Tag: hg38

Scatter Gather principle by chromosome on Gatk 0 Hi all, On a quest to optimize gatk pipeline, I met scatter gather principle, so I did following, pids= for chr in chr1 chr2 chr3 chr4 chr5 chr6 chr7 chr8 chr9 chr10 chr11 chr12 chr13 chr14 chr15 chr16 chr17 chr18 chr19 chr20…

encode gt of hg38 to machine learning 0 Hi I’m new in the field , I have a large vcf file that have many variants with many sample I extract gt for each sample / variants to get a matrix to do a machine learning algorithem now, I need to…

This directory contains reciprocal-best netted chains for hg38-apaSpi1. – hg38.apaSpi1.rbest.net.gz: hg38-referenced recip.best net to apaSpi1. – hg38.apaSpi1.rbest.chain.gz: chains extracted from the recip.best net. These can be passed to the liftOver program to translate coords from hg38 to apaSpi1 through the recip.best net. – apaSpi1.hg38.rbest.net.gz: apaSpi1-referenced recip.best net. – apaSpi1.hg38.rbest.chain.gz: recip.best…

I tried your suggestion **samtools view -H qname_unknown_circle.bam** and the output result is like this： yu@root:~$ samtools view -H qname_unknown_circle.bam @HD VN:1.5 SO:queryname @SQ SN:chr1 LN:248956422 @SQ SN:chr10 LN:133797422 @SQ SN:chr11 LN:135086622 ………(Many lines like this ‘@SQ SN:chrxx LN:xxxx’ are omitted) @SQ SN:chrY_KI270740v1_random LN:37240 @HD VN:1.5 SO:unsorted GO:query @PG ID:bwa…

Legend Please note that a short description of a certain column can be displayed when you move your mouse cursor over the column’s header and hold it still. Below, a more detailed description is shown per column. Effect: The variant’s effect on the protein’s function, in the format ‘R/C’ where…

Updating hg 18 .bim file with lifted .map and .bed file 0 Hello, I am trying to update rsids in an hg18 .bim file with an hg38.bed and hg38.map file. I’ve tried the following: system(“./plink –file plink_hg38 –make-just-bim –out newBim –allow-extra-chr”) but got the error: Error: Failed to open plink_hg38.ped….

Use drop-down controls below and press refresh to alter tracks displayed.Tracks with lots of items will automatically be displayed in more compact modes.    Custom Tracks H3K27ac Meta NeuN SCZhidedensesquishpackfull H3K27ac NeuN SCZ del_CRDhidedensesquishpackfull H3K27ac NeuN SCZ del_CRD_del_peakshidedensesquishpackfull H3K27ac Tissuehidedensesquishpackfull H3K27ac Tissue BDhidedensesquishpackfull H3K27ac Tissue BD del_CRDhidedensesquishpackfull H3K27ac Tissue BD…

Name Last modified Size Description Parent Directory – GTEX-1C475-0726-SM-73KVL.Esophagus_Muscularis.RNAseq.bw 2019-12-16 09:16 160M GTEX-1C475-1826-SM-73KWA.Skin_Sun_Exposed_Lower_leg.RNAseq.bw 2019-12-16 09:16 194M GTEX-1GMR3-0626-SM-9WYT3.Artery_Coronary.RNAseq.bw 2019-12-16 09:16 177M GTEX-1H1E6-0826-SM-9WG83.Pancreas.RNAseq.bw 2019-12-16 09:16 122M GTEX-1HFI6-0011-R7b-SM-CM2SS.Brain_Putamen_basal_ganglia.RNAseq.bw 2019-12-16 09:16 172M GTEX-1HGF4-0011-R5b-SM-CM2ST.Brain_Caudate_basal_ganglia.RNAseq.bw 2019-12-16 09:17 178M GTEX-1HSGN-0726-SM-A9G2F.Thyroid.RNAseq.bw 2019-12-16 09:17 194M GTEX-1HSKV-0011-R1b-SM-CMKH7.Brain_Hippocampus.RNAseq.bw 2019-12-16 09:17 149M GTEX-1I1GU-1226-SM-A9SKT.Esophagus_Gastroesophageal_Junction.RNAseq.bw 2019-12-16 09:17 186M GTEX-1IDJC-1326-SM-CL53H.Colon_Transverse.RNAseq.bw 2019-12-16 09:17 217M GTEX-1IDJU-1026-SM-AHZ2U.Vagina.RNAseq.bw 2019-12-16…

R-A7993 – YFull YTree Info SNPs currently defining R-A7993 A7993     Sample ID Country / Language Info Ref File Testing company Statistics Status YF063745 —— R-A7993 R-A7993*, R-FGC59783* Hg38 .BAM FTDNA (Y700) 30X, 18.6 Mbp, 151 bp YF015291 Germany (Rheinland-Pfalz) R-A7993 R-A7993*, R-FGC59783* Hg38 .BAM FTDNA (Y500) 28X, 12.1 Mbp,…

