments in the world. The research report also covers market size, price, sales, revenue, market shares, gross margin, growth rate and cost structure. The report aims…

Continue Reading Global CRISPR/Cas9 Market In- Depth Research, Industry Statistics 2022

CRISPR/Cas9 deletions induce adverse on-target genomic effects

Clustered regularly interspaced short palindromic repeats (CRISPR/Cas9) have transformed genome engineering techniques. Numerous toolsets have been created to enable easy and efficient loss-of-function perturbations of functional genomic sites. Study: CRISPR/Cas9 deletions induce adverse on-target genomic effects leading to functional DNA in human cells. Image Credit: elenabsl/Shutterstock The CRISPR/Cas9 system’s elements…

Continue Reading CRISPR/Cas9 deletions induce adverse on-target genomic effects

CRISPR-VAE: A Method for Explaining CRISPR/Cas12a Predictions, and an Efficiency-aware gRNA Sequence Generator

Abstract Deep learning has shown great promise in the prediction of the gRNA efficiency, which helps optimize the engineered gRNAs, and thus has greatly improved the usage of CRISPR-Cas systems in genome editing. However, the black box prediction of deep learning methods does not provide adequate explanation to the factors…

Continue Reading CRISPR-VAE: A Method for Explaining CRISPR/Cas12a Predictions, and an Efficiency-aware gRNA Sequence Generator

Parkinson’s disease motor symptoms rescue by CRISPRa-reprogramming astrocytes into GABAergic neurons

doi: 10.15252/emmm.202114797. Online ahead of print. Jessica Giehrl-Schwab #  1   2 , Florian Giesert #  1   2 , Benedict Rauser  1   2 , Chu Lan Lao  3   4 , Sina Hembach  1   2 , Sandrine Lefort  5 , Ignacio L Ibarra  6 , Christina Koupourtidou  3   7 , Malte Daniel Luecken  6 , Dong-Jiunn Jeffery…

Continue Reading Parkinson’s disease motor symptoms rescue by CRISPRa-reprogramming astrocytes into GABAergic neurons

dCas9-VP64-Blasticidin SAM CRISPRa Helper Construct 1 Plasmid DNA

This product is a lentiviral plasmid that utilizes the EF1 alpha promoter to drive expression of dCas9-VP64 and blasticidin resistance cassette linked by a 2A peptide (EF1a-dCas9-VP64-2A-Blasticidin) allowing for easy selection following successful transfection or transduction. Use Sigma′s lentiviral dCas9-VP64 plasmid for generation of lentiviral particles and efficient production of…

Continue Reading dCas9-VP64-Blasticidin SAM CRISPRa Helper Construct 1 Plasmid DNA

Cutting Edge Agriculture Gene Editing with Cas-CLOVER

Blog Agriculture Biotechnology Though CRISPR-Cas enabled targeted genome engineering across a vast array of organisms, the system features major disadvantages. Frequent off-target mutagenesis, licensing restrictions and non-ideal economic license terms have inhibited commercial crop-science product upscaling, and, in many cases, entirely disqualified CRISPR’s use by many commercial crop developers. Seeking…

Continue Reading Cutting Edge Agriculture Gene Editing with Cas-CLOVER

Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

In nature, microbes have evolved different systems to sense external stimuli. Synthetic biology approaches (1) repurpose these systems as biosensors to specifically and sensitively detect various targets of interest. Although various highly sensitive and specific laboratory-based analytical methods (including high-performance liquid chromatography and mass spectrometry) can detect small-molecule targets, they…

Continue Reading Development of Cas12a-Based Cell-Free Small-Molecule Biosensors via Allosteric Regulation of CRISPR Array Expression

LAMP-CRISPR-Cas12a-lateral flow immunochromatographic strip | IDR

Introduction About 700,000 people die from “superbugs” globally every year. Antibiotic abuse is the culprit of extensive spread of superbugs. Currently, carbapenemase-producing organisms are among the most important pathogens of hospital infections. Especially the plasmid-mediated highly transmissible carbapenem-resistant Enterobacterales (CRE) has become an important public health issue of global concern….