Name Last modified Size Description Parent Directory   –   chm13v2.0_RefSeqStri..> 2022-08-22 01:51 2.0M   chm13v2.0_RefSeq_12A..> 2022-08-22 01:51 2.5M   code/ 2022-08-22 01:53 –   hg38_RefSeqStrict_22..> 2022-08-22 01:51 2.3M   hg38_RefSeq_22Apr202..> 2022-08-22 01:51 3.0M   mm10_RefSeqStrict_22..> 2022-08-22 01:51 2.0M   mm10_RefSeq_22Jun202..> 2022-08-22 01:51 2.5M   mm39_RefSeqStrict_23..> 2022-08-22 01:51 1.9M  …

Study population The study sample included 34,072 unrelated (3rd degree or less) TOPMed participants from eight U.S. based cohort studies: Jackson Heart Study (JHS; n = 2504), Framingham Heart Study (FHS; n = 3520), Hispanic Community Health Study/Study of Latinos (HCHS/SOL; n = 6,408), Atherosclerosis Risk in Communities study (ARIC; n = 6197), Cardiovascular Health Study (CHS; n = 2835),…

Introduction Severe pneumonia is one of the most common causes of infectious diseases among patients in the intensive care unit (ICU), and this can lead to various complications and high mortality.1–3 Timely and accurate pathogen diagnoses are crucial for appropriate antimicrobial therapy and improved clinical outcomes. However, the low detection…

Cell culture Human glioblastoma cells (U87MG and U87MG-Luc) and human embryonic kidney cells (HEK293) were obtained from the American Type Culture Collection (Manassas, Va.). Cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum (Gibco™ Fetal Bovine Serum South America, Thermo Scientific Fisher-US), 2 mM l-glutamine, 50 U/ml…

This directory contains reciprocal-best netted chains for macEug2-hg38. – macEug2.hg38.rbest.net.gz: macEug2-referenced recip.best net to hg38. – macEug2.hg38.rbest.chain.gz: chains extracted from the recip.best net. These can be passed to the liftOver program to translate coords from macEug2 to hg38 through the recip.best net. – hg38.macEug2.rbest.net.gz: hg38-referenced recip.best net. – hg38.macEug2.rbest.chain.gz: recip.best…

Sample ID Country / Language Info Ref File Testing company Statistics Status I7021 Mongolia (Bulgan) C-F15910 C-F15910*, C-Y507 Hg19 .BAM Ancient 3X, 20.2 Mbp, 40 bp NEO249 Russia (Chukotskiy avtonomnyy okrug) C-F15910* —— Hg19 .BAM Ancient 1X, 7.2 Mbp, 81 bp I11696 Mongolia (Bulgan) C-Y507 —— Hg19 .BAM Ancient 2X,…

stay In the first two sections , We compared the differences vcf Use of annotation software , And convert the demerit recorded after the annotation into maf File format , because snpeff The comment result cannot be converted to maf, So we will compare later ANNOVAR、VEP、GATK Funcatator The results of…

J-BY3 – YFull YTree Info SNPs currently defining J-BY3 BY3 / FGC15184     Sample ID Country / Language Info Ref File Testing company Statistics Status YF016315 —— J-FGC15174 J-FGC15174*, J-FGC15168*, J-FT258574 Hg38 .BAM FTDNA (Y500) 23X, 12.0 Mbp, 151 bp YF068400 Sudan (Janūb Kurdufān) J-FGC38453* —— Hg38 .BAM FTDNA (Y700)…

Subjects Normal breast and tumor samples were obtained with the written informed consent from donors and appropriate approval from local ethical committees, with the detailed information described in the respective original publications: normal tissue9, METABRIC14, TCGA35. Differential allelic expression analysis DNA and total RNA from 64 samples of normal breast…

Q-YP3952 – YFull YTree Info Sample ID Country / Language Info Ref File Testing company Statistics Status YF073154 Russia (Chechenskaya Respublika) / Chechen Q-YP3952* —— Hg38 .BAM FTDNA (Y700) 33X, 18.2 Mbp, 151 bp YF092378 Russia (Chechenskaya Respublika) / Chechen Q-BZ87 —— Hg38 .BAM FTDNA (Y700) 55X, 18.5 Mbp, 151…

Hi all, I am new to R and Seurat, and I am following Seurat tutorials to find anchors between RNA-seq and ATAC-seq data according to: Combining the two tutorials is difficult for a cell line data set I am using for SNARE-seq Human here. I managed to run the following…

Variant #0000255165 (NC_000010.10:g.123278248A>G, FGFR2(NM_000141.4):c.939+1245T>C) Chromosome 10 Allele Unknown Affects function (as reported) Probably does not affect function Affects function (by curator) Not classified Classification method – Clinical classification likely benign DNA change (genomic) (Relative to hg19 / GRCh37) g.123278248A>G DNA change (hg38) g.121518734A>G Published as FGFR2(NM_022970.3):c.1035T>C (p.Y345=) ISCN – DB-ID FGFR2_000119 Variant remarks VKGL data sharing initiative Nederland Reference – ClinVar ID – dbSNP ID – Origin CLASSIFICATION record Segregation –…

I don’t see where you’re actually reading from the file in the first place. You have to actually read your path_text.txt before you can format it correctly right? with open(‘path_text.txt’,’r’,encoding=’utf-8′) as myfile: content = myfiel.read().splitlines() Which will give you [‘/gp/oi/eu/gatk/inputs/NA12878_24RG_med.hg38.bam’, ‘/gp/oi/eu/gatk/inputs/NA12878_24RG_small.hg38.bam’] in content. Now if you want to write this…

R-Z697 – YFull YTree Info SNPs currently defining R-Z697 Z697     Sample ID Country / Language Info Ref File Testing company Statistics Status YF009397 Sweden (Västra Götalands län) R-Z697* —— Hg19 .BAM FTDNA (Y500) 81X, 14.4 Mbp, 165 bp YF084333 Italy (Chieti) R-FT285492 —— Hg38 .BAM Dante Labs 14X, 23.4…

R-Y140591 – YFull YTree Info Sample ID Country / Language Info Ref File Testing company Statistics Status YF067865 Germany R-Y140591* —— Hg38 .BAM FTDNA (Y700) 52X, 18.7 Mbp, 151 bp YF076495 Germany R-FT167842 —— Hg38 .BAM FTDNA (Y700) 49X, 18.3 Mbp, 151 bp YF067633 Germany R-FT167842 —— Hg38 .BAM FTDNA…

Sample ID Country / Language Info Ref File Testing company Statistics Status HGDP01351 China, People’s Republic of O-F3607* —— Hg38 .BAM Scientific 16X, 23.6 Mbp, 151 bp YF079316 —— O-Y224790 —— Hg19 .BAM 23mofang 58X, 21.3 Mbp, 150 bp HG00583 China, People’s Republic of O-Y224790 —— Hg19 .BAM Scientific ——…

R-A114 – YFull YTree Info SNPs currently defining R-A114 FGC78244     A114(H)     H Sample ID Country / Language Info Ref File Testing company Statistics Status YF067576 France (Ille-et-Vilaine) R-A114* —— Hg19 .BAM Dante Labs 12X, 23.0 Mbp, 151 bp YF088360 United States (Virginia) R-CTS4466* —— Hg38 .BAM FTDNA (Y700)…

Sample ID Country / Language Info Ref File Testing company Statistics Status ERS5240131 Singapore C-F13864* —— Hg19 .BAM Scientific 7X, 22.9 Mbp, 150 bp YF076683 China, People’s Republic of (Shandong) C-F13864* —— Hg19 .BAM 23mofang 57X, 21.2 Mbp, 150 bp YF071813 —— C-F13864* —— Hg19 .BAM 23mofang 21X, 21.8 Mbp,…

I was trying to use the getPlotSetArray() function, but I got the error ‘No genomes installed!’ from the getREF function. I digged into the problem and it turns out that in the latest version of the BSgenome package the output of the function BSgenome::installed.genomes(splitNameParts=TRUE) changed from: pkgname organism provider provider_version…

I am exploring modifications of hg38 like these: github.com/mebbert/Dark_and_Camouflaged_genes Starting from the regular bcbio hg38 data installation Masking hg38.fa using bedtools maskfasta Generating indexes using bcbio_setup_genome.py for seq and bwa as described in the manual The bwa directory then contains ├── bwa │   ├── hg38_masked.fa.amb │   ├── hg38_masked.fa.ann │   ├──…

I-L1193 – YFull YTree Info SNPs currently defining I-L1193 L1193     FGC87558     Y72031     Sample ID Country / Language Info Ref File Testing company Statistics Status ASH1 Ireland (Tipperary) I-L1193* —— Hg19 .BAM Ancient 1X, 10.5 Mbp, 101 bp PB581 Ireland (Clare) I-L1193* —— Hg19 .BAM Ancient 2X, 15.8…

Dear sir, When I ran “rsem-calculate-expression –paired-end –alignments -p 8input.bam” gencodev22 ./out. I got error message rsem-parse-alignments ../bowtie2/hg38 ./rsem-out.temp/rsem-out ./rsem-out.stat/rsem-out /NGS_Storage/Debbie/RNA-seq/variant_calling_20210602/RNA-leukemia002A-906.para.bam 3 -tag XM Read A00355:209:H3KTLDSX2:2:2606:24677:17425: The adjacent two lines do not represent the two mates of a paired-end read! (RSEM assumes the two mates of a paired-end read should…

PALM SPRINGS, Calif. — Researchers from the Telomere-to-Telomere (T2T) Consortium have generated an assembly of a complete human reference genome that could lead to better variant calling in the clinic and inform new studies of cell biology. The results of the project were presented by Karen Miga, an investigator at…

J-Y18411 – YFull YTree Info Sample ID Country / Language Info Ref File Testing company Statistics Status YF072520 Albania J-BY111710 —— Hg19 .BAM Dante Labs 10X, 22.8 Mbp, 151 bp YF067307 Palestine (Nablus) J-BY111710 —— Hg38 .BAM FTDNA (Y700) 34X, 18.7 Mbp, 151 bp NA20827 Italy (Firenze) J-CTS3330 —— Hg19…