Continue Reading LAMP-CRISPR-Cas12a-lateral flow immunochromatographic strip | IDR

dCas9-VPR-mediated transcriptional activation of functionally equivalent genes for gene therapy

1. Dunbar, C. E. et al. Gene therapy comes of age. Science 359, eaan4672 (2018). PubMed Google Scholar  2. Wang, D., Tai, P. W. L. & Gao, G. Adeno-associated virus vector as a platform for gene therapy delivery. Nat. Rev. Drug Discov. 18, 358–378 (2019). CAS PubMed PubMed Central Google Scholar  3. Eid, A.,…

Continue Reading dCas9-VPR-mediated transcriptional activation of functionally equivalent genes for gene therapy

CRISPR-Cas12a ribonucleoprotein-mediated gene editing in the plant pathogenic fungus Magnaporthe oryzae

. 2021 Dec 24;3(1):101072. doi: 10.1016/j.xpro.2021.101072. eCollection 2022 Mar 18. Affiliations Expand Affiliation 1 Department of Plant Pathology, Kansas State University, Manhattan, KS, USA. Free PMC article Item in Clipboard Jun Huang et al. STAR Protoc. 2021. Free PMC article Show details Display options Display options Format AbstractPubMedPMID . 2021 Dec…

Continue Reading CRISPR-Cas12a ribonucleoprotein-mediated gene editing in the plant pathogenic fungus Magnaporthe oryzae

Structural basis for mismatch surveillance by CRISPR/Cas9

Abstract The widespread use of CRISPR/Cas9 as a programmable genome editing tool has been hindered by off-target DNA cleavage (Cong et al., 2013; Doudna, 2020; Fu et al., 2013; Jinek et al., 2013). While analysis of such off-target editing events have enabled the development of Cas9 variants with greater discrimination…

Continue Reading Structural basis for mismatch surveillance by CRISPR/Cas9

CRISPR-PN2: a new way to study parasitic nematodes

A new online software for CRISPR experiments, called CRISPR-PN2 has been developed for a wide range of experiments in parasitic nematodes. A web-based CRISPR tool, called CRISPR-PN2, has been developed by Damien M O’Halloran from The George Washington University (WA, USA). The CRISPR-PN2 software allows flexible control over the automated…

Continue Reading CRISPR-PN2: a new way to study parasitic nematodes

The Point of Base Editors: Correcting Point Mutations

Some genome editing systems are highly conspicuous. They introduce double-strand breaks to DNA that attract the attention of cellular mechanisms such as nonhomologous end joining and homology-directed repair. If a genome editing system is so brash as to attempt a sizable insertion of new DNA, homology-directed repair must ensure that…

Continue Reading The Point of Base Editors: Correcting Point Mutations

CRISPR Applications in Medicine Depend on Minimizing Off-Target Editing

By Rolf Turk, PhD Genome editing technologies, such as CRISPR, are being applied to better understand basic biological systems as well as to research new kinds of gene and cell therapies. The CRISPR-Cas9 system comprises a Cas9 endonuclease protein that forms a complex with a guide RNA (gRNA) molecule, which…

Continue Reading CRISPR Applications in Medicine Depend on Minimizing Off-Target Editing

Modification of endoglin-targeting nanoliposomes | IJN

Introduction Today, malignant tumors (cancer) still severely imperil human health and cause millions of global mortality rates.1,2 Deep-seated solid tumors are challenging to cure by most therapeutic tools, mainly blamed on the complex tumor microenvironment (TME).3,4 Adoptive cell therapy (ACT), as one of the effective immunotherapeutic means for cancer treatment,…

Continue Reading Modification of endoglin-targeting nanoliposomes | IJN

CRISPR: Guide to gRNA design

Introduction to CRISPR in SnapGene Genome editing technology has been evolving for many years. The Holy Grail of genome engineering has always been to introduce a specific genetic change that affects only the genomic target and leaves no undesired changes in the DNA. The discovery and application of the bacterial…

Continue Reading CRISPR: Guide to gRNA design

Another Milestone for CRISPR-Cas9 Technology: First Trial Data for Treatment Delivered Intravenously

Unlike most other CRISPR/Cas-9 therapies that are ex vivo treatments in which cells are modified outside the body, this study was successful with an in vivo treatment Use of CRISPR-Cas9 gene editing technology for therapeutic purposes can be a boon for clinical laboratories. Not only is this application a step…

Continue Reading Another Milestone for CRISPR-Cas9 Technology: First Trial Data for Treatment Delivered Intravenously