Hi: I am a bit confuse with the the relationship/difference between knownGene and wgEncodeGencodeCompV39 on UCSC Table Browser. Anyone know the precise difference between them? They both can be downloaded from the goldenPath page. knownGene: The schema is here, which is NOT match the file (knownGene.txt.gz) I downloaded. According to…

When I try to install the gtf for hg38 BiocManager::install(“TxDb.Hsapiens.UCSC.hg38.knownGene”) I get the following error: ‘getOption(“repos”)’ replaces Bioconductor standard repositories, see ‘?repositories’ for details replacement repositories: CRAN: cran.rstudio.com/ Bioconductor version 3.14 (BiocManager 1.30.16), R 4.1.2 (2021-11-01) Installing package(s) ‘TxDb.Hsapiens.UCSC.hg38.knownGene’ Error in readRDS(dest) : error reading from connection Per stackoverflow.com/questions/67455984/getoptionrepos-replaces-bioconductor-standard-repositories-see-reposito I…

B-M8498 – YFull YTree Info Sample ID Country / Language Info Ref File Testing company Statistics Status YF004283 Saudi Arabia B-M8498* —— Hg19 .BAM FTDNA (Y500) 43X, 13.7 Mbp, 165 bp HGDP00992 Namibia B-M7650* —— Hg38 .BAM Scientific 18X, 23.5 Mbp, 151 bp YF013963 —— B-Y82361 —— Hg38 .BAM FTDNA…

I-FGC15109 – YFull YTree Info SNPs currently defining I-FGC15109 FGC15109     Sample ID Country / Language Info Ref File Testing company Statistics Status SZ43 Hungary (Somogy) I-BY138* —— Hg19 .BAM Ancient 8X, 22.8 Mbp, 32 bp YF010533 —— I-BY138* —— Hg19 .BAM FTDNA (Y500) 73X, 14.9 Mbp, 165 bp YF019250…

bedtools -u not giving unique files 1 The following are the steps Im following: First step to extract sample using bed file is this (here the bedfile is input bedfile converted to Hg38): tabix -h -R Hg19_to_Hg38_sorted.bed.gz gnomad.genomes.v{g_version}.hgdp_tgp.chr{chr}.vcf.bgz | perl {vcftools} -c {sample_name} > {sample_name}_out.vcf’ output({sample_name}_out.vcf’) chr2 113982416 rs56177103 TATAAAATAAAATAAA…

Hello, I have finished the RNA seq analysis and I am trying to perform some pathway analysis. I have used the gage package and I was looking online about another package called goseq that takes into account length bias. However, when I run the code I get an error. How…

R-FGC19851 – YFull YTree Info SNPs currently defining R-FGC19851 FGC19851     Sample ID Country / Language Info Ref File Testing company Statistics Status YF072967 United States (Georgia) R-FGC19851* —— Hg38 .BAM FTDNA (Y700) 34X, 18.7 Mbp, 151 bp YF009427 —— R-FGC65264* —— Hg19 .BAM FTDNA (Y500) 38X, 12.8 Mbp, 165…

Ethical compliance The research carried out in this study has been approved by the Swedish Board of Agriculture, Jordbruksverket: N343/12. Cell culture Mouse primary fibroblasts were derived from adult (>10 weeks old) CAST/EiJ × C57BL/6J or C57BL/6J × CAST/EiJ mice by skinning, mincing and culturing tail explants (for at least 10 d) in DMEM high…

Sample ID Country / Language Info Ref File Testing company Statistics Status YF016938 Saudi Arabia (Ar Riyāḍ) J-FGC35106 YF081770 | J-FGC35106*, J-FGC58682* Hg38 .BAM FTDNA (Y500) 30X, 11.5 Mbp, 151 bp YF016937 Saudi Arabia (Ar Riyāḍ) J-FGC35106 YF081769 | J-FGC35106*, J-FGC58682* Hg38 .BAM FTDNA (Y500) 37X, 12.5 Mbp, 151 bp…

DOI: 10.18129/B9.bioc.TAPseq     This package is for version 3.12 of Bioconductor; for the stable, up-to-date release version, see TAPseq. Targeted scRNA-seq primer design for TAP-seq Bioconductor version: 3.12 Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using…

Sample ID Country / Language Info Ref File Testing company Statistics Status ERS2478532 Turkmenistan Q-YP4024* —— Hg19 .BAM Scientific 17X, 16.7 Mbp, 151 bp YF006625 Russia (Tomskaya oblast’) / Selkup Q-YP4024* —— Hg19 .BAM FTDNA (Y500) 67X, 14.8 Mbp, 165 bp DA162 Russia (Severnaya Osetiya-Alaniya, Respublika) Q-BZ5214* —— Hg19 .BAM…

DOI: 10.18129/B9.bioc.branchpointer     Prediction of intronic splicing branchpoints Bioconductor version: Release (3.14) Predicts branchpoint probability for sites in intronic branchpoint windows. Queries can be supplied as intronic regions; or to evaluate the effects of mutations, SNPs. Author: Beth Signal Maintainer: Beth Signal <b.signal at garvan.org.au> Citation (from within R,…

Sample ID Country / Language Info Ref File Testing company Statistics Status AF2 —— Q-Y570 Q-Y570*, Q-F746* Hg19 .BAM Ancient 1X, 1.3 Mbp, 94 bp YF093124 —— Q-M120* —— Hg38 .BAM Nebula Genomics 57X, 23.6 Mbp, 150 bp Kolyma1 Russia (Sakha, Respublika [Yakutiya]) Q-Y222276* —— Hg19 .BAM Ancient 7X, 13.4…

TCGA Data download in terms of ease of use ,RTCGA The bag should be better , And because it’s already downloaded data , The use is relatively stable . But also because of the downloaded data , There is no guarantee that the data is new .TCGAbiolinks The package is…

E-PF6747 – YFull YTree Info Sample ID Country / Language Info Ref File Testing company Statistics Status YF010216 Azerbaijan (Qəbələ) E-PF6747* —— Hg19 .BAM FTDNA (Y500) 50X, 13.7 Mbp, 165 bp YF064736 Egypt (Al Minūfīyah) E-FT97857* —— Hg38 .BAM FTDNA (Y700) 35X, 18.5 Mbp, 151 bp YF093064 Yemen (Tā’izz) E-Y280593…

Circular RNAs (circRNAs) are a novel class of noncoding RNAs that play important roles in human diseases. However, the regulation of circRNAs in glucocorticoid-induced osteoporosis (GIOP) has not been reported. In this study, we performed high-throughput sequencing to identify altered circRNAs in the vertebrae from GIOP patients. A total of…

Variant #0000726648 (NC_000017.10:g.7100169G>A, ACADVL(NM_000018.3):c.-23135G>A) Chromosome 17 Allele Unknown Affects function (as reported) Effect unknown Affects function (by curator) Not classified Classification method – Clinical classification VUS DNA change (genomic) (Relative to hg19 / GRCh37) g.7100169G>A DNA change (hg38) – Published as DLG4(NM_001321075.2):c.990C>T (p.G330=) ISCN – DB-ID DLG4_000038 Variant remarks VKGL data sharing initiative Nederland Reference – ClinVar ID – dbSNP ID – Origin CLASSIFICATION record Segregation – Frequency – Re-site –…

Variant #0000803285 (NC_000007.13:g.92730753A>G, SAMD9(NM_017654.3):c.4658T>C) Chromosome 7 Allele Unknown Affects function (as reported) Effect unknown Affects function (by curator) Not classified Classification method – Clinical classification VUS DNA change (genomic) (Relative to hg19 / GRCh37) g.92730753A>G DNA change (hg38) – Published as SAMD9(NM_017654.3):c.4658T>C (p.I1553T), SAMD9(NM_017654.4):c.4658T>C (p.I1553T) ISCN – DB-ID SAMD9_000024 See all 3 reported entries Variant remarks VKGL data sharing initiative Nederland Reference – ClinVar ID – dbSNP ID – Origin CLASSIFICATION…

Sample ID Country / Language Info Ref File Testing company Statistics Status YF003382 Finland (Länsi-Suomen lääni) I-Z2040* —— Hg19 .BAM FTDNA (Y500) 47X, 13.3 Mbp, 165 bp YF067917 Ireland I-FGC69701* —— Hg19 .BAM Dante Labs 9X, 22.9 Mbp, 151 bp YF078735 Belarus (Vicebskaja voblasc’) / Polish I-FGC69702 —— Hg38 .VCF…

E-BY7447 – YFull YTree Info SNPs currently defining E-BY7447 BY7447     Sample ID Country / Language Info Ref File Testing company Statistics Status YF075635 Yemen (Al Bayḑā’) E-FT183181 —— Hg38 .BAM FTDNA (Y700) 39X, 18.2 Mbp, 151 bp YF067501 Yemen (Şan’ā’) E-FT183181 —— Hg38 .BAM FTDNA (Y700) 44X, 18.8 Mbp,…

Sample ID Country / Language Info Ref File Testing company Statistics Status YF016926 Ireland R-DF109 R-DF109*, R-A18726* Hg38 .BAM FTDNA (Y500) 27X, 12.7 Mbp, 165 bp YF016394 United States (Ohio) R-DF109 R-DF109*, R-A18726* Hg38 .BAM FTDNA (Y500) 34X, 11.9 Mbp, 151 bp YF011566 Ireland (Mayo) R-DF109 R-DF109*, R-A18726*, R-FGC23742* Hg38…

R-ZP77 – YFull YTree Info SNPs currently defining R-ZP77 ZP77 / FGC6562     Sample ID Country / Language Info Ref File Testing company Statistics Status YF008362 —— R-ZP77* —— Hg19 .BAM FTDNA (Y500) 41X, 13.8 Mbp, 165 bp YF067652 Unknown R-BY40744 —— Hg38 .BAM FTDNA (Y700) 36X, 18.7 Mbp, 151…

Download full list of SNPs and their coordinates in hg38 3 What is the best / standard place to get a full list of SNPs and their coordinates in hg38? I downloaded the SNPsnap database, but just realized that those coordinates are in hg19. I’m trying to figure out how…

I found a little problem. When I set the “-t gene”, the reads is mark “__no_feature”. But when I set the “-t exon”, the reads is mark “ENSG00000276104”. The gene “ENSG00000276104” is a single exon gene. I don’t know why this happens. reads: “TGTCTGTGGCGGTGGGATCCCGCGGCCGTGTTTTCCTGGTGGCCCGGCCGTGCCTGAGGTTTCTCCCCGAGCCGCCGCCTCTGCGGGCTCCCGGGTGCCCTTGCCCTCGCGGTCCCCGGCCCTCGCCCGTCTGTGCCCTCTTCCCCGCCCGCCGATCCTCTTCTTCCCCCCGAGCGGCTCACCGGCTTCACGTCCGTTGGTGGCCCCGCCTGGGAC”. I had aligned to hg38 by…

    This package is for version 3.1 of Bioconductor; for the stable, up-to-date release version, see ChIPQC. Quality metrics for ChIPseq data Bioconductor version: 3.1 Quality metrics for ChIPseq data Author: Tom Carroll, Wei Liu, Ines de Santiago, Rory Stark Maintainer: Tom Carroll <tc.infomatics at gmail.com>, Rory Stark <rory.stark…

Our version of TS is 5.12.2 When trying to upload new custom reference fasta (downloaded from ncbi ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz, gunzipped and renamed to hg38.fasta) through “Import custom reference” in interface an error occures: “uploaded file size is incorrect” (to be honest the error was not shown in logs, because of TypeError…

help with CrossMap 0 Hello all, I would really appreciate your help as I am new to working with different file builds and having a setback lifting a vcf file from build hg38 to hg19. in essence, using CrossMap the chromosome value gets altered. Like for example, below is the…

Significance Genetic investigations of most structural birth defects, including spina bifida (SB), congenital heart disease, and craniofacial anomalies, have been underpowered for genome-wide association studies because of their rarity, genetic heterogeneity, incomplete penetrance, and environmental influences. Our systems biology strategy to investigate SB predisposition controls for population stratification and avoids…

I’ve got sequencing data for a small 500 bp amplicon from a few samples. GATK best principles suggest running VariantRecalibrator on the GVCF files I generate. I’m trying to get this working, but I get an error about “Found annotations with zero variances”. Reading the gatk manual and other posts…

computeMatrix in deeptool is Running with no result 0 Hi All, I wonder if someone can help me in explaining what to input on the -R <bed file> argument of the code below? computeMatrix scale-regions -S <bigwig file(s)> -R <bed file> -b 1000 what I did for example, I download…

NoClassDefFoundError: htsjdk/samtools/util/IntervalTree 0 When I run circm6A (github.com/canceromics/circm6a) example code: cd ../.. java -Xmx16g -jar circm6a.jar -ip test_data/HeLa_eluate_rep_1.chr22.bam -input test_data/HeLa_input_rep_1.chr22.bam -r test_data/gencode_chr22.gtf -g test_data/hg38_chr22.fa -o test_data/example_Hela The following error occurred: Start at 2021-12-12 16:33:26 Exception in thread “main” java.lang.NoClassDefFoundError: htsjdk/samtools/util/IntervalTree at main.Method.loadGenes(Method.java:200) at main.Method.run(Method.java:66) at main.Main.main(Main.java:9) Caused by: java.lang.ClassNotFoundException: htsjdk.samtools.util.IntervalTree…

transcripts are not true in TxDb.Hsapiens.UCSC.hg38.knownGene 1 @11b02720 Last seen 2 hours ago United States Hello, I used TxDb.Hsapiens.UCSC.hg38.knownGene/GenomicFeatures to retrieve gene promoters and other genomic features. here is code: library(‘TxDb.Hsapiens.UCSC.hg38.knownGene’) txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene PR <- promoters(txdb, upstream=2000, downstream=0) but when I take a look at the PR results: it…

I’m trying to use recalibrate my vcf using gatk VariantRecalibrator, but keep getting an error “Illegal argument value: Positional arguments were provided”. But I don’t know what this means, or how to correct it! Here’s my call: gatk VariantRecalibrator -R “/Volumes/Seagate Expansion Drive/refs/hg38/gatk download/Homo_sapiens_assembly38.fasta” -V “$OUT”/results/variants/”$SN”.norm.vcf.gz -AS –resource hapmap,known=false,training=true,truth=true,prior=15.0: “/Volumes/Seagate…

The Single Nucleotide Polymorphism Database (dbSNP) is a free public archive for genetic variation within and across different species developed and hosted by the National Center for Biotechnology Information (NCBI) in collaboration with the National Human Genome Research Institute (NHGRI). Furthermore, are there any databases for single nucleotide polymorphisms?As there…

Removing uncovered transcripts from multi FASTA reference file 0 Hi everyone 🙂 for RNASeq analyses, I have a reference file, containing multiple transcript sequences (it´s a subset of the NCBI human hg38 transcriptome). I found, that some of the transcripts are not even covered by a single read (especially if…

The Biostar Herald publishes user submitted links of bioinformatics relevance. It aims to provide a summary of interesting and relevant information you may have missed. You too can submit links here. This edition of the Herald was brought to you by contribution from Istvan Albert, and was edited by Istvan…

Hi, I have been trying to get a dosage file from vcf, map and fam files. For that, I have written this bash script : plink –fam plink.fam –map plink.map –dosage one.vcf –write-dosage However, I got this error: –dosage: Reading from one.vcf. Error: Line 1 of one.vcf has fewer tokens…

What is the codification in genestrand 1 and 2? 0 Hi there, I’m doing some peak annotation using ChIPseeker library(ChIPseeker) library(TxDb.Hsapiens.UCSC.hg38.knownGene) library(clusterProfiler) library(annotables) library(org.Hs.eg.db) txdb <- TxDb.Hsapiens.UCSC.hg38.knownGene peaks= readPeakFile(“peaks_”, header = F) peakAnno <- annotatePeak(peaks, tssRegion=c(-3000, 3000), TxDb=txdb, annoDb=”org.Hs.eg.db”) peaks_annot <- as.data.frame(peakAnno) In my annotation file “geneStrand” is codified as…

Best tools for calling structural variants from 2 assemblies? 0 Dear community, I have the fasta files of 2 assemblies of the human genome (for example hg19 and hg38). What would be the best tools to call structural variants from these 2 fasta files? Most of the tools I know…

I have written a rule for CombineGVCFs in gatk4. The rule is as follow all_gvcf = get_all_gvcf_list() rule cohort: input: all_gvcf_list = all_gvcf, ref=”/data/refgenome/hg38.fa”, interval_list = prefix+”/bedfiles/hg38.interval_list”, params: extra = “–variant”, output: prefix+”/vcf/cohort.g.vcf”, shell: “gatk CombineGVCFs -R {input.ref} {params.extra} {input.all_gvcf_list} -O {output} –tmp-dir=/data/tmp -L {input.interval_list}” all_gvcf is the dataset for…

This is due to the fact that the very reference genomes that we use for re-alignment are themselves based on individuals who carry rare risk alleles. Thus, when we call variants against these genomes, we are, at many loci, comparing against rare disease risk alleles. As the best/worst example (depending…

mixing hg38 and GRCh38 during variant calling 0 Hello everyone! I’ve been working on a variant calling pipeline for WES data and used a mix of hg38 and GRCh38 reference files after reading that hg38 is just an abbreviation of GRCh38, and that they refer to the same thing. But…

SNP exon region UCSC 2 how i can get SNP in only exons regions genome with UCSC? UCSC get the all SNP of gene region, and there is no filter option to get only exon region. tx ucsc SNP exon • 245 views • link updated 2 hours ago by…

Description Somatic single nucleotide variants (SNVs) in cancer genome affect gene expression through various mechanisms depending on their genomic location. In this study, we found that somatic SNVs near splice site are associated with abnormal intronic polyadenylation (IPA) . Here we give examples to show how to detect SNV-associated IPA…

Where can I get ?or how can I make a mappability track for hg38 assembly 2 Lucky you @manojmumar_bhosale I worked on similar problem recently and therefore have the bash script you can use. Required tools: GEM libary from here UCSC’s wigToBigWig from here (I chose binary for Linux 64…

How to load user-defined genome in IGV-webapp 0 I would like to create a session in IGV-webapp using a HTML file. The following works with pre-defined genomes (g.e. genome: “hg38”), but I would like to load my own genome. Is there a way to achieve this? <!DOCTYPE html> <html lang=”en”>…

Hello, We have an FAQ page that covers this topic (genome.ucsc.edu/FAQ/FAQgenes.html#singledownload). As posted by ATpoint, it boils down to different datasets and different approaches. hg19 knownCanonical was last updated in 2013 and built primarily from RefSeq and GenBank sequences and a few other sources. One isoform was identified from each…

Here is a fairly efficient way to do this; assuming hg38 and BEDOPS and standard Unix tools installed. $ bedmap –echo –echo-map-id –delim ‘t’ <(awk ‘{n=split($0,a,/[:_]/); print “chr”a[1]”t”a[2]”t”a[2]+1″t”a[3]”https://www.biostars.org/”a[4];}’ sumstats.txt | sort-bed -) <(wget -qO- hgdownload.cse.ucsc.edu/goldenPath/hg38/database/snp150.txt.gz | gunzip -c | cut -f2-5 | sort-bed -) > answer.bed This gets around making…

UCSC liftover 2 Hi, I’m using UCSC liftover to convert hg19 to hg38. The result came out that I don’t understand. Feb. 2009 (GRCh37/hg19) → Dec. 2013 (GRCh38/hg38) – chr1:120904787 → chr1:143905854 Dec. 2013 (GRCh38/hg38) → Feb. 2009 (GRCh37/hg19) – chr1:143905854 → chr1:149400430 (I didn’t check “Allow multiple output regions”.)…

Hi Everyone, I am currently looking at Acute Myeloid Leukemia (AML) paired-end WGS samples from the TARGET data ocg.cancer.gov/programs/target/target-methods#3241. A bioinformatician in our group remapped the samples from hg19 to hg38. Unfortunately, we do not have any copies of the hg19 version anymore. However, when I try to run anything…

Coverage drops in fastq alignment against custom Immunoglobulin reference 0 I am working on Hiseq2000/2500 single end reads on RNASeq leukemia samples. I am interested in aligning all the reads beloging to the Immunoglobulin genes (Ig) for further analysis. The task is difficult for two main reasons: Final Ig genes…

vcf file analysis 0 Hello everyone, I have 22 vcf file for each chr. They were in genome build hg19 so I did a liftover and convert them to hg38 genome build. Now I need just chrom and position values from these vcf files and merge them together into a…

DOI: 10.18129/B9.bioc.BSgenome.Hsapiens.UCSC.hg38.dbSNP151.major     Full genome sequences for Homo sapiens (UCSC version hg38, based on GRCh38.p12) with injected major alleles (dbSNP151) Bioconductor version: Release (3.13) Full genome sequences for Homo sapiens (Human) as provided by UCSC (hg38, based on GRCh38.p12) with major allele injected from dbSNP151, and stored in Biostrings…

tool or database to convert Gene ID to genomic position 1 Hello.I have lots of Pseudogene IDs like LOC100431174 but none of the below methods worked for me to find their genomic position “offline”. I need a table or package to do it offline without querying to a webpage.methods I…

featureCounts: unable to find chromosome in SAM header 0 I am using featureCounts to try and create a count table for some RNA-Seq data I collected using an Oxford Nanopore platform. I have .sam files aligned with minimap2, and am running the following command to try to get a count…

miRNAseq analysis not shown adapter sequence and huge N’s content 0 Hi there, This is my third time doing miRNA sequencing analysis, so i do not have huge experience on this… So, i have 18 human semen samples, (also no experience in this type samples) i have been reading alot…

INTRODUCTION The development of novel cancer therapies requires knowledge of specific biological pathways to target individual tumors and eradicate cancer cells. Toward this goal, the landscape of genetic vulnerabilities of cancer, or the cancer dependency map, is being systematically profiled. Using RNA interference (RNAi) loss-of-function screens, Marcotte et al. (1),…

liftover using genome browser 0 Hello everyone, I have a file which is hg38 build. I want to do a liftover and change it to hg19. I thought of using liftover tool from UCSC genome browser. I realise that the input file should be bed format. My file has only…

Hi, I am trying to run the following command: gatk VariantRecalibrator -R genome.fa -V all.Sample.SNP.vcf.gz –trust-all-polymorphic -tranche 100.0 -tranche 99.95 -tranche 99.9 -tranche 99.8 -tranche 99.6 -tranche 99.5 -tranche 99.4 -tranche 99.3 -tranche 99.0 -tranche 98.0 -tranche 97.0 -tranche 90.0 -an MQRankSum -an ReadPosRankSum -an FS -an MQ -an SOR…

Get chromosome sizes from fasta file 4 Hello, I’m wondering whether there is a program that could calculate chromosome sizes from any fasta file? The idea is to generate a tab file like the one expected in bedtools genomecov for example. I know there’s the fetchChromSize program from UCSC, but…

Badly formed genome unclippedLoc: Contig chr1 given as location, but this contig isn’t present in the Fasta sequence dictionary 2 Hi everyone, I’m trying to run Mutect2 for WES cancer data. However, since their Resource bundle only supports h19 seems I cannot proceed (I want to compare it with Strelka2…

Using MACS2 parameters 0 Trying to reproduce a galaxy training in Linux CLI. I’ve come up with the following commands for the peak calling with MACS2. Am I on the right track? The galaxy parameters are- macs2 command can be- macs2 callpeak -t input_file.bed -n macs_output -g 50818468 –nomodel –shift…

Non-repeat human genome dataset 1 Could anyone please point me to where I could find a dataset of non-repeat sequences for the human ref genome. I’m not sure if it’s still regarded as true, but I saw that possibly 2/3 of the human genome contains repeats. Is there a place…

Hi everybody, I would like to phase (just phasing, not imputation) vcf file containing about 1100 individuals (a given human population) derived from whole genome sequencing, the vcf file obtained by GATK. As I searched, SHAPEIT was mostly used; based on its manual, it requires genetic map for phasing, however,…

Thanks for the question – it has kept me busy this Sunday morning / afternoon. As implied by others, this poses a computational challenge but is not insurmountable. For motif searching generally, I usually use AWK. My approach here was to: generate all possible k-mers of the chosen size (run…

question about running CIRI-full 1 I’m using ciri-full to calculate the full length sequence of circRNAs ,and I can run the test data set successfully, but I can’t run my own data running test data set: java -jar ../CIRI-full.jar Pipeline -1 test_1.fq.gz -2 test_2.fq.gz -a test_anno.gtf -r test_ref.fa -d test_output/…

Hello i am trying to change my nebula Genomics report to 23 and me Format i have to problems nebula uses 38 human ensemble and 23 and me 37, I was thinking to do a python script but i have some doubts: My plan was to change the genotype according…